CN109504757A

CN109504757A - Detect the method and kit of ubiquitin protein enzyme gene PS MB1 promotor polymorphism

Info

Publication number: CN109504757A
Application number: CN201811444470.1A
Authority: CN
Inventors: 黄薇; 牛振民; 施锦绣; 张晨辉
Original assignee: Shanghai Industrial Institute For Research And Technology; Shanghai Human Genome Research Center
Current assignee: Shanghai Industrial Institute For Research And Technology; Chinese National Human Genome Center at Shanghai; Shanghai Human Genome Research Center
Priority date: 2018-11-29
Filing date: 2018-11-29
Publication date: 2019-03-22

Abstract

The invention discloses a kind of methods and kit for detecting ubiquitin protein enzyme gene PS MB1 promotor polymorphism, wherein, the method of detection includes: to detect the PSMB1 gene promoter region sequence of the individual, and compared with normal PSMB1 gene promoter region sequence, has differences and indicate that the individual is polymorphic with the specific promoter of PSMB1 gene；The kit includes: the primer of specific amplification PSMB1 gene, and it is 100-2000bp and containing the 321st in SEQ ID NO.1 amplified production that the primer amplification, which goes out length,.The present invention can use the genotype situation of detection ubiquitin protein enzyme gene PS MB1 promotor polymorphism rs12527072.

Description

Detect the method and kit of ubiquitin protein enzyme gene PS MB1 promotor polymorphism

Technical field

The invention belongs to field of biotechnology, more particularly it relates to a kind of detection ubiquitin protein enzyme gene PS MB1 The method and kit of promotor polymorphism.

Background technique

PSMB1 gene is located at 6q27, and size is about 22Kbp, and it is one that the product of coding, which belongs to proteasome Type B family, 20S core beta subunit in kind uiquitin-protease multienzyme complex.Proteasome is a kind of albumen being present in cytoplasm and karyon Hydrolyze multienzyme complex, be responsible for the intracellular most of protein of degradation, MHC I class molecule include HLA-B27 molecule expression and It plays a crucial role in related antigen presentation.The antigen of MHC I class molecular presentation derives from the catabolite of proteasome. Regulation of the function of proteasome by its structure composition, the four circular cylindrical knots that core is made of α and β subunit Structure, in conjunction with PA28 after become immunoproteasome.PSMB1 is subunit important in β ring.The change of β ring will affect To protein degradation matter speed and cleavage site and endogenous protein degradation and antigen presentation.

Also, the promotor polymorphism of PSMB1 gene affects the expression of gene, causes endogenous protein of degrading The quantity and property of the Antigenic Peptide of generation change.

Therefore, novel method and reagent that this field is detected it is necessary to develop the promotor polymorphism of progress PSMB1 gene, With realize quickly, conveniently, accurate detection.

Summary of the invention

The purpose of the present invention is to provide a kind of methods and examination for detecting ubiquitin protein enzyme gene PS MB1 promotor polymorphism Agent box.

In the first aspect of the present invention, a kind of utilization genotype detection ubiquitin protein enzyme gene PS MB1 promoter region is provided The kit of polymorphism, comprising: the primer of specific amplification PSMB1 gene or genetic fragment, the primer amplification go out to contain Corresponding to the amplified production of the 321st nucleotide in SEQ ID NO:1.

In a preferred embodiment, the kit also contains reagent selected from the group below:

1) the specific nucleotide (preferably, further including its neighbouring nucleotide) with the 321st in SEQ ID NO:1 is tied The probe of conjunction；

2) limitation of the 321st nucleotide (preferably, further including its neighbouring nucleotide) in SEQ ID NO:1 is identified Property restriction endonuclease.

In another preferred example, described 321st there are single nucleotide polymorphism below:

321st T → A；Wherein, nucleotide position number is based on SEQ ID NO:1.

In another preferred example, the sequence of the primer is as shown in SEQ ID NO:3 and SEQ ID NO:4.

In another preferred example, the length of the amplified production is 100-2000bp.

It in another preferred example, further include substance selected from the group below: the extraction agent of DNA, PCR amplification in the kit Reagent (such as archaeal dna polymerase), endonuclease reaction reagent, electrophoresis reagents, and/or illustrate the operation instruction of pleiomorphism detecting method Book.

In another aspect of this invention, one kind is provided and detects ubiquitin protein enzyme gene PS MB1 promoter region nondiagnosticly The method of polymorphism, comprising:

(1) nucleic acid samples of sample to be tested are obtained；

(2) the PSMB1 gene of the nucleic acid samples is detected, it is determined whether exist corresponding to the 321st in SEQ ID NO:1 The polymorphism of nucleotide.

In a preferred embodiment, described 321st there are single nucleotide polymorphism below: the 321st T → A；Wherein, Nucleotide position number is based on SEQ ID NO:1.

In another preferred example, it in step (2), is detected using PCR amplification and PCR sequencing PCR.

In another preferred example, PCR expansion is carried out with sequence primer as shown in SEQ ID NO:3 and SEQ ID NO:4 Increase；Also, PCR reaction condition are as follows:

(1) 94 DEG C initial denaturation 2 minutes；

(2) 94 DEG C are denaturalized 30 seconds, and 63 DEG C are annealed 40 seconds, and 72 DEG C extend 40 seconds, above-mentioned to carry out 10 circulations, each circulation altogether Annealing temperature is successively decreased 0.5 DEG C；

(3) 94 DEG C are denaturalized 30 seconds, and 58 DEG C are annealed 40 seconds, and 72 DEG C extend 40 seconds, above-mentioned to carry out 30 circulations altogether；

(4) 72 DEG C extend 7 minutes.

Other aspects of the invention are apparent to those skilled in the art due to this disclosure 's.

Detailed description of the invention

The schematic diagram of Fig. 1, SNP site of the present invention and its polynucleotide sequence adjacent to sequence；Wherein box position It sets as polymorphic site of the present invention；Two sections of underline positions are primer binding sites.

Specific embodiment

The present inventor after extensive and in-depth study, is directed to ubiquitin protein enzyme gene PS MB1 promotor polymorphism (SNP), the present inventor devises the detection method of a kind of based on PCR and sequencing, and that this method has is accurate, convenient, can operate The strong feature of property.

The present invention provides the sides that one kind detects ubiquitin protein enzyme gene PS MB1 promoter region polymorphism nondiagnosticly Method, comprising: (1) obtain the nucleic acid samples of sample to be tested；(2) the PSMB1 gene of the nucleic acid samples is detected, it is determined whether there are phases Should in SEQ ID NO:1 the 321st nucleotide polymorphism.Described 321st there are single nucleotide polymorphism below: 321st T → A；Wherein, nucleotide position number is based on SEQ ID NO:1.

In a preferred embodiment of the present invention, it is detected with PCR amplification and PCR sequencing PCR.By being directed to ubiquitin protein enzyme Gene PS MB1 promoter design primer need to only pass through a routine PCR reaction, the additional sequencing for relying on existing microarray dataset Technology can reach the purpose of detection SNP genotype.Verified, method of the invention is easy to operate, and high sensitivity, reproduction Property is good.Suitable for the detection to ubiquitin protein enzyme gene PS MB1 promotor polymorphism.

For the present inventor by the screening to primer, obtaining one kind can specific amplified ubiquitin protein enzyme gene PS MB1 promoter The primer of particular section, the primer have nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:4, specificity Expanding effect is good, PCR amplification of the PCR amplification success rate close to 100%, especially suitable for complex system.

These primers of the invention can also use radioactive isotope, biotin, enzyme, fluorescein or other chemiluminescent substances Matter is marked.

It, can also be further using the 321st in specificity and SEQ ID NO:1 nucleosides in technical solution of the present invention Sour (preferably, further including its neighbouring nucleotide) in conjunction with probe detected；Or using specific recognition SEQ ID The restriction enzyme of the 321st nucleotide (preferably, further including its neighbouring nucleotide) detected originally in NO:1.

For example, Taqman real time fluorescent PCR method can be used to carry out the identification of the SNP.TaqMan probe method is high Special quantitative PCR technique is spent, core is 3 ' → 5 ' exonuclease activities using Taq enzyme, cuts off probe, generates fluorescence Signal.Since probe and template are specific bindings, so the power of fluorescence signal just represents the quantity of template.

The method for obtaining the DNA of sample to be tested is technology well-known to those skilled in the art, such as can be taken traditional Phenol/chloroform/isoamyl alcohol method, or some commercially available DNA extraction kits can be used, this kind of kit is those skilled in the art It is well known.

Using primer and probe of the invention, polymerase chain reaction (PCR) and sequencing need to be only carried out, and corresponding by judgement Polymorphic site nucleotide, and required sample size is seldom.Round pcr is technology well known to those skilled in the art, The basic principle is that the method for external enzyme' s catalysis specific DNA fragment.

PCR reaction system in generally include: PCR reaction buffer, dNTPs, DNA sample to be measured, up/down trip primer, Archaeal dna polymerase, sterile deionized water.

Part or all of polynucleotides of the invention can be used as probe and be fixed on microarray (microarray) or DNA On chip (also known as " genetic chip "), for analyzing the Differential expression analysis of gene and gene diagnosis in tissue.With PSMB1 egg The primer of Bai Teyi carries out RNA- polymerase chain reaction (RT-PCR) amplification in vitro also and can detect the transcription product of PSMB1 albumen.

Detection of the present invention can be directed to cDNA, can also be directed to genomic DNA；The detection can be for multiple The sample of miscellaneous system.

As preferred embodiment of the invention, in order to cooperate nucleotides sequence shown in SEQ ID NO:3 and SEQ ID NO:4 Column, optimize PCR amplification effect, and the PCR reaction condition that the present inventor additionally provides optimization comprises the following steps that

(1) 94 DEG C initial denaturation 2 minutes；

(4) 72 DEG C extend 7 minutes.

The present invention also provides a kind of examinations using genotype detection ubiquitin protein enzyme gene PS MB1 promoter region polymorphism Agent box contains primer shown in SEQ ID NO:3 and SEQ ID NO:4 in the kit.In a preferred embodiment of the present invention, Also contain specificity in the kit with the 321st in SEQ ID NO:1 nucleotide (preferably, further including that its is neighbouring Nucleotide) probe that combines, or in identification SEQ ID NO:1 the 321st nucleotide (preferably, further including that its is neighbouring Nucleotide) restriction enzyme.

In addition, the kit can also contain other reagents, such as (but not limited to):

(A) various PCR reaction reagents, such as, but not limited to: Taq enzyme, PCR buffer, dNTP, archaeal dna polymerase etc.；Or

(B) reagent needed for various extraction DNA (preparing PCR reaction template), such as, but not limited to: phenol, chloroform, isoamyl Alcohol, NaCl etc.；Or

(C) kit of DNA is extracted.

In addition, can also contain the operation instructions for being described kit operating method and/or standard behaviour in the kit Make program.

Kit of the invention can be used for the auxiliary diagnosis of PSMB1 protein related diseases.In terms of diagnosis, PSMB1 albumen Polynucleotide polymorphism can be used for judging PSMB1 albumen expression whether or under morbid state PSMB1 albumen it is different Often expression.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or According to the normal condition proposed by manufacturer.

The acquisition and identification of embodiment 1, SNP

One, research object

On the basis of informed consent, the peripheral blood sample of people is had collected.

Two, experimental method and result

1, DNA is extracted

Extracting DNA from the peripheral blood sample of people with conventional phenol-chloroform method (can also be used commercialized kit, extracts DNA), after concentration correction to 20ng/ μ l, it is used for standard PCR amplification.

2, for the design of primers in PCR and sequencing

According to the genome sequence of PSMB1 in GenBank, the following primer of design and synthesis:

Sense primer P1:tgcatctgcttttcaatgct (SEQ ID NO:3)；

Antisense primer P2:GCCTGtgtatgagtggctga (SEQ ID NO:4).

3, the PCR amplification of PSMB1 gene

Using the DNA of extraction as template, PCR is carried out with Touchdown program on GeneAmp 9700PCR instrument with Taq enzyme Amplification.

PCR reaction condition are as follows:

(1) 94 DEG C initial denaturation 2 minutes；

(4) 72 DEG C extend 7 minutes.

Pcr amplification product is verified through agarose gel electrophoresis.As a result, obtaining the amplified production of PSMB1 gene.

4, the discovery and detection of SNP

PCR product is after Resin purifying resin, with ABI-3730DNA sequenator (Applied biosystems Appliedbiosystems (ABI)) be sequenced, with Polyphred software (Washington, DC university http: // Droog.mbt.washington.edu/Polyphred.html interpretation, Genotyping and the SNP confirmation of sequence) are carried out.

The schematic diagram of sequence comprising the SNP site is shown in Fig. 1, and in the sequence, the 321st W is as of the present invention Polymorphic site；67th~86 bit slice section and the 616th~635 bit slice section are set to primer binding sites, amplified production size For 569bp.

The corresponding polynucleotide sequence of the gene promoter area PSMB1 of wild type is as follows:

Atttcagttaccttaaaaagtcccttcttcccctttatagtcactctgctggccccaggtaactactg catctgcttttcaatgctgaagattagttttgtctattctagaatttcatatagatggaatcagagtgtatgcttt tttgtgtatgtctgacttcttagcccagtgtactgtttgtatatcagtagttaatccattgtatagctaagtatca ctccattgtttggatgttccacagttcatccattctccagttgctcacatttggggtctttccagtttggagctat tgcgaataaaagcactgtaaacatTtgtgtagactttgaatgcactgtttttacttctcatgggtaaatacttagg agtaggattgctaggtcctatattggtatatgtataactttataagaaactgccaaactgttttttgaagtggctg tattgttttgcagcataagagatttaagttgctccacatcctcaccaacactttctgctgtcagtctttttacttt cactctagtgattgcttagtagtatcttattgtggttttgatttttatttgcctgattactaatgtttctgagcac cttggcaagtgcttgtcagccactcatacaCAGGCCcacctcactttactgcacttcactttactgcatgtttgac aaattgaaggttgtggtaaacctgtacccagcaagtctgttggcattatttttccaaaagtgtgt(SEQ ID NO: 1)

The corresponding polynucleotide sequence of the gene promoter area PSMB1 of saltant type is as follows:

Atttcagttaccttaaaaagtcccttcttcccctttatagtcactctgctggccccaggtaactactg catctgcttttcaatgctgaagattagttttgtctattctagaatttcatatagatggaatcagagtgtatgcttt tttgtgtatgtctgacttcttagcccagtgtactgtttgtatatcagtagttaatccattgtatagctaagtatca ctccattgtttggatgttccacagttcatccattctccagttgctcacatttggggtctttccagtttggagctat tgcgaataaaagcactgtaaacatAtgtgtagactttgaatgcactgtttttacttctcatgggtaaatacttagg agtaggattgctaggtcctatattggtatatgtataactttataagaaactgccaaactgttttttgaagtggctg tattgttttgcagcataagagatttaagttgctccacatcctcaccaacactttctgctgtcagtctttttacttt cactctagtgattgcttagtagtatcttattgtggttttgatttttatttgcctgattactaatgtttctgagcac cttggcaagtgcttgtcagccactcatacaCAGGCCcacctcactttactgcacttcactttactgcatgtttgac aaattgaaggttgtggtaaacctgtacccagcaagtctgttggcattatttttccaaaagtgtgt(SEQ ID NO: 2)

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>Shanghai Industrial Institute for Research and Technology;Research Center of Shanghai Human Genome

<120>method and kit of ubiquitin protein enzyme gene PS MB1 promotor polymorphism are detected

<130> 186322

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 741

<212> DNA

<213>homo sapiens (Homo sapiens)

<400> 1

atttcagtta ccttaaaaag tcccttcttc ccctttatag tcactctgct ggccccaggt 60

aactactgca tctgcttttc aatgctgaag attagttttg tctattctag aatttcatat 120

agatggaatc agagtgtatg cttttttgtg tatgtctgac ttcttagccc agtgtactgt 180

ttgtatatca gtagttaatc cattgtatag ctaagtatca ctccattgtt tggatgttcc 240

acagttcatc cattctccag ttgctcacat ttggggtctt tccagtttgg agctattgcg 300

aataaaagca ctgtaaacat ttgtgtagac tttgaatgca ctgtttttac ttctcatggg 360

taaatactta ggagtaggat tgctaggtcc tatattggta tatgtataac tttataagaa 420

actgccaaac tgttttttga agtggctgta ttgttttgca gcataagaga tttaagttgc 480

tccacatcct caccaacact ttctgctgtc agtcttttta ctttcactct agtgattgct 540

tagtagtatc ttattgtggt tttgattttt atttgcctga ttactaatgt ttctgagcac 600

cttggcaagt gcttgtcagc cactcataca caggcccacc tcactttact gcacttcact 660

ttactgcatg tttgacaaat tgaaggttgt ggtaaacctg tacccagcaa gtctgttggc 720

attatttttc caaaagtgtg t 741

<210> 2

<211> 741

<212> DNA

<213>homo sapiens (Homo sapiens)

<400> 2

atttcagtta ccttaaaaag tcccttcttc ccctttatag tcactctgct ggccccaggt 60

aactactgca tctgcttttc aatgctgaag attagttttg tctattctag aatttcatat 120

agatggaatc agagtgtatg cttttttgtg tatgtctgac ttcttagccc agtgtactgt 180

ttgtatatca gtagttaatc cattgtatag ctaagtatca ctccattgtt tggatgttcc 240

acagttcatc cattctccag ttgctcacat ttggggtctt tccagtttgg agctattgcg 300

aataaaagca ctgtaaacat atgtgtagac tttgaatgca ctgtttttac ttctcatggg 360

taaatactta ggagtaggat tgctaggtcc tatattggta tatgtataac tttataagaa 420

actgccaaac tgttttttga agtggctgta ttgttttgca gcataagaga tttaagttgc 480

tccacatcct caccaacact ttctgctgtc agtcttttta ctttcactct agtgattgct 540

tagtagtatc ttattgtggt tttgattttt atttgcctga ttactaatgt ttctgagcac 600

cttggcaagt gcttgtcagc cactcataca caggcccacc tcactttact gcacttcact 660

ttactgcatg tttgacaaat tgaaggttgt ggtaaacctg tacccagcaa gtctgttggc 720

attatttttc caaaagtgtg t 741

<210> 3

<211> 20

<212> DNA

<213>primer (Primer)

<400> 3

tgcatctgct tttcaatgct 20

<210> 4

<211> 20

<212> DNA

<213>primer (Primer)

<400> 4

gcctgtgtat gagtggctga 20

Claims

1. a kind of kit using genotype detection ubiquitin protein enzyme gene PS MB1 promoter region polymorphism, which is characterized in that Include: the primer of specific amplification PSMB1 gene or genetic fragment, the primer amplification goes out to contain corresponding to SEQ ID NO: The amplified production of 321st nucleotide in 1.

2. kit as described in claim 1, which is characterized in that the kit also contains reagent selected from the group below:

1) probe of the specificity in conjunction with the 321st nucleotide in SEQ ID NO:1；

2) restriction enzyme of the 321st nucleotide in SEQ ID NO:1 is identified.

3. kit as claimed in claim 1 or 2, which is characterized in that described 321st there are mononucleotide polymorphics below Property:

321st T → A；Wherein, nucleotide position number is based on SEQ ID NO:1.

4. kit as described in claim 1, which is characterized in that the sequence of the primer such as SEQ ID NO:3 and SEQ ID Shown in NO:4.

5. kit as described in claim 1, which is characterized in that the length of the amplified production is 100-2000bp.

6. kit as described in claim 1, which is characterized in that further include substance selected from the group below: DNA in the kit Extraction agent, PCR amplification reagent, endonuclease reaction reagent, electrophoresis reagents, and/or illustrate that the use of pleiomorphism detecting method is said Bright book.

7. the method that one kind detects ubiquitin protein enzyme gene PS MB1 promoter region polymorphism nondiagnosticly, which is characterized in that packet It includes:

(1) nucleic acid samples of sample to be tested are obtained；

(2) the PSMB1 gene of the nucleic acid samples is detected, it is determined whether there is the nucleosides corresponding to the 321st in SEQ ID NO:1 The polymorphism of acid.

8. the method for claim 7, which is characterized in that described 321st there are single nucleotide polymorphism below:

321st T → A；Wherein, nucleotide position number is based on SEQ ID NO:1.

9. the method for claim 7, which is characterized in that in step (2), carried out using PCR amplification and PCR sequencing PCR Detection.

10. method as claimed in claim 9, which is characterized in that with sequence as shown in SEQ ID NO:3 and SEQ ID NO:4 Primer carry out PCR amplification；Also, PCR reaction condition are as follows:

(1) 94 DEG C initial denaturation 2 minutes；

(2) 94 DEG C are denaturalized 30 seconds, and 63 DEG C are annealed 40 seconds, and 72 DEG C extend 40 seconds, above-mentioned to carry out 10 circulations, each cycle annealing altogether 0.5 DEG C of lapse of temperature；

(4) 72 DEG C extend 7 minutes.