CN109468296A - Protein UGT146 and its encoding gene and application - Google Patents

Abstract

The invention discloses protein UGT146 and its encoding gene and applications.Protein UGT146 is that amino acid sequence is protein shown in sequence 2 in sequence table.It is demonstrated experimentally that protein UGT146 has the activity of glycosyl transferase, it can Efficient Conversion lariciresinol generation lariciresinol -4-O- β-D-Glucose glycosides and/or the-O- of lariciresinol -4 ' β-D-Glucose glycosides and/or the peaceful B of straight clematis.To UGT146 gene is imported in woaded blue hairy, obtain turning UGT146 gene hairy；Compared with the woaded blue for not importing UGT146 gene hairy, turns the content that UGT146 gene hairy middle lariciresinol generates lariciresinol -4-O- β-D-Glucose glycosides,-O- of lariciresinol -4 ' β-D-Glucose glycosides and the peaceful B of straight clematis and dramatically increase.The present invention has important application value.

Description

Protein UGT146 and its encoding gene and application

Technical field

The invention belongs to field of biotechnology, and in particular to protein UGT146 and its encoding gene and application.

Background technique

Woaded blue (Isatis indigotica Fort.) is that Cruciferae woaded blue belongs to biennial herbaceous plant.Woaded blue root is Radix Isatidis, leaf are one of folium isatidis source, are conventional Chinese medicine, have the effect of clearing heat and detoxicating, cool blood relieving sore-throat, clinically commonly use In the treatment of the diseases such as influenza, popular cheek inflammation, Japanese Type-B encephalitis, acute, chronic hepatitis, shingles zoster.Lignanoid And its glucoside compound (predominantly lariciresinol -4-O- β-D-Glucose glycosides and the peaceful B of straight clematis) is that woaded blue is disease-resistant One of malicious important active substances basis, can lignanoid and its glucoside compound content in woaded blue it is lower, wherein straight clematis Peaceful B is only up to 0.900mg/g, largely limits its application clinically.Lignanoid and its glucoside compound synthesis Most of key gene has been accredited in approach, but is catalyzed the encoding gene of crucial glycosylation modified glycosyl transferase still It is not accredited.

Glycosyl transferase (glycosyltransferases) is nucleotide-saccharide donor monosaccharide by glycosyl from activation It is transferred to glycosyl acceptor and forms glycosidic bond, play key effect in the biosynthesis and growth course of plant sugar methods of glycosides. It can be seen that the clone of woaded blue glycosyl transferase encoding gene is parsing lignanoid's biosynthesis pathway and then utilizes metabolic engineering It adjusts the content of lignanoid's glucosides in woaded blue or this kind of compound offer important foundation is directly synthesized by synthetic biology strategy.

For improve medicinal plant active constituent, in addition to medicinal plant germplasm preferably other than, can also pass through plant metabolic engineering And synthetic biology, cell or tissue culture, effective component route of synthesis key gene clone and conversion are carried out to medicinal plant Etc. technologies, improve medicinal plant active constituent.Hairy culture, which has, does not depend on exogenous plant hormones, synthesis secondary metabolites energy The advantages that power is strong and stable, bioconversion function and fertility is strong, high value day is produced using it as bioreactor Right product has great potential.

Summary of the invention

The object of the present invention is to provide a kind of glycosyl transferase, lariciresinol can be converted to and fall by glycosyl transferase Leaf pine tree lipidol -4-O- β-D-Glucose glycosides and/or the-O- of lariciresinol -4 ' β-D-Glucose glycosides and/or straight clematis are peaceful B。

Glycosyl transferase provided by the invention, entitled protein UGT146 derive from woaded blue (Isatisindigotica Fort.).The protein UGT146 can be following a1) or a2) or a3) or a4):

A1) amino acid sequence is protein shown in sequence 2 in sequence table；

A2) the fused protein that the N-terminal of protein shown in sequence 2 or/and C-terminal connection label obtain in sequence table；

A3) amino acid sequence is protein shown in sequence 6 in sequence table；

A4) by a1) or a2) or a3) shown in protein pass through one or several amino acid residues substitution and/or missing And/or the protein with glycosyl transferase activity that addition obtains.

Wherein, sequence 2 is made of 486 amino acid residues in sequence table.

In order to make a1) in protein convenient for purifying, can in sequence table the amino terminal of protein shown in sequence 2 or Carboxyl terminal connects upper label as shown in Table 1.

The sequence of 1. label of table

Above-mentioned a3) in protein, the substitution and/or deletion and/or addition of one or several amino acid residues be No more than the substitution and/or deletion and/or addition of 10 amino acid residues.

Above-mentioned a3) in protein can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression and obtain.

Above-mentioned a3) in the encoding gene of protein can be by the way that one will be lacked in DNA sequence dna shown in sequence 1 in sequence table The codon of a or several amino acid residues, and/or the missense mutation of one or several base-pairs is carried out, and/or at its 5 ' end And/or 3 ' end connect the coded sequence of label shown in table 1 and obtain.

The nucleic acid molecules of code for said proteins UGT146 also belong to protection scope of the present invention.

The nucleic acid molecules of the coding protein UGT146 concretely following b1) or b2) or b3) b4) or b5) shown in DNA molecular:

B1) code area is DNA molecular shown in sequence 1 in sequence table；

B2) nucleotide sequence is DNA molecular shown in sequence 1 in sequence table；

B3) nucleotide sequence is DNA molecular shown in sequence 5 in sequence table；

B4) and b1) or b2) or the nucleotide sequence that b3) limits there is 75% or 75% or more identity, derive from woaded blue And the DNA molecular of code for said proteins UGT146；

B5) under strict conditions with b1) or b2) or b3) nucleotide sequence hybridization that limits, from woaded blue and coding institute State the DNA molecular of protein UGT146.

Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also To be RNA, such as mRNA or hnRNA.

Wherein, sequence 1 is made of 1461 nucleotide in sequence table, the nucleotide coding sequence table of sequence 1 in sequence table Amino acid sequence shown in middle sequence 2.Sequence 5 is made of 1557 nucleotide in sequence table, the nucleotide of sequence 5 in sequence table Amino acid sequence shown in sequence 6 in polynucleotide.

Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation Method is mutated the nucleotide sequence of code for said proteins UGT146 of the invention.Those have by manually modified The nucleotide sequence 75% of the isolated protein UGT146 or the nucleotide of higher identity with the present invention, as long as Code for said proteins UGT146 is derived from nucleotide sequence of the invention and to be equal to sequence of the invention.

Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair Amino acid sequence shown in the sequence 2 of bright polynucleotide composition protein UGT146 nucleotide sequence have 75% or Higher or 80% or higher or 85% or higher or 90% or higher or 95% or higher identity nucleotide sequence.Together One property can with the naked eye or computer software is evaluated.Identity using computer software, between two or more sequences It can be indicated with percentage (%), can be used to evaluate the identity between correlated series.

Expression cassette, recombinant vector, recombinant microorganism or transgenic cell line containing any of the above-described nucleic acid molecules It belongs to the scope of protection of the present invention.

The recombinant vector containing any of the above-described nucleic acid molecules can be in the insertion of the multiple cloning sites of expression vector The recombinant plasmid that DNA molecular shown in the sequence 1 of sequence table obtains.

The recombinant vector recombinant plasmid that concretely embodiment refers to containing any of the above-described nucleic acid molecules PET28a-HIS-MBP-UGT146 or recombinant plasmid pCAMBIA1300-super-UGT146.

The recombinant plasmid pET28a-HIS-MBP-UGT146 can be by the limit of pET28a-HIS-MBP prokaryotic expression carrier DNA small fragment between property restriction endonuclease EcoRI identification sequence processed and restriction enzyme NotI identification sequence replaces with nucleotides sequence Column are DNA molecular shown in the sequence 1 of sequence table, obtained recombinant plasmid.The pET28a-HIS-MBP prokaryotic expression carrier The nucleotide sequence of (annular) can be as shown in sequence 3 in sequence table.

In the recombinant plasmid pCAMBIA1300-super-UGT146, the sequence 1 of sequence table from 5 ' ends the 1st to DNA molecular shown in 1458 is merged with the coded sequence of the FLAG label on carrier framework, shown in the sequence 5 of formation sequence table Fusion, with UGT146-3 × Flag fusion protein of 3 × Flag label shown in the sequence 6 of expressed sequence table.

The recombinant microorganism containing any of the above-described nucleic acid molecules can divide for that will contain any of the above-described nucleic acid The recombinant vector of son imports the recombinant bacterium that the microorganism that sets out obtains.

The microorganism that sets out can be Escherichia coli or Agrobacterium.The Escherichia coli concretely Escherichia coli Transetta(DE3).The Agrobacterium can be agrobacterium rhizogenes C58C1.

Recombinant microorganism containing any of the above-described nucleic acid molecules recombination fungus beetle that concretely embodiment refers to (i.e. by recombinant plasmid pET28a-HIS-MBP-UGT146 import Escherichia coli Transetta (DE3), obtained recombinant bacterium) or The C58C1/pCAMBIA1300-super-UGT146 that embodiment refers to is (i.e. by recombinant plasmid pCAMBIA1300-super- UGT146 imports agrobacterium rhizogenes C58C1, obtained recombinational agrobacterium).

The transgenic cell line does not include propagation material.

The present invention also protects X1) any of the above-described protein UGT146, or, any of the above-described nucleic acid molecules, or, containing Have expression cassette, recombinant vector, recombinant microorganism or the transgenic cell line of any of the above-described nucleic acid molecules, application, can be Following c1) at least one of to c6):

C1) as the application of glycosyl transferase；

C2) the application in the product that preparation has glycosyl transferase function；

C3) the application in production lariciresinol list glucoside and/or lariciresinol double glucosides；

C4) in preparation for producing lariciresinol list glucoside and/or lariciresinol double glucosides Application in product；

C5) the application in conversion lariciresinol；

C6) application in the product for converting lariciresinol is being prepared.

The c3) or c4) in, " production lariciresinol list glucoside and/or the double grapes of lariciresinol Glucosides " can be using lariciresinol and uridine 5'-diphosphate-β-O-D- glucose as raw material.

The present invention also protects X2) any of the above-described protein UGT146, or, any of the above-described nucleic acid molecules, or, containing There are expression cassette, recombinant vector, recombinant microorganism or the transgenic cell line of any of the above-described nucleic acid molecules, is cultivating larch Answering in the increase of resinol list glucoside content and/or the increased genetically modified plants of lariciresinol double glucosides content With.

In any of the above-described application, the lariciresinol list glucoside can be lariciresinol -4-O- β-D-Glucose glycosides and/or the-O- of lariciresinol -4 ' β-D-Glucose glycosides.

In any of the above-described application, the lariciresinol double glucosides can be the peaceful B of straight clematis.

In any of the above-described application, the plant can be following G1) any one of to G4): c1) dicotyledonous plant Object；C2) monocotyledon；C3) Cruciferae section plant；C4) woaded blue.

The present invention also protects a kind of method for cultivating genetically modified plants, it may include improves any of the above-described described in the plant that sets out The expression quantity and/or activity of protein UGT146, the step of obtaining genetically modified plants；Compared with the plant that sets out, described turn The lariciresinol list glucoside content of gene plant increases and/or lariciresinol double glucosides content increases.

The expression quantity and/or activity of any of the above-described protein UGT146 in plant " raising set out " can be by more Copy changes the methods well known in the art such as promoter, regulatory factor, transgenosis, reaches the expression for improving protein UGT146 Amount and/or active effect.

In the above method, the expression quantity and/or activity of protein UGT146 in plant " raising set out " can pass through The nucleic acid molecules for importing code for said proteins UGT146 to the plant that sets out are realized.

In the above method, the plant can be following G1) any one of to G4): c1) dicotyledon；C2) unifacial leaf Plant；C3) Cruciferae section plant；C4) woaded blue.

The present invention, which also protects, a kind of cultivates transgenosis woaded blue hairy method, it may include raising is set out in woaded blue hairy The expression quantity and/or activity of any of the above-described protein UGT146, the step of obtaining transgenosis woaded blue hairy；With compare ancient name for Chinese cabbage Blue hairy is compared, and transgenosis woaded blue hairy lariciresinol list glucoside content increases and/or fallen leaves pine resin Alcohol double glucosides content increases.

The expression quantity and/or activity of any of the above-described protein UGT146 in woaded blue hairy " raising set out " can By multicopy, change the methods well known in the art such as promoter, regulatory factor, transgenosis, reaches and improve protein UGT146 Expression quantity and/or active effect.

It is described the expression quantity and/or activity of woaded blue hairy middle protein UGT146 " raising set out " in the above method The nucleic acid molecules realization of any of the above-described protein UGT146 is encoded by importing to the woaded blue that sets out hairy.

In any of the above-described the method, the nucleic acid molecules of the coding protein UGT146 concretely following b1) or b2) Or b3) b4) or b5) shown in DNA molecular:

B1) code area is DNA molecular shown in sequence 1 in sequence table；

B2) nucleotide sequence is DNA molecular shown in sequence 1 in sequence table；

B3) nucleotide sequence is DNA molecular shown in sequence 5 in sequence table；

B4) and b1) or b2) or the nucleotide sequence that b3) limits there is 75% or 75% or more identity, derive from woaded blue And the DNA molecular of code for said proteins UGT146；

B5) under strict conditions with b1) or b2) or b3) nucleotide sequence hybridization that limits, from woaded blue and coding institute State the DNA molecular of protein UGT146.

Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also To be RNA, such as mRNA or hnRNA.

Wherein, sequence 1 is made of 1461 nucleotide in sequence table, the nucleotide coding sequence table of sequence 1 in sequence table Amino acid sequence shown in middle sequence 2.Sequence 5 is made of 1557 nucleotide in sequence table, the nucleotide of sequence 5 in sequence table Amino acid sequence shown in sequence 6 in polynucleotide.

Described " nucleic acid molecules for encoding any of the above-described protein UGT146 are imported to the woaded blue that sets out hairy " is specific The recombination of the nucleic acid molecules to importing in the woaded blue that sets out hairy containing any of the above-described protein UGT146 of coding can be passed through Carrier is realized.The recombinant vector containing the nucleic acid molecules for encoding any of the above-described protein UGT146 is concretely described Recombinant plasmid pCAMBIA1300-super-UGT146.

In any of the above-described method, the lariciresinol list glucoside can be lariciresinol -4-O- β-D-Glucose glycosides and/or the-O- of lariciresinol -4 ' β-D-Glucose glycosides.

In any of the above-described method, the lariciresinol double glucosides can be the peaceful B of straight clematis.

It is demonstrated experimentally that protein UGT146 provided by the invention has the activity of glycosyl transferase, it can Efficient Conversion fallen leaves Pine tree lipidol generates lariciresinol -4-O- β-D-Glucose glycosides and/or the-O- of lariciresinol -4 ' β-D-Glucose glycosides And/or the peaceful B of straight clematis.Lariciresinol -4-O- β-D-Glucose glycosides and the peaceful B of straight clematis are that woaded blue is antiviral important Active material.The present invention has important application value.

Detailed description of the invention

Fig. 1 is UGT systematic evolution tree (adjacent method) analysis.

The SDS-PAGE of building schematic diagram and expression product that Fig. 2 is recombinant plasmid pET28a-HIS-MBP-UGT146.

Fig. 3 is the UPLC testing result in embodiment 2.

Fig. 4 is the Q-TOF-MS testing result in embodiment 2.

Fig. 5 is the building schematic diagram of recombinant plasmid pCAMBIA1300-super-UGT146.

Fig. 6 is the identification for turning UGT146 gene hairy.

Fig. 7 is the detection for turning UGT146 gene hairy middle UGT146-3 × Flag fusion protein.

Fig. 8 is to turn UGT146 gene hairy middle lariciresinol -4-O- β-D- glucopyranoside, fallen leaves pine resin The measurement result of-the O- of alcohol -4 ' β-D- glucopyranoside and the peaceful B content of straight clematis.

Specific embodiment

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.

Experimental method in following embodiments is unless otherwise specified conventional method.

Test material as used in the following examples is unless otherwise specified to buy from routine biochemistry reagent shop It arrives.

Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.

Escherichia coli Transetta (DE3) competent cell, pEASY-Uni Seamless Cloning and Assembly Kit, DNA gel QIAquick Gel Extraction Kit and sheep anti-Mouse secondary antibody are Beijing Quanshijin Biotechnology Co., Ltd Product.PrimeScript 1st Strand cDNA Synthesis Kit is the production of precious biological (Dalian) Engineering Co., Ltd Product.Prestained Protein Ladder is the product of NEB company.KOD-Plus-Neo High fidelity PCR enzyme is Japan's spinning The product of (Shanghai) Biotechnology Co., Ltd.IPTG and PMSF is the product of Sigma Co., USA.

Primer in following embodiments is synthesized by Sangon Biotech (Shanghai) Co., Ltd..

Sequencing in following embodiments is completed by Beijing Qing Ke Bioisystech Co., Ltd.

The nucleotide sequence of pET28a-HIS-MBP prokaryotic expression carrier (annular) is as shown in sequence 3 in sequence table.

The nucleotide sequence of pCAMBIA1300-super plant expression vector (annular) is as shown in sequence 4 in sequence table.

The preparation method of 6,7-V fluid nutrient medium in following embodiments is as follows: first, in accordance with table 2 prepare a great number of elements, Microelement I, microelement II, molysite and organic principle；Then 6,7-V fluid nutrient medium, every 1L 6, the training of 7-V liquid are prepared Base is supported by sucrose 30g, inositol 0.1g, calcium chloride hydrate 0.26g, 10mL a great number of elements, 1mL microelement I, 1mL microelement II, 1mL molysite and 1mL organic principle and water composition, adjust pH value to 5.8,121 DEG C of high pressure sterilization 15min.

Table 2

Embodiment 1, the preparation for recombinating glycosyl transferase

One, from the acquisition of the encoding gene of the glycosyl transferase of woaded blue (UGT146 gene)

The present inventor has found encoding gene (the UGT146 base of glycosyl transferase in woaded blue by many experiments Cause).The nucleotide sequence of UGT146 gene is as shown in sequence 1 in sequence table.UGT146 DNA encoding the protein UGT146, albumen The amino acid sequence of matter UGT146 is as shown in sequence 2 in sequence table.

By the blast program in the amino acid sequence ncbi database of protein UGT146 in Non-redundant Homology search is carried out in GenBank CDS translation+PDB+Swissprot database.

UGT systematic evolution tree (adjacent method) is shown in Fig. 1.The result shows that on amino acid levels protein UGT146 with it is other UGT in species has higher homology, while having typical Active site structure domain.

Two, the building of recombinant plasmid pET28a-HIS-MBP-UGT146

The building schematic diagram of recombinant plasmid pET28a-HIS-MBP-UGT146 is shown in A in Fig. 2.

1, woaded blue hairy total serum IgE is extracted, PrimeScript 1st Strand cDNA Synthesis is then used Kit carries out reverse transcription, obtains woaded blue hairy cDNA.

2, using woaded blue hairy cDNA as template, using primers F: 5 '-tgttccaggggcccgaattcatgaaaca Ggagctggttttcatac-3 ' (restriction enzyme site that underscore is restriction enzyme EcoRI) and primer R:5 '-gtggtgct cgagtgcggccgcTcaagagatattcgaagtgacatc-3 ' (restriction enzyme site that underscore is restriction enzyme NotI) The primer pair of composition carries out PCR amplification, obtains pcr amplification product.

Reaction system is 20 μ L, by 5 μ L KOD Buffer (10 ×) (the included group of KOD-Plus-Neo High fidelity PCR enzyme Part), 5 μ L dNTP (concentration 2.0mmol/L), 2 μ L primers F aqueous solutions (concentration be 10 μm of ol/L), 2 μ L primer R aqueous solutions (concentration is 10 μm of ol/L), the cDNA aqueous solution of 1 μ L KOD-Plus-Neo High fidelity PCR enzyme, 1 hairy of μ L woaded blue (contains 20ng The cDNA that woaded blue is hairy) and 4 μ L aseptic double-distilled waters composition.

Response procedures are as follows: 94 DEG C of initial denaturation 2min；98 DEG C of denaturation 10s, 55 DEG C of annealing 30s, 68 DEG C of extension 2min, 34 are followed Ring；68 DEG C of extension 7min.

2, the pcr amplification product for taking step 1 to obtain carries out agarose gel electrophoresis, then utilizes DNA gel reclaim reagent The DNA fragmentation of box recycling about 1500bp.

3, pET28a-HIS-MBP prokaryotic expression carrier is taken, with restriction enzyme EcoRI and NotI digestion, recycling is about The carrier framework of 6.5kb.

4, the DNA fragmentation that step 2 obtains and the carrier framework that step 3 obtains are used into pEASY-Uni Seamless Cloning and Assembly kit is attached, and obtains recombinant plasmid pET28a-HIS-MBP-UGT146.

Recombinant plasmid pET28a-HIS-MBP-UGT146 is sequenced.According to sequencing result, to recombinant plasmid PET28a-HIS-MBP-UGT146 carries out structure and is described as follows: by the restricted interior of pET28a-HIS-MBP prokaryotic expression carrier It is sequence that DNA small fragment between enzyme cutting EcoRI identification sequence and restriction enzyme NotI identification sequence, which replaces with nucleotide sequence, DNA molecular shown in the sequence 1 of list.

Three, the expression of glycosyl transferase is recombinated

1, recombinant plasmid pET28a-HIS-MBP-UGT146 conversion Escherichia coli Transetta (DE3) competence is thin Born of the same parents obtain recombination fungus beetle.

2, the monoclonal for recombinating fungus beetle is inoculated in 5mL LB liquid medium (containing 50 μ g/mL kanamycins), 37 DEG C, 250rpm shaken cultivation is stayed overnight, and culture bacterium solution is obtained.

3, after completing step 2, by the inoculation of culture bacterium solution, (inoculation is compared for 1:100) in 500mL LB liquid medium (containing 50 μ G/mL kanamycins), 37 DEG C, 250rpm shaken cultivation to OD_600nmValue is 0.4-0.6, and IPTG is added and makes it in system Concentration is 1mM, then 16 DEG C, 250rpm shaken cultivation 16h, 4 DEG C, 5000g centrifugation 10min, collection thallus.

3, the thallus for taking step 2 to obtain, washs 2 times with precooling pure water, be then added 30mL containing 1mMEDTA, 1mMPMSF, The pH7.4,50mM Tris-Cl buffer of 10% (v/v) glycerol are resuspended, and obtain re-suspension liquid.

4, after completing step 4, the re-suspension liquid is taken, (interval 5s, breaks under 10KG frequency using cell crushing instrument ultrasonication Broken 5s is crushed 5min altogether), then 4 DEG C, 13000rpm centrifugation 15min collect supernatant, and supernatant is as recombination fungus beetle Crude enzyme liquid (induces) through IPTG.

According to the method described above, recombinant plasmid pET28a-HIS-MBP-UGT146 is replaced with into pET28a-HIS-MBP protokaryon Expression vector obtains recombinant bacterium second (as control bacterium), then further obtains the crude enzyme liquid of recombinant bacterium second.

According to the method described above, step 3 is replaced with into step 3X, other steps are constant, obtain the crude enzyme liquid of recombination fungus beetle (being induced without IPTG).Step 3X are as follows: (inoculation, which is compared, (to be contained for 1:100) in 500mL LB liquid medium by the inoculation of culture bacterium solution 50 μ g/mL kanamycins), 37 DEG C, 250rpm shaken cultivation to OD_600nmValue is 0.4-0.6, then 16 DEG C, 250rpm oscillation training 16h is supported, 4 DEG C, 5000g centrifugation 10min collect thallus.

(not by the crude enzyme liquid of the crude enzyme liquid for recombinating fungus beetle (being induced through IPTG), the crude enzyme liquid of recombinant bacterium second and recombination fungus beetle Induced through IPTG) carry out SDS-PAGE.As a result see that (M is Prestained Protein Ladder to B in Fig. 2, and 1 is recombinant bacterium second Crude enzyme liquid, 2 be recombinate fungus beetle crude enzyme liquid (without IPTG induce), 3 be recombination fungus beetle crude enzyme liquid (being induced through IPTG)). The result shows that there is an apparent specific protein band of expression in the crude enzyme liquid (inducing through IPTG) for recombinating fungus beetle, it is corresponding to divide Son amount is 100kD, in the same size with expection；It recombinates in the crude enzyme liquid (being induced without IPTG) and the crude enzyme liquid of recombinant bacterium second of fungus beetle The band for being then 100kDa without molecular weight.

The crude enzyme liquid (inducing through IPTG) of fungus beetle is recombinated i.e. containing recombination glycosyl transferase.

Embodiment 2, recombination glycosyl transferase conversion lariciresinol generate lariciresinol list glucoside and fall Leaf pine tree lipidol double glucosides

Solution to be measured is the crude enzyme liquid (inducing through IPTG) of recombination fungus beetle prepared by embodiment 1 or the thick enzyme of recombinant bacterium second Liquid.

1, reaction system is prepared.Reaction system by 300 μ L solution to be measured, (solvent is first to 1.5 μ L lariciresinol solution Alcohol, concentration 40mM) and 3 μ L uridine 5'-diphosphate-β-O-D- glucose solutions (solvent is ultrapure water, concentration 40mM) composition.

2, the reaction system for taking step 1 to prepare, 30 DEG C of water-bath 12h.

3,2 times of pure methanol of volume (purpose is reacted to terminate), mechanical shaking extraction is added in the system for taking into step 2.

4, after completing step 3,13000rpm is centrifuged 15min, collects supernatant.

5, after completing step 4, the supernatant is taken, the membrane filtration for being 0.22 μM with aperture collects filtrate.

Filtrate and the peaceful B standard product of straight clematis are subjected to UPLC analysis.

UPLC condition are as follows: chromatographic column: ACQUITY UPLC BEH C18 (2.1mm × 50mm, 1.7 μm)；Mobile phase: contain 0.1% formic acid acetonitrile (A): water (B)=12:88 containing 0.1% formic acid；Flow velocity: 0.4mL/min；Detection wavelength is 225nm, column Temperature is 40 DEG C, and sample volume is 2 μ L.

Experimental result is shown in Fig. 3, (CB is the peaceful B of straight clematis, and Lari is lariciresinol, and UGT146+Lari is recombinant bacterium The filtrate collected after crude enzyme liquid (inducing through the IPTG) reaction of first, Vector+Lari are to receive after the crude enzyme liquid of recombinant bacterium second reacts The filtrate of collection).The result shows that retention time of the straight peaceful B standard product of clematis in UPLC is 1.32min；Recombinate the thick of fungus beetle The filtrate collected after enzyme solution (inducing through IPTG) reaction is to exist at 1.32min, 2.41min and 2.82min in retention time Characteristic peak, there is also a non-characteristic peaks；The filtrate collected after the crude enzyme liquid reaction of recombinant bacterium second does not detect then accordingly Characteristic peak, only one non-characteristic peak.

6, it to 3 characteristic peaks and the peaceful B standard product of 1 non-characteristic peak, straight clematis in step 5 and is fallen using Q-TOF-MS Leaf pine tree lipidol standard items carry out qualitative analysis.Mass Spectrometry Conditions are as follows: Waters Xevo G2-S QTOF-MS mass spectrum uses EFI Mist ionization source (ESI), using anionic textiles mode；Scanning range m/z 50~1500, sweep time 0.2s, capillary electricity 2000V, orifice potential 40V are pressed, solvent gas nitrogen 900L/h is removed, removes 450 DEG C of solvent temperature, 100 DEG C of ion source temperature.

The analysis result of the peaceful B standard product of straight clematis is shown in A in Fig. 4.The analysis result of lariciresinol is shown in C in Fig. 4.Filter The analysis result of liquid is shown in that the molecular ion peak of B: four products in Fig. 4 is respectively m/z729.2605 [M+COOH-H]-(first Product, the P4 of B in corresponding diagram 4), m/z 567.2086 [M+COOH-H]-(second product, the P3 of B in corresponding diagram 4), m/ z521.2024[M-H]^-(third product, the P2 of B in corresponding diagram 4) and m/z 405.1552 [M+COOH-H]^-(the 4th production Object, the P1 of B in corresponding diagram 4).The result shows that first product and 405.1552 [M+COOH- of substrate lariciresinol m/z H]-mass difference 324, illustrate first product be added two molecule glucoses (to fall on the basis of lariciresinol Leaf pine tree lipidol double glucosides)；And the appearance time of first product and the peaceful B standard product of straight clematis is (respectively 6.33min and 6.34min), molecular weight (respectively 729.2605 and 729.2600) it is almost the same, illustrate that first product is exactly The peaceful B of straight clematis.Second product and third product are to have added a molecule glucose on the basis of lariciresinol (i.e. Lariciresinol list glucoside), specific structure need to be identified further.When the appearance of the 4th product and lariciresinol Between (being 9.78min), molecular weight (respectively 405.1554 and 405.1552) it is almost the same, illustrate that the 4th product is exactly to fall Leaf pine tree lipidol.

7, to further determine that the lariciresinol list glucoside (i.e. second product and the third that obtain in step 6 A product) glycosylation position, and then crude enzyme liquid (the inducing through IPTG) of recombination fungus beetle prepared by system evaluation embodiment 1 urges Change function, the present inventor first amplifies active recombinant protein catalystic converter system, prepares intermediate two product m/z 567.2354[M+COOH-H]-,m/z 521.2269[M-H]-；Then using MS, 1H-NMR, 13C-NMR, H-H COSY, HSQC and HMBC carries out the confirmation of glycosylation position.

MS, 1H-NMR, 13C-NMR spectral information of the lariciresinol list glucoside obtained in step 6 are shown in Table 3.

MS, 1H-NMR and 13C-NMR spectral information of 3. lariciresinol list glucoside of table

Nuclear-magnetism qualification result is as follows: second product is lariciresinol -4-O- β-D-Glucose glycosides, and structural formula is such as Shown in formula (I)；Third product is the-O- of lariciresinol -4 ' β-D-Glucose glycosides, shown in structural formula such as formula (II).

The above results show that the crude enzyme liquid (inducing through IPTG) of recombination fungus beetle prepared by embodiment 1 has glycosyl transferase Activity, lariciresinol can be converted to the lariciresinol list glucoside (Portugal lariciresinol -4-O- β-D- Polyglycoside and/or the-O- of lariciresinol -4 ' β-D-Glucose glycosides) and/or lariciresinol double glucosides (i.e. straight iron The peaceful B of line lotus).

Embodiment 3, the acquisition and identification for turning UGT146 gene hairy

One, the building of recombinant plasmid pCAMBIA1300-super-UGT146

The building schematic diagram of recombinant plasmid pCAMBIA1300-super-UGT146 is shown in Fig. 5.

1, the pcr amplification product obtained using step 22 in embodiment 1 is template, using primer 2 F:5 '-GCTTCTGCAG GGGCCCGGGGATGAAACAGGAGCTGGTTTTC and primer 2 R:5 '-GGATCCACTAGTATTTAAATgAGAGATATTCGA The primer pair of AGTGACATC composition carries out PCR amplification, obtains pcr amplification product.

2, the pcr amplification product for taking step 1 to obtain carries out agarose gel electrophoresis, then utilizes DNA gel reclaim reagent The DNA fragmentation of box recycling about 1500bp.

3, pCAMBIA1300-super plant expression vector is taken, with restriction enzyme SalI digestion, recycles about 10kb's Carrier framework.

4, the DNA fragmentation that step 2 obtains and the carrier framework that step 3 obtains are used into pEASY-Uni Seamless Cloning and Assembly kit is attached, and obtains recombinant plasmid pCAMBIA1300-super-UGT146.

Recombinant plasmid pCAMBIA1300-super-UGT146 is sequenced.Sequencing result shows recombinant plasmid Sequence 1 in pCAMBIA1300-super-UGT146 containing the ordered list DNA molecular shown in the 1st to 1458 from 5 ' ends (terminator codon of sequence 1 in sequence table is deleted in order to form UGT146-3 × Flag fusion with 3 × FLAG tag fusion Albumen).In recombinant plasmid pCAMBIA1300-super-UGT146, the sequence 1 of sequence table the 1st to 1458 institute from 5 ' ends The DNA molecular shown is merged with the coded sequence of the FLAG label on carrier framework, merges base shown in the sequence 5 of formation sequence table Cause, with UGT-3 × Flag fusion protein of Flag label shown in the sequence 6 of expressed sequence table.

Two, the acquisition of recombinational agrobacterium

By recombinant plasmid pCAMBIA1300-super-UGT146 transforming agrobacterium rhizogenes C58C1, recombinational agrobacterium is obtained, It is named as C58C1/pCAMBIA1300-super-UGT146.

Three, intend turning UGT146 gene hairy acquisition

1, the acquisition of woaded blue aseptic seedling

(1) take full unabroken Seeds of Isatis indigotica, with 75% (v/v) ethanol water impregnate 5min, aseptic water washing 4~ 5 times.

(2) after completing step (1), the Seeds of Isatis indigotica is taken, with 3% (m/v) NaClO aqueous solution soaking 10min, sterile water It rinses 5 times.

(3) after completing step (2), the Seeds of Isatis indigotica is seeded to MS solid medium, first 26 ± 2 DEG C of dark culture 2d, Then 26 ± 2 DEG C of culture (i.e. 16h optical culture/8h dark culture alternately, luminous intensity when illumination cultivation is 2000LUX) 20d, Obtain woaded blue aseptic seedling.

2, Agrobacterium activates

(1) go bail for -80 DEG C of presence of C58C1/pCAMBIA1300-super-UGT146, and streak inoculation is flat in LB solid Plate, 28 DEG C of culture 2d.

(2) after completing step (1), picking C58C1/pCAMBIA1300-super-UGT146 single colonie is seeded to LB liquid Culture medium, 28 DEG C, 200rpm shaken cultivation, obtains OD600_nmThe Agrobacterium bacterium solution that value is 0.6.

3, leaf disk method converts woaded blue hairy

(1) the woaded blue tests for sterility that step 1 obtains is cut into square (side length 1cm), it is small obtains woaded blue aseptic seedling Piece.Woaded blue aseptic seedling small pieces are placed in MS solid medium (purpose is to prevent leaf abscission).

(2) after completing step (1), the woaded blue aseptic seedling small pieces are immersed in the Agrobacterium bacterium solution that step 2 obtains, 28 DEG C, 200rpm disseminate 10min.

(3) after completing step (2), the woaded blue aseptic seedling small pieces are taken out in super-clean bench, are first inhaled with sterile blotting paper The excess Agrobacterium bacterium solution of the dry small on piece of woaded blue aseptic seedling, then woaded blue aseptic seedling small pieces are lain against into the MS solid medium (back side Upward), 25 ± 1 DEG C of dark culture 2d.

(4) after completing step (3), the woaded blue aseptic seedling small pieces are taken, is first used aseptic water washing 3 times, is then transferred to and contains The MS solid medium of 400mg/L Cef, 25 ± 1 DEG C of dark cultures (replacing a subculture every 7d).Dark culture 15d is left The right side grows hairy since the edge of wound of woaded blue aseptic seedling small pieces.

(5) when the growth of hair root in step (4) is to 3-5cm, cut, be seeded to RU 24756 containing 400mg/mL and On the MS solid medium of 50mg/L hygromycin, 25 ± 1 DEG C dark culture 2 weeks.

(6) after completing step (5), still well-grown hairy stock system after hygromycin selection is selected, each strain carries out Independent numbering.(no longer addition hygromycin selection is in favor of hairy for the MS solid medium that hairy of number is seeded to containing Cef Root growth), by constantly reducing Cef concentration (400mg/L → 200mg/L → 0mg/L) degerming, obtain sterile quasi- turning UGT146 Gene hairy.It is so anti-if Agrobacterium continued growth can be transferred back in the MS solid medium of the Cef containing 400mg/L It is multiple, until complete degerming.

According to the method for step 2-3, C58C1/pCAMBIA1300-super-UGT146 is replaced with into C58C1, in step 3 (5) the MS solid medium of RU 24756 containing 400mg/mL and 50mg/L hygromycin replaces with MS solid medium, other Step is constant, obtains turning hairy of empty carrier (as control).

Four, turn UGT146 gene hairy identification

Respectively extraction step three obtain the quasi- genomic DNA for turning UGT146 gene hairy and using it as template, divide Not with primer pair first (by 5 '-CGAGGGGATCCGATTTGCTT-3 ' and 5 '-GACGCCCTCCTCGCCTTCCT-3 ' form, use In RolB gene on identification Ri plasmid T-DNA), primer pair B is (by 5 '-TCGCCATGCCTCACCAACTCAC-3 ' and 5 '- CCTTGATCGAGCCGGGTGAGAA-3 ' composition, for identifying RolC gene on Ri plasmid T-DNA) and primer pair third (by 5 '- TACACAGCCATCGGTCCAGA-3 ' and 5 '-TTAGCGAGAGCCTGACCTATTG-3 ' composition, for identifying hpt gene) into Row PCR amplification, obtains pcr amplification product.

If certain is quasi- turn UGT146 gene hairy using primer pair first obtain contain about 700bp in pcr amplification product DNA fragmentation, using the DNA fragmentation of primer pair B obtained in pcr amplification product containing about 500bp and using primer pair third The DNA fragmentation for containing about 719bp in pcr amplification product is obtained, then this intends turning hairy middle recombinant plasmid of UGT146 gene PCAMBIA1300-super-UGT146 is successfully integrated into woaded blue genome, this is quasi- to turn UGT146 gene hairy and be accredited as to turn UGT146 gene hairy.

Part of test results is shown in that (M is DNA Marker to Fig. 6, and C is to turn empty carrier hairy genomic DNA as mould Plate, swimming lane 1-17, which is 17, to be intended turning the hairy stock system of UGT146 gene, and number is followed successively by OX146-1 to OX146-17).As a result table Bright, OX146-1 to OX146-17 is to turn the hairy stock system of UGT146 gene.

Five, turn UGT146 gene hairy expansion culture

1, taking step 4 to be accredited as, to turn the hairy stock system of UGT146 gene and multi-branched, Duo Genmao, growth rapidly hairy Stock system (specially OX146-2, OX146-4, OX146-5, OX146-6, OX146-8, OX146-9, OX146-11, OX146- 12, OX146-14, OX146-15 and OX146-16) be transferred to MS fluid nutrient medium respectively, 25 DEG C, 80rpm be protected from light suspension culture One month.

2, after completing step 1,0.5g hairy is weighed in superclean bench, is transferred to equipped with 50mL 6, the training of 7-V liquid Support base triangular flask (specification 150mL) in, 25 DEG C, 80rpm be protected from light suspension culture one month, sampling carry out subsequent experimental.

To turn empty carrier hairy and be transferred to MS fluid nutrient medium, 25 DEG C, 80rpm be protected from light suspension culture one month；Then 0.5g hairy is weighed in superclean bench, is transferred to equipped with 50mL 6, and (specification is for the triangular flask of 7-V fluid nutrient medium In 150mL), 25 DEG C, 80rpm be protected from light suspension culture one month, sampling carry out subsequent experimental.

Embodiment 4, the detection for turning UGT146 gene hairy middle UGT146-3 × Flag fusion protein

Hairy to be measured for turn hairy of empty carrier, hairy of OX146-2, hairy of OX146-4, hairy of OX146-5, Hairy of OX146-6, hairy of OX146-8, hairy of OX146-9, hairy of OX146-11, hairy of OX146-12, Hairy of OX146-14, hairy of OX146-15 or OX146-16 hairy.

1, it takes round bottom EP to manage (specification 2mL), is added 0.05g hairy to be measured, liquid nitrogen frozen is then ground to powder； Then it is added 100 μ 2.5 × SDS of L Loadingbuffer (reference molecule cloning experimentation guide (third edition) is voluntarily prepared), boils 10min is boiled in water, is cooled to room temperature.The purpose for carrying out this step is to extract hairy total protein to be measured.

2, the sample for completing step 1 is subjected to Western blot.Using anti-DYKDDDDK label mouse monoclonal antibody (north The product of Jing Quanshijin Bioisystech Co., Ltd, article No. HT201) it is used as primary antibody, sheep anti-Mouse secondary antibody to detect as secondary antibody UGT146-3 × Flag fusion protein, using Genes For Plant Tolerance β-Actin mouse monoclonal antibody, (Jiangsu health is limited for century biotechnology The product of company, article No. CW0264)) as primary antibody detection Actin albumen, as internal reference.

Experimental result is shown in Fig. 7, (V is to turn empty carrier hairy, and 2 be OX146-2 hairy, and 4 be OX146-4 hairy, and 5 are OX146-5 hairy, 6 be OX146-6 hairy, and 8 be OX146-8 hairy, and 9 be OX146-9 hairy, and 11 be OX146-11 Hairy, 12 be OX146-12 hairy, and 14 be OX146-14 hairy, and 15 be OX146-15 hairy, and 16 be OX146-16 Hairy).The result shows that turning UGT146 gene hairy total protein in the expected size of UGT146-3 × Flag fusion protein Cross reaction signal is shown at 58kDa, turns empty carrier hairy total protein and corresponding intersection reaction signal is then not observed. It can be seen that UGT146 gene has successfully been integrated into woaded blue genome and has expressed.

Embodiment 5, the measurement for turning UGT146 gene hairy middle purpose component content

Chromatographic separation condition in the present embodiment: Waters ACQUITY UPLC BEH C18 chromatographic column (2.1mm × 10mm, 1.8 μm)；Mobile phase is made of the aqueous solution (A) containing 0.1% formic acid and the acetonitrile solution (B) containing 0.1% formic acid；Gradient Elute (0-1min, 5%-25%B；1-3.5min, 25%-40%B；3.5-4min, 40%-5%B；4-6min, 5%B)；Stream Fast 0.6mL/min；40 DEG C of column temperature；1.0 μ L of sample volume.

Mass Spectrometry Conditions in the present embodiment: ion source is electro-spray ionization source (ESI), using anionic textiles mode； Multiple-reaction monitoring pattern (MRM) carries out quantitative analysis；550 DEG C of ionization temperature (TEMP)；Spray voltage 4500V, spraying gas (GS1)55psi；Auxiliary heating gas (GS2) 55psi；Gas curtain gas (CUR) 30psi.

The triple level four bars of ultra performance liquid chromatography -/linear ion hydrazine mass spectrography (UPLC-QTRAP-MS/ in the present embodiment MS the Mass Spectrometry Conditions parameter such as table 4 in the research of woaded blue multi-target ingredient) is measured simultaneously.

Table 4

One, the preparation of standard solution

1, precision weighs appropriate lariciresinol -4-O- β-D- the glucopyranoside,-O- of lariciresinol -4 ' β - Methanol is added in D- glucopyranoside and the peaceful B of straight clematis, is configured to mixing stock solution.It mixes in stock solution, pine resin of falling leaves The concentration of alcohol -4-O- β-D- the glucopyranoside,-O- of lariciresinol -4 ' β-D- glucopyranoside and the peaceful B of straight clematis It is 1mg/mL.

2, accurate to measure appropriate mixing stock solution, it is diluted step by step with methanol, obtaining concentration is 5 μ g/mL, 10 μ g/mL, 20 μ The hybrid standard product solution of g/mL, 40 μ g/mL, 80 μ g/mL, 160 μ g/mL, 240 μ g/mL.

The hybrid standard product solution of each concentration refers to lariciresinol -4-O- β-D- glucopyranose in the solution The concentration of the glycosides,-O- of lariciresinol -4 ' β-D- glucopyranoside and the peaceful B of straight clematis is all the same, such as concentration is 40 μ The hybrid standard product solution of g/mL is lariciresinol -4-O- β-D- glucopyranoside, lariciresinol-in the solution The concentration of 4 '-O- β-D- glucopyranosides and the peaceful B of straight clematis are 40 μ g/mL.

Two, the preparation of test solution

1, five hairy of OX146-2, hairy of the OX146-4, hairy of OX146-5, OX146- prepared in Example 3 6 hairy or turn empty carrier hairy, freeze-drying obtains hairy powder.

2, after completing step 1, hairy powder of 50mg is taken, 1mL methanol, ultrasonic extraction 45min under 90% power is added；So 5000rpm is centrifuged 5min afterwards, collects supernatant.

3, after completing step 2, the supernatant is taken, 0.22 μM of membrane filtration collects filtrate.Filtrate is test solution.

Three, the acquisition of regression equation and linear relationship are investigated

Standard solution is measured according to condition under this example detection item.With sample introduction mass concentration X (μ g/mL) for horizontal seat Mark, chromatographic peak area Y are that ordinate obtains regression equation；It is corresponding when with the signal-to-noise ratio (S/N) of each compound equal to 3 and 10 Concentration is determined as minimum detection limit (LOD) and minimum quantitative limit (LOQ), is shown in Table 5.

Table 5

Four, lariciresinol monoglycosides and the peaceful B content measurement of straight clematis

The peak area of the measuring method detection test solution of above-mentioned steps three.Then peak area is substituted into corresponding standard Curve obtains lariciresinol -4-O- β-D- the glucopyranoside,-O- β-D- glucopyranoside of lariciresinol -4 ' With the content of the peaceful B of straight clematis.

Experimental result is shown in Fig. 8, (A is lariciresinol -4-O- β-D- glucopyranoside, and B is lariciresinol - 4 '-O- β-D- glucopyranosides, C are the peaceful B of straight clematis).The result shows that hairy of OX146-2, hairy of OX146-4, Lariciresinol -4-O- β-D-Glucose, lariciresinol -4 '-in OX146-5 hairy and OX146-6 hairy O- β-D-Glucose, the peaceful B of straight clematis content be significantly increased, highest respectively reach 458.24 μ g/g, 800.14 μ g/g, 1446.98 μ g/g are 8.22 times for turning empty carrier hairy, 4.43 times and 7.95 times respectively.It can be seen that step 3 obtained Lariciresinol -4-O- β-D-Glucose,-O- β of lariciresinol -4 '-D- can be produced by turning UGT146 gene hairy Glucose, the peaceful B of straight clematis.The present invention provides a good production platform for the synthesis of lignanoid's glycoside ingredients Biogenic.

<110>Institute Of Chinese Materia Medica Of China Academy of Chinese Medical Sciences

<120>protein UGT146 and its encoding gene and application

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 1461

<212> DNA

<213>woaded blue (Isatis indigotica Fort.)

<400> 1

atgaaacagg agctggtttt cataccatca cctggtgacg gccacatcag accattagtg 60

caggttgcta agctccttgt cgaccgtgat gaacatatct ccatcaccat cctcatcatc 120

cctcagatgc atggattcgg tagcggaagc tctaactcct acatcgcttc tctctccacc 180

gcatctgaag accgcctcca ctacaacgtt ctctccgtcg ccgatgaacc aaactctgat 240

gacgccaaac ccaacttcct ctctcacatc aatagcttca agccacaggt gaaggccacg 300

gttgagaaac tcatcacttc cccagcccga cccgactcgc cgccgtcaag actcgctgga 360

atcgtggtgg acatgttctg cacggacatg attgatgtcg ccaacgagtt tgacgtaccg 420

agttacatgt tttacacctc caacgctacg tttctcgggt tgctaagcca cgttcagcat 480

ctttacgatg ataagaacta tgacgtcagc gacttgttgg attcggaggt taccgagctg 540

gagattccgt gtttgacatg tcctttgccg gttaagtgtt taccctctgt gatgttaaac 600

aaggagtggc taccgattgc gctttcacaa gtgagaagat acaaagaaac aaagggtatt 660

ttggtaaata cgtttgcaga actggagccc caagctatga agtttttctc cggagaagat 720

aaccttcttc ctaccgtgta tcccgtggga cccattttga acctcaaaac caacggtcca 780

aatccggcgg acgataaaca gtcagagatc ttacggtggt tggacgagca gcctcgtgaa 840

accgttgtgt tcctctgttt tggaagcatg ggaggtttcc gtgaggatca agcaaaggaa 900

atcgcaatag cgcttgagcg aagtggccat cgtttcgttt ggtctctccg ccgtgctcgg 960

ccagagggaa ctaggggacc tcccggagag tttacaaacc ttgaagagat tctgccggag 1020

ggatttttag atcggacggc gaagattggg aaggttatcg gttgggctcc acagaccgcc 1080

atactagcaa accctgctgt ccgaggattt gtgtcgcact gtggttggaa ctcgacactg 1140

gagagtctct ggttcggtgt tccgatagcc acgtggccac tctatgccga gcaacaagtt 1200

aacgcgttcg agatggtgga ggagctaggg ctagcagtgg aaatccgaaa ctctttcagg 1260

gcagatttca tggcggcgga gtcggagttg atgacggcgg aggagataga gcgggggatc 1320

cgctgtttga tggagcagga taacgtgagg gatagagtga aggagatgag tgagaagagc 1380

cacgtgtctt taatggaagg tggatcttcg cacgctgctc ttctcaagtt cattgaagat 1440

gtcacttcga atatctcttg a 1461

<210> 2

<211> 486

<212> PRT

<213>woaded blue (Isatis indigotica Fort.)

<400> 2

Met Lys Gln Glu Leu Val Phe Ile Pro Ser Pro Gly Asp Gly His Ile

1 5 10 15

Arg Pro Leu Val Gln Val Ala Lys Leu Leu Val Asp Arg Asp Glu His

20 25 30

Ile Ser Ile Thr Ile Leu Ile Ile Pro Gln Met His Gly Phe Gly Ser

35 40 45

Gly Ser Ser Asn Ser Tyr Ile Ala Ser Leu Ser Thr Ala Ser Glu Asp

50 55 60

Arg Leu His Tyr Asn Val Leu Ser Val Ala Asp Glu Pro Asn Ser Asp

65 70 75 80

Asp Ala Lys Pro Asn Phe Leu Ser His Ile Asn Ser Phe Lys Pro Gln

85 90 95

Val Lys Ala Thr Val Glu Lys Leu Ile Thr Ser Pro Ala Arg Pro Asp

100 105 110

Ser Pro Pro Ser Arg Leu Ala Gly Ile Val Val Asp Met Phe Cys Thr

115 120 125

Asp Met Ile Asp Val Ala Asn Glu Phe Asp Val Pro Ser Tyr Met Phe

130 135 140

Tyr Thr Ser Asn Ala Thr Phe Leu Gly Leu Leu Ser His Val Gln His

145 150 155 160

Leu Tyr Asp Asp Lys Asn Tyr Asp Val Ser Asp Leu Leu Asp Ser Glu

165 170 175

Val Thr Glu Leu Glu Ile Pro Cys Leu Thr Cys Pro Leu Pro Val Lys

180 185 190

Cys Leu Pro Ser Val Met Leu Asn Lys Glu Trp Leu Pro Ile Ala Leu

195 200 205

Ser Gln Val Arg Arg Tyr Lys Glu Thr Lys Gly Ile Leu Val Asn Thr

210 215 220

Phe Ala Glu Leu Glu Pro Gln Ala Met Lys Phe Phe Ser Gly Glu Asp

225 230 235 240

Asn Leu Leu Pro Thr Val Tyr Pro Val Gly Pro Ile Leu Asn Leu Lys

245 250 255

Thr Asn Gly Pro Asn Pro Ala Asp Asp Lys Gln Ser Glu Ile Leu Arg

260 265 270

Trp Leu Asp Glu Gln Pro Arg Glu Thr Val Val Phe Leu Cys Phe Gly

275 280 285

Ser Met Gly Gly Phe Arg Glu Asp Gln Ala Lys Glu Ile Ala Ile Ala

290 295 300

Leu Glu Arg Ser Gly His Arg Phe Val Trp Ser Leu Arg Arg Ala Arg

305 310 315 320

Pro Glu Gly Thr Arg Gly Pro Pro Gly Glu Phe Thr Asn Leu Glu Glu

325 330 335

Ile Leu Pro Glu Gly Phe Leu Asp Arg Thr Ala Lys Ile Gly Lys Val

340 345 350

Ile Gly Trp Ala Pro Gln Thr Ala Ile Leu Ala Asn Pro Ala Val Arg

355 360 365

Gly Phe Val Ser His Cys Gly Trp Asn Ser Thr Leu Glu Ser Leu Trp

370 375 380

Phe Gly Val Pro Ile Ala Thr Trp Pro Leu Tyr Ala Glu Gln Gln Val

385 390 395 400

Asn Ala Phe Glu Met Val Glu Glu Leu Gly Leu Ala Val Glu Ile Arg

405 410 415

Asn Ser Phe Arg Ala Asp Phe Met Ala Ala Glu Ser Glu Leu Met Thr

420 425 430

Ala Glu Glu Ile Glu Arg Gly Ile Arg Cys Leu Met Glu Gln Asp Asn

435 440 445

Val Arg Asp Arg Val Lys Glu Met Ser Glu Lys Ser His Val Ser Leu

450 455 460

Met Glu Gly Gly Ser Ser His Ala Ala Leu Leu Lys Phe Ile Glu Asp

465 470 475 480

Val Thr Ser Asn Ile Ser

485

<210> 3

<211> 6533

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 3

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atgggcagca gccatcatca tcatcatcac 5100

agcagcggcc tggtgccgcg cggcagccat atgaaaactg aagaaggtaa actggtaatc 5160

tggattaacg gcgataaagg ctataacggt ctcgctgaag tcggtaagaa attcgagaaa 5220

gataccggaa ttaaagtcac cgttgagcat ccggataaac tggaagagaa attcccacag 5280

gttgcggcaa ctggcgatgg ccctgacatt atcttctggg cacacgaccg ctttggtggc 5340

tacgctcaat ctggcctgtt ggctgaaatc accccggaca aagcgttcca ggacaagctg 5400

tatccgttta cctgggatgc cgtacgttac aacggcaagc tgattgctta cccgatcgct 5460

gttgaagcgt tatcgctgat ttataacaaa gatctgctgc cgaacccgcc aaaaacctgg 5520

gaagagatcc cggcgctgga taaagaactg aaagcgaaag gtaagagcgc gctgatgttc 5580

aacctgcaag aaccgtactt cacctggccg ctgattgctg ctgacggggg ttatgcgttc 5640

aagtatgaaa acggcaagta cgacattaaa gacgtgggcg tggataacgc tggcgcgaaa 5700

gcgggtctga ccttcctggt tgacctgatt aaaaacaaac acatgaatgc agacaccgat 5760

tactccatcg cagaagctgc ctttaataaa ggcgaaacag cgatgaccat caacggcccg 5820

tgggcatggt ccaacatcga caccagcaaa gtgaattatg gtgtaacggt actgccgacc 5880

ttcaagggtc aaccatccaa accgttcgtt ggcgtgctga gcgcaggtat taacgccgcc 5940

agtccgaaca aagagctggc aaaagagttc ctcgaaaact atctgctgac tgatgaaggt 6000

ctggaagcgg ttaataaaga caaaccgctg ggtgccgtag cgctgaagtc ttacgaggaa 6060

gagttggcga aagatccacg tattgccgcc actatggaaa acgcccagaa aggtgaaatc 6120

atgccgaaca tcccgcagat gtccgctttc tggtatgccg tgcgtactgc ggtgatcaac 6180

gccgccagcg gtcgtcagac tgtcgatgaa gccctgaaag acgcgcagac taattcgagc 6240

tcgaacaaca acaacaataa caataacaac aacctcgggg atgacgatga caaggtaccg 6300

ctggaagttc tgttccaggg gcccgaattc ggatccgaat tcgagctccg tcgacaagct 6360

tgcggccgca ctcgagcacc accaccacca ccactgagat ccggctgcta acaaagcccg 6420

aaaggaagct gagttggctg ctgccaccgc tgagcaataa ctagcataac cccttggggc 6480

ctctaaacgg gtcttgaggg gttttttgct gaaaggagga actatatccg gat 6533

<210> 4

<211> 10002

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 4

aattcccgat ctagtaacat agatgacacc gcgcgcgata atttatccta gtttgcgcgc 60

tatattttgt tttctatcgc gtattaaatg tataattgcg ggactctaat cataaaaacc 120

catctcataa ataacgtcat gcattacatg ttaattatta catgcttaac gtaattcaac 180

agaaattata tgataatcat cgcaagaccg gcaacaggat tcaatcttaa gaaactttat 240

tgccaaatgt ttgaacgatc ggggaaattc gagctcttac ttatcgtcat cgtccttgta 300

atcgatgtcg tgatccttat agtctccatc atggtctttg tagtccatgg taccggatcc 360

actagtattt aaatgtcgac cccgggcccc tgcagaagct ttctagagtc gatttggtgt 420

atcgagattg gttatgaaat tcagatgcta gtgtaatgta ttggtaattt gggaagatat 480

aataggaagc aaggctattt atccatttct gaaaaggcga aatggcgtca ccgcgagcgt 540

cacgcgcatt ccgttcttgc tgtaaagcgt tgtttggtac acttttgact agcgaggctt 600

ggcgtgtcag cgtatctatt caaaagtcgt taatggctgc ggatcaagaa aaagttggaa 660

tagaaacaga atacccgcga aattcaggcc cggttgccat gtcctacacg ccgaaataaa 720

cgaccaaatt agtagaaaaa taaaaactga ctcggatact tacgtcacgt cttgcgcact 780

gatttgaaaa atctccctcg atcgagaaag agatcaatgt tgagctgctt caaaagcaat 840

gggattgacc agctcgcgga tcctacaggc caaattcgct cttagccgta caatattact 900

caccggtgcg atgcccccca tcgtaggtga aggtggaaat taatgatcca tcttgagacc 960

acaggcccac aacagctacc agtttcctca agggtccacc aaaaacgtaa gcgcttacgt 1020

acatggtcga taagaaaagg caatttgtag atgttaacat ccaacgtcgc tttcagggat 1080

cctacaggcc aaattcgctc ttagccgtac aatattactc accggtgcga tgccccccat 1140

cgctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca gctggcgtaa 1200

tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgaatg 1260

ctagagcagc ttgagcttgg atcagattgt cgtttcccgc cttcagttta aactatcagt 1320

gtttgacagg atatattggc gggtaaacct aagagaaaag agcgtttatt agaataacgg 1380

atatttaaaa gggcgtgaaa aggtttatcc gttcgtccat ttgtatgtgc atgccaacca 1440

cagggttccc ctcgggatca aagtactttg atccaacccc tccgctgcta tagtgcagtc 1500

ggcttctgac gttcagtgca gccgtcttct gaaaacgaca tgtcgcacaa gtcctaagtt 1560

acgcgacagg ctgccgccct gcccttttcc tggcgttttc ttgtcgcgtg ttttagtcgc 1620

ataaagtaga atacttgcga ctagaaccgg agacattacg ccatgaacaa gagcgccgcc 1680

gctggcctgc tgggctatgc ccgcgtcagc accgacgacc aggacttgac caaccaacgg 1740

gccgaactgc acgcggccgg ctgcaccaag ctgttttccg agaagatcac cggcaccagg 1800

cgcgaccgcc cggagctggc caggatgctt gaccacctac gccctggcga cgttgtgaca 1860

gtgaccaggc tagaccgcct ggcccgcagc acccgcgacc tactggacat tgccgagcgc 1920

atccaggagg ccggcgcggg cctgcgtagc ctggcagagc cgtgggccga caccaccacg 1980

ccggccggcc gcatggtgtt gaccgtgttc gccggcattg ccgagttcga gcgttcccta 2040

atcatcgacc gcacccggag cgggcgcgag gccgccaagg cccgaggcgt gaagtttggc 2100

ccccgcccta ccctcacccc ggcacagatc gcgcacgccc gcgagctgat cgaccaggaa 2160

ggccgcaccg tgaaagaggc ggctgcactg cttggcgtgc atcgctcgac cctgtaccgc 2220

gcacttgagc gcagcgagga agtgacgccc accgaggcca ggcggcgcgg tgccttccgt 2280

gaggacgcat tgaccgaggc cgacgccctg gcggccgccg agaatgaacg ccaagaggaa 2340

caagcatgaa accgcaccag gacggccagg acgaaccgtt tttcattacc gaagagatcg 2400

aggcggagat gatcgcggcc gggtacgtgt tcgagccgcc cgcgcacgtc tcaaccgtgc 2460

ggctgcatga aatcctggcc ggtttgtctg atgccaagct ggcggcctgg ccggccagct 2520

tggccgctga agaaaccgag cgccgccgtc taaaaaggtg atgtgtattt gagtaaaaca 2580

gcttgcgtca tgcggtcgct gcgtatatga tgcgatgagt aaataaacaa atacgcaagg 2640

ggaacgcatg aaggttatcg ctgtacttaa ccagaaaggc gggtcaggca agacgaccat 2700

cgcaacccat ctagcccgcg ccctgcaact cgccggggcc gatgttctgt tagtcgattc 2760

cgatccccag ggcagtgccc gcgattgggc ggccgtgcgg gaagatcaac cgctaaccgt 2820

tgtcggcatc gaccgcccga cgattgaccg cgacgtgaag gccatcggcc ggcgcgactt 2880

cgtagtgatc gacggagcgc cccaggcggc ggacttggct gtgtccgcga tcaaggcagc 2940

cgacttcgtg ctgattccgg tgcagccaag cccttacgac atatgggcca ccgccgacct 3000

ggtggagctg gttaagcagc gcattgaggt cacggatgga aggctacaag cggcctttgt 3060

cgtgtcgcgg gcgatcaaag gcacgcgcat cggcggtgag gttgccgagg cgctggccgg 3120

gtacgagctg cccattcttg agtcccgtat cacgcagcgc gtgagctacc caggcactgc 3180

cgccgccggc acaaccgttc ttgaatcaga acccgagggc gacgctgccc gcgaggtcca 3240

ggcgctggcc gctgaaatta aatcaaaact catttgagtt aatgaggtaa agagaaaatg 3300

agcaaaagca caaacacgct aagtgccggc cgtccgagcg cacgcagcag caaggctgca 3360

acgttggcca gcctggcaga cacgccagcc atgaagcggg tcaactttca gttgccggcg 3420

gaggatcaca ccaagctgaa gatgtacgcg gtacgccaag gcaagaccat taccgagctg 3480

ctatctgaat acatcgcgca gctaccagag taaatgagca aatgaataaa tgagtagatg 3540

aattttagcg gctaaaggag gcggcatgga aaatcaagaa caaccaggca ccgacgccgt 3600

ggaatgcccc atgtgtggag gaacgggcgg ttggccaggc gtaagcggct gggttgtctg 3660

ccggccctgc aatggcactg gaacccccaa gcccgaggaa tcggcgtgac ggtcgcaaac 3720

catccggccc ggtacaaatc ggcgcggcgc tgggtgatga cctggtggag aagttgaagg 3780

ccgcgcaggc cgcccagcgg caacgcatcg aggcagaagc acgccccggt gaatcgtggc 3840

aagcggccgc tgatcgaatc cgcaaagaat cccggcaacc gccggcagcc ggtgcgccgt 3900

cgattaggaa gccgcccaag ggcgacgagc aaccagattt tttcgttccg atgctctatg 3960

acgtgggcac ccgcgatagt cgcagcatca tggacgtggc cgttttccgt ctgtcgaagc 4020

gtgaccgacg agctggcgag gtgatccgct acgagcttcc agacgggcac gtagaggttt 4080

ccgcagggcc ggccggcatg gccagtgtgt gggattacga cctggtactg atggcggttt 4140

cccatctaac cgaatccatg aaccgatacc gggaagggaa gggagacaag cccggccgcg 4200

tgttccgtcc acacgttgcg gacgtactca agttctgccg gcgagccgat ggcggaaagc 4260

agaaagacga cctggtagaa acctgcattc ggttaaacac cacgcacgtt gccatgcagc 4320

gtacgaagaa ggccaagaac ggccgcctgg tgacggtatc cgagggtgaa gccttgatta 4380

gccgctacaa gatcgtaaag agcgaaaccg ggcggccgga gtacatcgag atcgagctag 4440

ctgattggat gtaccgcgag atcacagaag gcaagaaccc ggacgtgctg acggttcacc 4500

ccgattactt tttgatcgat cccggcatcg gccgttttct ctaccgcctg gcacgccgcg 4560

ccgcaggcaa ggcagaagcc agatggttgt tcaagacgat ctacgaacgc agtggcagcg 4620

ccggagagtt caagaagttc tgtttcaccg tgcgcaagct gatcgggtca aatgacctgc 4680

cggagtacga tttgaaggag gaggcggggc aggctggccc gatcctagtc atgcgctacc 4740

gcaacctgat cgagggcgaa gcatccgccg gttcctaatg tacggagcag atgctagggc 4800

aaattgccct agcaggggaa aaaggtcgaa aaggtctctt tcctgtggat agcacgtaca 4860

ttgggaaccc aaagccgtac attgggaacc ggaacccgta cattgggaac ccaaagccgt 4920

acattgggaa ccggtcacac atgtaagtga ctgatataaa agagaaaaaa ggcgattttt 4980

ccgcctaaaa ctctttaaaa cttattaaaa ctcttaaaac ccgcctggcc tgtgcataac 5040

tgtctggcca gcgcacagcc gaagagctgc aaaaagcgcc tacccttcgg tcgctgcgct 5100

ccctacgccc cgccgcttcg cgtcggccta tcgcggccgc tggccgctca aaaatggctg 5160

gcctacggcc aggcaatcta ccagggcgcg gacaagccgc gccgtcgcca ctcgaccgcc 5220

ggcgcccaca tcaaggcacc ctgcctcgcg cgtttcggtg atgacggtga aaacctctga 5280

cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa 5340

gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat gacccagtca 5400

cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag attgtactga 5460

gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca 5520

ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag 5580

cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag 5640

gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc 5700

tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc 5760

agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc 5820

tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt 5880

cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg gtgtaggtcg 5940

ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat 6000

ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag 6060

ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt 6120

ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc 6180

cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta 6240

gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag 6300

atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga 6360

ttttggtcat gcattctagg tactaaaaca attcatccag taaaatataa tattttattt 6420

tctcccaatc aggcttgatc cccagtaagt caaaaaatag ctcgacatac tgttcttccc 6480

cgatatcctc cctgatcgac cggacgcaga aggcaatgtc ataccacttg tccgccctgc 6540

cgcttctccc aagatcaata aagccactta ctttgccatc tttcacaaag atgttgctgt 6600

ctcccaggtc gccgtgggaa aagacaagtt cctcttcggg cttttccgtc tttaaaaaat 6660

catacagctc gcgcggatct ttaaatggag tgtcttcttc ccagttttcg caatccacat 6720

cggccagatc gttattcagt aagtaatcca attcggctaa gcggctgtct aagctattcg 6780

tatagggaca atccgatatg tcgatggagt gaaagagcct gatgcactcc gcatacagct 6840

cgataatctt ttcagggctt tgttcatctt catactcttc cgagcaaagg acgccatcgg 6900

cctcactcat gagcagattg ctccagccat catgccgttc aaagtgcagg acctttggaa 6960

caggcagctt tccttccagc catagcatca tgtccttttc ccgttccaca tcataggtgg 7020

tccctttata ccggctgtcc gtcattttta aatataggtt ttcattttct cccaccagct 7080

tatatacctt agcaggagac attccttccg tatcttttac gcagcggtat ttttcgatca 7140

gttttttcaa ttccggtgat attctcattt tagccattta ttatttcctt cctcttttct 7200

acagtattta aagatacccc aagaagctaa ttataacaag acgaactcca attcactgtt 7260

ccttgcattc taaaacctta aataccagaa aacagctttt tcaaagttgt tttcaaagtt 7320

ggcgtataac atagtatcga cggagccgat tttgaaaccg cggtgatcac aggcagcaac 7380

gctctgtcat cgttacaatc aacatgctac cctccgcgag atcatccgtg tttcaaaccc 7440

ggcagcttag ttgccgttct tccgaatagc atcggtaaca tgagcaaagt ctgccgcctt 7500

acaacggctc tcccgctgac gccgtcccgg actgatgggc tgcctgtatc gagtggtgat 7560

tttgtgccga gctgccggtc ggggagctgt tggctggctg gtggcaggat atattgtggt 7620

gtaaacaaat tgacgcttag acaacttaat aacacattgc ggacgttttt aatgtactga 7680

attaacgccg aattaattcg ggggatctgg attttagtac tggattttgg ttttaggaat 7740

tagaaatttt attgatagaa gtattttaca aatacaaata catactaagg gtttcttata 7800

tgctcaacac atgagcgaaa ccctatagga accctaattc ccttatctgg gaactactca 7860

cacattatta tggagaaact cgagcttgtc gatcgacaga tccggtcggc atctactcta 7920

tttctttgcc ctcggacgag tgctggggcg tcggtttcca ctatcggcga gtacttctac 7980

acagccatcg gtccagacgg ccgcgcttct gcgggcgatt tgtgtacgcc cgacagtccc 8040

ggctccggat cggacgattg cgtcgcatcg accctgcgcc caagctgcat catcgaaatt 8100

gccgtcaacc aagctctgat agagttggtc aagaccaatg cggagcatat acgcccggag 8160

tcgtggcgat cctgcaagct ccggatgcct ccgctcgaag tagcgcgtct gctgctccat 8220

acaagccaac cacggcctcc agaagaagat gttggcgacc tcgtattggg aatccccgaa 8280

catcgcctcg ctccagtcaa tgaccgctgt tatgcggcca ttgtccgtca ggacattgtt 8340

ggagccgaaa tccgcgtgca cgaggtgccg gacttcgggg cagtcctcgg cccaaagcat 8400

cagctcatcg agagcctgcg cgacggacgc actgacggtg tcgtccatca cagtttgcca 8460

gtgatacaca tggggatcag caatcgcgca tatgaaatca cgccatgtag tgtattgacc 8520

gattccttgc ggtccgaatg ggccgaaccc gctcgtctgg ctaagatcgg ccgcagcgat 8580

cgcatccata gcctccgcga ccggttgtag aacagcgggc agttcggttt caggcaggtc 8640

ttgcaacgtg acaccctgtg cacggcggga gatgcaatag gtcaggctct cgctaaactc 8700

cccaatgtca agcacttccg gaatcgggag cgcggccgat gcaaagtgcc gataaacata 8760

acgatctttg tagaaaccat cggcgcagct atttacccgc aggacatatc cacgccctcc 8820

tacatcgaag ctgaaagcac gagattcttc gccctccgag agctgcatca ggtcggagac 8880

gctgtcgaac ttttcgatca gaaacttctc gacagacgtc gcggtgagtt caggcttttt 8940

catatctcat tgccccccgg gatctgcgaa agctcgagag agatagattt gtagagagag 9000

actggtgatt tcagcgtgtc ctctccaaat gaaatgaact tccttatata gaggaaggtc 9060

ttgcgaagga tagtgggatt gtgcgtcatc ccttacgtca gtggagatat cacatcaatc 9120

cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg 9180

gggtccatct ttgggaccac tgtcggcaga ggcatcttga acgatagcct ttcctttatc 9240

gcaatgatgg catttgtagg tgccaccttc cttttctact gtccttttga tgaagtgaca 9300

gatagctggg caatggaatc cgaggaggtt tcccgatatt accctttgtt gaaaagtctc 9360

aatagccctt tggtcttctg agactgtatc tttgatattc ttggagtaga cgagagtgtc 9420

gtgctccacc atgttatcac atcaatccac ttgctttgaa gacgtggttg gaacgtcttc 9480

tttttccacg atgctcctcg tgggtggggg tccatctttg ggaccactgt cggcagaggc 9540

atcttgaacg atagcctttc ctttatcgca atgatggcat ttgtaggtgc caccttcctt 9600

ttctactgtc cttttgatga agtgacagat agctgggcaa tggaatccga ggaggtttcc 9660

cgatattacc ctttgttgaa aagtctcaat agccctttgg tcttctgaga ctgtatcttt 9720

gatattcttg gagtagacga gagtgtcgtg ctccaccatg ttggcaagct gctctagcca 9780

atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg gcacgacagg 9840

tttcccgact ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta gctcactcat 9900

taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc 9960

ggataacaat ttcacacagg aaacagctat gacatgatta cg 10002

<210> 5

<211> 1557

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 5

atgaaacagg agctggtttt cataccatca cctggtgacg gccacatcag accattagtg 60

caggttgcta agctccttgt cgaccgtgat gaacatatct ccatcaccat cctcatcatc 120

cctcagatgc atggattcgg tagcggaagc tctaactcct acatcgcttc tctctccacc 180

gcatctgaag accgcctcca ctacaacgtt ctctccgtcg ccgatgaacc aaactctgat 240

gacgccaaac ccaacttcct ctctcacatc aatagcttca agccacaggt gaaggccacg 300

gttgagaaac tcatcacttc cccagcccga cccgactcgc cgccgtcaag actcgctgga 360

atcgtggtgg acatgttctg cacggacatg attgatgtcg ccaacgagtt tgacgtaccg 420

agttacatgt tttacacctc caacgctacg tttctcgggt tgctaagcca cgttcagcat 480

ctttacgatg ataagaacta tgacgtcagc gacttgttgg attcggaggt taccgagctg 540

gagattccgt gtttgacatg tcctttgccg gttaagtgtt taccctctgt gatgttaaac 600

aaggagtggc taccgattgc gctttcacaa gtgagaagat acaaagaaac aaagggtatt 660

ttggtaaata cgtttgcaga actggagccc caagctatga agtttttctc cggagaagat 720

aaccttcttc ctaccgtgta tcccgtggga cccattttga acctcaaaac caacggtcca 780

aatccggcgg acgataaaca gtcagagatc ttacggtggt tggacgagca gcctcgtgaa 840

accgttgtgt tcctctgttt tggaagcatg ggaggtttcc gtgaggatca agcaaaggaa 900

atcgcaatag cgcttgagcg aagtggccat cgtttcgttt ggtctctccg ccgtgctcgg 960

ccagagggaa ctaggggacc tcccggagag tttacaaacc ttgaagagat tctgccggag 1020

ggatttttag atcggacggc gaagattggg aaggttatcg gttgggctcc acagaccgcc 1080

atactagcaa accctgctgt ccgaggattt gtgtcgcact gtggttggaa ctcgacactg 1140

gagagtctct ggttcggtgt tccgatagcc acgtggccac tctatgccga gcaacaagtt 1200

aacgcgttcg agatggtgga ggagctaggg ctagcagtgg aaatccgaaa ctctttcagg 1260

gcagatttca tggcggcgga gtcggagttg atgacggcgg aggagataga gcgggggatc 1320

cgctgtttga tggagcagga taacgtgagg gatagagtga aggagatgag tgagaagagc 1380

cacgtgtctt taatggaagg tggatcttcg cacgctgctc ttctcaagtt cattgaagat 1440

gtcacttcga atatctctca tttaaatact agtggatccg gtaccatgga ctacaaagac 1500

catgatggag actataagga tcacgacatc gattacaagg acgatgacga taagtaa 1557

<210> 6

<211> 518

<212> PRT

<213>artificial sequence

<220>

<223>

<400> 6

Met Lys Gln Glu Leu Val Phe Ile Pro Ser Pro Gly Asp Gly His Ile

1 5 10 15

Arg Pro Leu Val Gln Val Ala Lys Leu Leu Val Asp Arg Asp Glu His

20 25 30

Ile Ser Ile Thr Ile Leu Ile Ile Pro Gln Met His Gly Phe Gly Ser

35 40 45

Gly Ser Ser Asn Ser Tyr Ile Ala Ser Leu Ser Thr Ala Ser Glu Asp

50 55 60

Arg Leu His Tyr Asn Val Leu Ser Val Ala Asp Glu Pro Asn Ser Asp

65 70 75 80

Asp Ala Lys Pro Asn Phe Leu Ser His Ile Asn Ser Phe Lys Pro Gln

85 90 95

Val Lys Ala Thr Val Glu Lys Leu Ile Thr Ser Pro Ala Arg Pro Asp

100 105 110

Ser Pro Pro Ser Arg Leu Ala Gly Ile Val Val Asp Met Phe Cys Thr

115 120 125

Asp Met Ile Asp Val Ala Asn Glu Phe Asp Val Pro Ser Tyr Met Phe

130 135 140

Tyr Thr Ser Asn Ala Thr Phe Leu Gly Leu Leu Ser His Val Gln His

145 150 155 160

Leu Tyr Asp Asp Lys Asn Tyr Asp Val Ser Asp Leu Leu Asp Ser Glu

165 170 175

Val Thr Glu Leu Glu Ile Pro Cys Leu Thr Cys Pro Leu Pro Val Lys

180 185 190

Cys Leu Pro Ser Val Met Leu Asn Lys Glu Trp Leu Pro Ile Ala Leu

195 200 205

Ser Gln Val Arg Arg Tyr Lys Glu Thr Lys Gly Ile Leu Val Asn Thr

210 215 220

Phe Ala Glu Leu Glu Pro Gln Ala Met Lys Phe Phe Ser Gly Glu Asp

225 230 235 240

Asn Leu Leu Pro Thr Val Tyr Pro Val Gly Pro Ile Leu Asn Leu Lys

245 250 255

Thr Asn Gly Pro Asn Pro Ala Asp Asp Lys Gln Ser Glu Ile Leu Arg

260 265 270

Trp Leu Asp Glu Gln Pro Arg Glu Thr Val Val Phe Leu Cys Phe Gly

275 280 285

Ser Met Gly Gly Phe Arg Glu Asp Gln Ala Lys Glu Ile Ala Ile Ala

290 295 300

Leu Glu Arg Ser Gly His Arg Phe Val Trp Ser Leu Arg Arg Ala Arg

305 310 315 320

Pro Glu Gly Thr Arg Gly Pro Pro Gly Glu Phe Thr Asn Leu Glu Glu

325 330 335

Ile Leu Pro Glu Gly Phe Leu Asp Arg Thr Ala Lys Ile Gly Lys Val

340 345 350

Ile Gly Trp Ala Pro Gln Thr Ala Ile Leu Ala Asn Pro Ala Val Arg

355 360 365

Gly Phe Val Ser His Cys Gly Trp Asn Ser Thr Leu Glu Ser Leu Trp

370 375 380

Phe Gly Val Pro Ile Ala Thr Trp Pro Leu Tyr Ala Glu Gln Gln Val

385 390 395 400

Asn Ala Phe Glu Met Val Glu Glu Leu Gly Leu Ala Val Glu Ile Arg

405 410 415

Asn Ser Phe Arg Ala Asp Phe Met Ala Ala Glu Ser Glu Leu Met Thr

420 425 430

Ala Glu Glu Ile Glu Arg Gly Ile Arg Cys Leu Met Glu Gln Asp Asn

435 440 445

Val Arg Asp Arg Val Lys Glu Met Ser Glu Lys Ser His Val Ser Leu

450 455 460

Met Glu Gly Gly Ser Ser His Ala Ala Leu Leu Lys Phe Ile Glu Asp

465 470 475 480

Val Thr Ser Asn Ile Ser His Leu Asn Thr Ser Gly Ser Gly Thr Met

485 490 495

Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp Tyr

500 505 510

Lys Asp Asp Asp Asp Lys

515

Claims (10)

1. protein UGT146 is following a1) or a2) or a3) or a4):

A1) amino acid sequence is protein shown in sequence 2 in sequence table；

A2) the fused protein that the N-terminal of protein shown in sequence 2 or/and C-terminal connection label obtain in sequence table；

A3) amino acid sequence is protein shown in sequence 6 in sequence table；

A4) by a1) or a2) or a3) shown in protein by one or several amino acid residues substitution and/or missing and/ Or the protein with glycosyl transferase activity that addition obtains.

2. encoding the nucleic acid molecules of protein UGT146 described in claim 1.

3. nucleic acid molecules as claimed in claim 2, it is characterised in that: the nucleic acid molecules be following b1) b2) or b3) or B4 DNA molecular shown in) or b5):

B1) code area is DNA molecular shown in sequence 1 in sequence table；

B2) nucleotide sequence is DNA molecular shown in sequence 1 in sequence table；

B3) nucleotide sequence is DNA molecular shown in sequence 5 in sequence table；

B4) and b1) or b2) or the nucleotide sequence that b3) limits there is 75% or 75% or more identity, derive from woaded blue and volume The DNA molecular of protein UGT146 described in code claim 1；

B5) under strict conditions with b1) or b2) or b3) nucleotide sequence hybridization that limits, from woaded blue and coding right is wanted Seek the DNA molecular of the 1 protein UGT146.

4. expression cassette, recombinant vector, recombinant microorganism or transgenic cell line containing nucleic acid molecules described in Claims 2 or 3.

5.X1) or X2):

X1) protein UGT146 described in claim 1, or, nucleic acid molecules described in Claims 2 or 3, or, containing claim 2 Or 3 the nucleic acid molecules expression cassette, recombinant vector, recombinant microorganism or transgenic cell line, application, be following c1) extremely At least one of c6):

C1) as the application of glycosyl transferase；

C2) the application in the product that preparation has glycosyl transferase function；

C3) the application in production lariciresinol list glucoside and/or lariciresinol double glucosides；

C4) product for producing lariciresinol list glucoside and/or lariciresinol double glucosides is being prepared In application；

C5) the application in conversion lariciresinol；

C6) application in the product for converting lariciresinol is being prepared；

X2) protein UGT146 described in claim 1, or, nucleic acid molecules described in Claims 2 or 3, or, containing claim 2 Or 3 the nucleic acid molecules expression cassette, recombinant vector, recombinant microorganism or transgenic cell line, cultivate lariciresinol Application in single glucoside content increase and/or the increased genetically modified plants of lariciresinol double glucosides content.

6. a kind of method for cultivating genetically modified plants, including improving protein UGT146 described in claim 1 in the plant that sets out Expression quantity and/or activity, the step of obtaining genetically modified plants；Compared with the plant that sets out, the fallen leaves of the genetically modified plants Pine tree lipidol list glucoside content increases and/or lariciresinol double glucosides content increases.

7. application as claimed in claim 5 or method of claim 6, it is characterised in that: the plant is following G1) Any one of to G4): c1) dicotyledon；C2) monocotyledon；C3) Cruciferae section plant；C4) woaded blue.

8. a kind of method for cultivating transgenosis woaded blue hairy, including improve the egg described in hairy middle claim 1 of woaded blue that sets out The expression quantity and/or activity of white matter UGT146, the step of obtaining transgenosis woaded blue hairy；Compared with control woaded blue hairy, Transgenosis woaded blue hairy lariciresinol list glucoside content increases and/or lariciresinol double glucosides contain Amount increases.

9. method according to claim 8, it is characterised in that: described " raising is set out woaded blue hairy middle protein UGT146 Expression quantity and/or activity " pass through to the woaded blue that sets out hairy import coding claim 1 described in protein UGT146 core Acid molecule is realized.

10. any method of application or claim 6 to 9 as described in claim 5 or 7, it is characterised in that: described Lariciresinol list glucoside can be lariciresinol -4-O- β-D-Glucose glycosides and/or lariciresinol -4 ' - O- β-D-Glucose glycosides；The lariciresinol double glucosides can be the peaceful B of straight clematis.