CN109439674B - Method for improving herbicide dicamba resistance and plant photosensitivity of soybeans by transferring DMO gene - Google Patents

Abstract

The invention discloses a method for improving the herbicide-resistant dicamba resistance and plant photosensitivity of soybeans by transferring dicamba monooxygenase genes, which obtains a DNA molecule with a nucleotide sequence shown as SEQ ID NO.2 by carrying out codon optimization on a DMO gene; a method for cultivating herbicide-resistant transgenic soybean by using the gene. The invention provides a solution for controlling the growth of weeds in agriculture, reduces the labor consumption of manual weeding and is convenient for production and utilization. Because the carrier contains the broad-spectrum herbicide resistance gene, the weeding range of the plant is further expanded, and the application range is enlarged. Meanwhile, the DMO gene-transferred soybean of the invention has normal leaf growth under low light and has utilization potential under shade conditions such as intercropping and the like.

Description

Method for improving herbicide dicamba resistance and plant photosensitivity of soybeans by transferring DMO gene

Technical Field

The invention belongs to the fields of molecular biology, genetic engineering technology and transgenic breeding, relates to Dicamba monooxygenase genes (DMO) and application thereof in herbicide-tolerant transgenic soybean cultivation, and provides a method for cultivating Dicamba-resistant transgenic soybean by using the DMO monooxygenase genes, and a detection and identification method of a DMO overexpression vector, an engineering bacterium and a positive transgenic seedling used in the cultivation process.

Background

Weeds can compete with crops for growth space and nutrients, and simultaneously spread various plant diseases and insect pests, so that serious harm is caused to the growth and development of the crops (Wangying, Li hong. research status [ J ] of herbicide-resistant transgenic plants, 2005,40(4): 15-17; Li Yunhe, Li Xiangju, Pengfa. global development and utilization of transgenic herbicide-resistant crops and development prospects and strategies in China [ J ] plant protection, 2011,37(06): 32-37). According to the statistics of the grain and agriculture organization of the United nations, the economic loss caused by the weed damage reaches 160-. Chemical weeding is a common weed management mode at present, but many crops and weeds are sensitive to herbicides, and easily cause phytotoxicity to the crops to influence plant growth.

Dicamba is a systemic conduction type selective hormone herbicide, belonging to benzoic acid. In China, dicamba is used as a high-efficiency low-toxicity herbicide and is mainly suitable for weed control of crops such as wheat, corn, millet, sorghum and the like.

Because the dicamba has the characteristics of high efficiency, low toxicity, strong weed killing capability, quick drug effect, moderate persistent effect and the like, the dicamba is popular with consumers. After the herbicide is sprayed for 24 hours, the weeds have malformed curly phenomenon and die after 15-24 days. It has remarkable control effect on hundreds of annual and perennial broadleaf weeds, such as: can prevent and kill off vicious weeds such as cleavers, gooseberries, descurainia sophia, xanthium sibiricum, Convolvulus arvensis, aralia elata, field horsetail, carp intestines and the like. Meanwhile, the herbicide can be mixed with other herbicides for use, so that the weeding range is expanded, and the lasting period is prolonged.

A monooxygenase gene capable of degrading dicamba was isolated from the bacterium Stenotrophoromonas maltophilia DI-6. Research shows that the gene can encode non-blood red monooxygenase protein, and dicamba can lose activity when the gene is expressed in plant nuclear genome and chloroplast genome. A key role in this degradation process is dicamba demethylated monooxygenase. The enzyme is mainly used in the electron transport chain, where NADH (reduced form of nicotinamide adenine dinucleotide) shuttles through the reductase to ferredoxin to DMO (monooxygenase), and finally to dicamba to degrade it to non-toxic intermediates (DCSA).

Dicamba-resistant soybeans obtained by transformation of dicamba monooxygenase gene cloned from stenotrophomonas maltophilia were used by Mensanto corporation in 2009 and field experiments were performed. The reports show that the over-expression of the herbicide-resistant gene DMO in the soybeans by a transgenic means has feasibility for cultivating herbicide-resistant germplasm. However, the use of the monooxygenase (DMO) gene degrading dicamba in soybean has been reported relatively rarely.

Disclosure of Invention

The invention aims to fill the blank in herbicide-resistant transgenic soybean breeding by DMO genes and the prior art means aiming at the single kind of soybean herbicide in practical production and the sensitivity to individual herbicide, cultivate herbicide-resistant germplasm of soybeans and improve the herbicide-resistant performance of the soybeans, thereby reducing the influence of weeds in agricultural production and promoting the production of the soybeans.

The purpose of the invention can be realized by the following technical scheme:

a DNA molecule which is any one of the following a) to c):

a) a DNA molecule with a nucleotide sequence shown as SEQ ID NO. 3;

b) a complementary sequence of the nucleotide sequence shown as SEQ ID NO. 3;

c) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.3, and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in SEQ ID NO. 2.

The DNA molecule provided by the invention is a brand new DMO gene; because the gene is different from the reported DMO gene through codon optimization, the similarity is only 74 percent; the comparative graph is shown in FIG. 1.

A recombinant DNA molecule comprising a plant leader peptide nucleotide sequence and the DNA molecule sequence of claim 1, wherein the nucleotide sequence of the recombinant DNA molecule is shown in SEQ ID No. 2.

Recombinant vectors, expression cassettes, transgenic cell lines or engineering bacteria containing the above DNA molecules or the above recombinant DNA molecules.

The recombinant vector is obtained by inserting the above-mentioned DNA molecule or the above-mentioned recombinant DNA molecule into a vector. The recombinant vector is a recombinant expression vector or a recombinant cloning vector. Preferably, the DNA molecule shown in SEQ ID NO.3 or the recombinant DNA molecule shown in SEQ ID NO.2 is inserted into a plant expression vector PCAMBIA3300 to obtain a recombinant expression vector PCAMBIA3300-DMO, wherein the expression vector itself carries a screening marker gene BAR. The transgenic engineering bacterium is obtained by transferring the recombinant vector into an engineering bacterium.

The DNA molecule, the recombinant DNA molecule or the recombinant vector, the expression cassette, the transgenic cell line or the engineering bacterium are applied to improving the herbicide-resistant dicamba and plant photosensitivity of the soybean or cultivating herbicide-resistant transgenic plants.

A method for cultivating herbicide-tolerant transgenic plants is characterized in that the DNA molecules or the recombinant DNA molecules are introduced into plant genomes and screened to obtain herbicide-tolerant positive transgenic plants. The process of introducing the DNA molecule or the recombinant DNA molecule into the genome of the plant is as follows: constructing a plant expression vector containing the DNA molecule, and introducing the constructed plant expression vector into a plant genome by an agrobacterium-mediated method.

The plants described in the present invention are dicotyledonous plants; the dicotyledonous plant is preferably soybean. Preferably, the DNA molecule or the recombinant DNA molecule is constructed to a PCAMBIA3300 plant expression vector, and the exogenous gene DMO gene is introduced into the genome of the soybean plant by an agrobacterium-mediated cotyledonary node transformation method to obtain the herbicide-resistant transgenic soybean.

The screening process in the method comprises the following steps: detecting and screening the obtained T0 generation transgenic plants through herbicide and PCR; screening the homozygous transgenic plants, and screening out herbicide-resistant dicamba positive transgenic plants.

The specific primers for PCR detection are as follows:

an upstream primer KDMO-F, the sequence of which is SEQ ID NO.4,

the sequence of the downstream primer KDMO-R is SEQ ID NO. 5.

A method for measuring the relative expression quantity of a DMO gene of a herbicide-tolerant transgenic plant comprises the steps of designing a specific primer, and measuring the expression quantity of the DMO gene in the herbicide-tolerant transgenic plant by fluorescence quantitative PCR (polymerase chain reaction), wherein the specific primer comprises the following components:

an upstream primer RT DMO-F with the sequence of SEQ ID NO.7,

the sequence of the downstream primer RT DMO-R is SEQ ID NO. 8.

The invention has the beneficial effects that:

the exogenous resistance gene is introduced into the soybean by an agrobacterium-mediated cotyledonary node transformation method to improve the herbicide resistance of the soybean, the transformation rate of transgenic soybean is low, the gene belongs to the exogenous gene, and a plant has a defense system which can reject the exogenous gene and sometimes even disappear in later generations, so the experimental result is difficult to add due to the phenomenon, and the new exploration provides a novel and practical method for breeding soybean resistant varieties by using a genetic engineering technology. As described above, when the DMO gene sequence disclosed in the prior art is transferred into soybean, the DMO gene sequence may disappear in the later generation due to the effect of the rejection of the foreign gene by the plant's own defense system, resulting in low conversion rate of the gene in soybean and difficulty in obtaining a stable transgenic soybean for the later generation. In order to solve the technical problems, the invention obtains a brand new DMO gene by carrying out codon optimization on the gene, and experimental results prove that the DMO gene after the codon optimization can be successfully integrated into the genome of a transgenic plant in a low copy mode and be transcribed, so that the stable transgenic soybean expression resistance with herbicide resistance is obtained, the environment is not polluted, the blank of the prior art can be filled, a novel and practical method is provided for breeding soybean resistant varieties by using a genetic engineering technology, and the soybean biotechnology breeding process is effectively promoted.

Drawings

FIG. 1 is a sequence alignment chart of DMO gene after codon optimization, and the sequence similarity of the two genes is 74%.

FIG. 2 map of recombinant plant expression vector PCAMBIA 3300-DMO.

FIG. 3 is a cultivation diagram of DMO dicamba resistant transgenic soybean transformants.

Wherein, 1: germinating the seeds; 2: preparing an explant; 3: infecting with a strain; 4: initial co-culture; 5: after co-culture for 5 d; 6: bud induction; 7, bud elongation; 8: rooting; 9: hardening seedlings; 10: growth of

FIG. 4 shows the result of PCR detection of DMO gene.

Wherein, Line 1: marker 5000; line 2-3: negative controls, water, wlimas82, respectively; line 4: a positive control plasmid; line 5-25: transgenic material, with bands indicating positive, indicating that the gene has been integrated, without bands indicating that the gene has not entered the soybean genome, amplified gene is approximately 600 bp.

FIG. 5 shows the test results of the test strip.

FIG. 6Basta resistance identification results.

Where the left side represents transgenic material and the right side represents control non-transgenic material.

FIG. 7 shows the results of the detection of herbicide application to transgenic material.

FIG. 8 shows the results of photosensitivity assay of transgenic soybean.

Wherein CK shows that three compound leaves of a non-transgenic plant cannot be completely unfolded due to the influence of light and the leaf deformity characteristics.

FIG. 9 shows the relative expression level of DMO gene after applying dicamba herbicide for 12 h.

FIG. 10 is a real-time quantitative PCR amplification curve and a melting curve of reference gene Lectin.

FIG. 11 real-time quantitative PCR amplification curve and lysis curve of the gene of interest DMO.

FIG. 12 reference gene Lectin and the DMO standard curve of the target gene.

Detailed Description

The technical scheme route of the invention is as follows: constructing a plant expression vector containing a DMO gene; introducing the DMO gene into soybean by an agrobacterium-mediated cotyledonary node transformation method, screening by dicamba to obtain a resistant plant, carrying out PCR (polymerase chain reaction) of a genome DNA (deoxyribonucleic acid) level and test strip detection of a protein level on the resistant rooting plant, and verifying whether an exogenous gene is integrated into a genome of a transgenic plant and generates transcription. Resistance analysis is carried out on the transgenic line, and the function of the DMO gene in herbicide resistance of the soybean is confirmed. The technical means of the invention specifically comprises the following steps:

codon optimization target gene and construction of plant expression vector and transgenic engineering bacterium

With reference to the full-length gene sequence CDS (GenBank No. aav53699) of dmc from Pseudomonas maltophilia strain DI-6, the gene of dmc (as shown in SEQ ID No. 1) was codon optimized according to the amino acid codon bias of soybean plants in a soybean crop expression host, with the optimization parameters mainly including: the optimized gene suitable for soybean expression is named as DMO by adjusting codon adaptive index, dominant codon frequency, GC content and the like, the nucleotide sequence of the gene is shown as SEQ ID NO.3, a section of plant leader peptide sequence of 165bp is added into the optimized DMO gene to obtain a recombinant sequence, the nucleotide sequence is shown as SEQ ID NO.2, and the encoded protein is shown as SEQ ID NO. 6. The invention obtains a brand new DMO gene by carrying out codon optimization on the gene, and experimental results prove that the DMO gene subjected to the codon optimization can be successfully integrated into the genome of a transgenic plant in a low copy mode and can be transcribed, so that the stable transgenic soybean expression resistance with herbicide resistance is obtained.

And (3) entrusting the optimized DMO gene shown as SEQ ID NO.2 to biotechnology companies for artificial synthesis of a whole gene sequence, and introducing XbalI enzyme cutting sites into 5' segments of the gene. Introducing a Scal enzyme cutting site into the 3' segment, cloning the gene into a vector PCAMBIA3300 vector after synthesis to construct a plant expression vector PCAMBIA3300-DMO (shown in figure 2), transferring the plasmid with correct sequencing into agrobacterium EHA105 for storage, and preparing for the next experiment.

Method for cultivating dicamba herbicide-resistant plants

(I) obtaining of DMO Dicamba-resistant transgenic Soybean transformants

(1) Seed sterilization: the robust and plump soybean seeds were placed in open petri dishes. The dish was placed in a standard size desiccator with a sealed lid (ensuring that the lid was operational). A beaker containing 100ml of sodium hypochlorite is placed in a dryer, 15ml of concentrated hydrochloric acid is added into a separating funnel, the hydrochloric acid is slowly added into the beaker to react to generate chlorine, and the seeds are sterilized for 2 hours.

(2) Seed germination: the sterilized seeds were placed in GM germination medium (20XMS bulk medium 25ml/L, 200XMS minimal medium 2.5ml/L, 200 Xferric salt 2.5ml/L, sucrose 5g/L, pH ═ 5.8, agar 7.8g/L) and cultured at 24 ℃ for 18h (dark culture).

(3) Co-culturing: first, prepare Agrobacterium, inoculate EHA105 strain containing PCAMBIA3300-DMO vector, inoculate in 5ml YEP culture medium (RIF + KAN), shake for 18h, make the strain reach saturation state. The 5ml of the culture was transferred to a shake flask containing 100ml of YEP medium and cultured at 28 ℃ for 12 hours. Make OD₆₅₀To 0.6-1.0. Centrifuging the bacterial solution at 4000 rpm at 25 deg.C for 10min to precipitate, removing supernatant, suspending the bacterial precipitate in L-CCM liquid co-culture medium to obtain final concentration of 0.6-1.0 (OD in OD)₆₅₀Under the conditions) (formula of L-CCM liquid co-culture medium: 5ml/L of 20X B5 mass culture medium, 0.5ml/L of 200X B5 micro-culture medium, 1ml/L of 100X B5 vitamin, 0.5ml/L, MES 3.9.9 g/L of 200X ferric salt, 30g/L, pH ═ 5.4 of sucrose, 5g/L of agar, 824ul of 2mg/ml benzylaminopurine, 250ul of 1mg/ml gibberellin, 1000ul of 40mg/ml acetosyringone and 1000ul of 154.2mg/ml dithiothreitol, and the volume is fixed to 1L). ② preparing explant, selecting plump soybean seeds, cutting the soybean along the soybean hilum with operation knifeThen 5-7 cuts are made in the axial direction of the joint of cotyledon and cotyledon hypocotyl. The incision should be approximately 3-4mm long and ready for inoculation. Inoculating explant, adding 35-45 ml of agrobacterium liquid into a triangular flask, adding 30-40 pieces of prepared explant and ensuring that the explant is fully coated by the inoculum. The tissues were allowed to stand in the inoculum for 30 minutes with occasional shaking of the flask. Fourthly, co-culture is carried out, a layer of filter paper (20X B5 mass culture medium 5ml/L, 200X B5 micro culture medium 0.5ml/L, 100X B5 vitamin 1ml/L, 200 Xferric salt 0.5ml/L, MES 3.9.9 g/L, sucrose 30g/L, pH ═ 5.4, agar 5g/L, 2mg/ml benzylaminopurine 824ul, 1mg/ml gibberellin 250ul, 40mg/ml acetosyringone 1000ul, 154.2mg/ml dithiothreitol 1000ul, 100mg/ml L-cysteine 4000ul, 158mg/ml sodium thiosulfate 1000ul is laid on the CCM co-culture medium, the explant after the impregnation is horizontally placed on the surface of the filter paper, and the light culture is carried out for 5d (16/8h, 90 ummol. m.m.sub.sub.25 ℃ condition) at 25 DEG C^-2·s^-1)。

(5) Inducing cluster buds: washing the explant with liquid bud induction culture medium Wash-liquid media for 2-3 times (50 ml/L of 20X B5 mass culture medium, 50ml/L of 200X B5 micro 5ml/L, 100XB5 vitamin 10ml/L, 5ml/L, MES 0.58.58 g/L of 200 Xferric salt, 30g/L, pH ═ 5.6 sucrose, 824ul of 2mg/ml benzylaminopurine, 250ul of 1mg/ml gibberellin, 500ul of 100mg/ml cefotaxime sodium, 2000ul of 250mg/ml ampicillin, and filter paper to 1L), then airing on sterilized bacteria (15cm) for about 15min, wherein no liquid is required on the external body surface, but the bean flap can not be in dry-wrinkled state for the best time, and placing on solid bud induction culture medium SI (50 ml/L of 20X B5 mass culture medium, 50ml/L of 200X B5 micro 5ml/L, 200X B5 micro 5 ml/L) with paraxial face upward, 10ml/L of 100XB5 vitamin, 5ml/L, MES 0.58.58 g/L of 200 Xferric salt, 30g/L, pH of sucrose, 7.8g/L of agar, 2mg/ml of benzylaminopurine 824ul, 100mg/ml of cefotaxime sodium 500ul, 250mg/ml of ampicillin 2000ul and 5mg/ml of glufosinate 1000ul, and the volume is up to 1L). Culturing at 25 deg.C under illumination for 4 weeks (16/8h, 90 ummol. m)^-2·s^-1). The culture medium is changed every 2 weeks, and the radicle is cut and kept for only 2-3cm when the culture medium is changed, if a young bud grows out at a growing point, the young bud needs to be cut off.

(6) Bud elongation culture: the external body after bud induction culture is converted into a solid bud elongation culture medium SE (50 ml/L of 20XMS bulk culture medium, 5ml/L of 200XMS micro culture medium, 10ml/L of 100XB5 vitamin, 5ml/L, MES 0.58.58 g/L of 200 Xferric salt, 30g/L, pH ═ 5.6 of sucrose, 7.8g/L of agar, 1000ul of 1mg/ml gibberellin, 20ul of 5mg/ml indoleacetic acid, 500ul of 2mg/ml trans-zeatin, 1000ul of 50mg/ml asparagine, 1000ul of 100mg/ml L-pyroglutamyl amine, 500ul of 100mg/ml cefotaxime sodium, 2000ul of 250mg/ml ampicillin, 1000ul of 5mg/ml pralidoxime, and 1L of 5mg/ml pralidoxime, in the process, the back of the external body needs to be slightly scratched for a few times, then the external body is inserted into the solid bud elongation culture medium with the paraxial face facing upwards, culturing at 25 deg.C under illumination for 3-5 weeks (16/8h, 90u mol. m)^-2·s^-1). The culture medium is changed every 2 weeks, and the back of the external implant needs to be slightly scratched for each change. After the culture medium is replaced for about two times, 1-2cm buds grow on the surface of part of the exosomatic part, and when the buds grow to about 3cm, the leaves of the exosomatic part do not turn yellow normally, and then the exosomatic part can enter a rooting stage.

(7) Rooting: when the bud is elongated (>2cm), the elongated seedling is cut off by scissors, placed in a rooting medium (20X B5 mass 25ml/L, 200X B5 micro 2.5ml/L, 200X ferric salt 2.5ml/L, 100X B5 vitamin 5ml/L, sucrose 15g/L, MES 0.59.59 g/L, pH ═ 5.7, agar 7.8g/L, 1mg/ml indolebutyric acid 1000ul, constant volume to 1L), rooting is about 2-4 weeks, after 3-4 fine heels grow out, the bottle cap of the culture bottle can be opened, deionized water is added, training is carried out for 3-5d, and finally, transplanting is carried out in soil for transplanting.

(8) Transplanting: carefully taking the rooted seedlings out of the culture medium by using tweezers, washing the root culture medium by using water, transplanting the seedlings into a plastic cup (the volume ratio of nutrient soil to vermiculite is 4: 1), reversely buckling the seedlings by using the plastic cup with the same size at the top to ensure that the humidity is proper, culturing the seedlings in an illumination incubator at 25 ℃ for about 1 week, observing whether thin roots grow out of the periphery of the plastic cup or not, removing the plastic cup at the top if the thin roots grow out, and putting the plastic cup in a greenhouse for normal culture, wherein the diagram is shown in fig. 3.

Attached: other culture medium formulas are as follows:

20X B5 Large Scale Medium:

KNO₃ 50g、MgSO₄.7H₂O 5g、NaH₂PO₄.2H₂O 3g、(NH4)₂SO4 2.68g、CaCl₂.2H₂O 3g。

100X B5 organic phase, adding water to a constant volume of 1L.

VB₁ 1g、VB₆0.1g, 0.1g nicotinic acid and 10g inositol, and adding water to a constant volume of 1L.

200X B5 micro medium:

H₃BO₄ 0.6g、ZnSO₄.7H₂O 0.4g、MnSO₄.H₂O 2g、CuSO₄.5H₂O 0.05g、COCl₂.6H₂O 0.05g、Na₂MnO₄.2H₂0.05g of O, and adding water to a constant volume of 1L.

20 × MS bulk medium:

KNO₃ 38g、NH₄NO₃ 33g、MgSO₄.7H₂O 7.4g、KH₂.PO₄ 3.4g、CaCL₂.2H₂o8.8 g, and the volume is up to 1L.

200 × MS minimal medium:

H₃BO₄ 1.24g、MnSO₄.H₂O 3.38g、ZnSO₄.7H₂O 1.72g、KI 1.66mg、Na₂MnO₄.2H₂O 50mg、CuSO₄.5H₂O 5mg、CaCl₂.6H₂o5 mg, and adding water to a constant volume of 1L.

(II) carrying out PCR identification and test strip detection on T0 positive transformation plants

The detection process specifically comprises the following steps:

(1) PCR detection

Respectively extracting genome DNA of a wild plant and a resistance rooting plant of a transgenic DMO gene, taking a resistance gene Bar (carried by a PCAMBIA3300 vector) and a target gene DMO as detection targets, and detecting whether a plant expression vector is integrated into a plant genome, wherein the primer sequences are as follows as shown in figure 4:

an upstream primer Bar-F: the sequence is shown as SEQ ID NO.9,

the downstream primer Bar-R: the sequence is shown as SEQ ID NO. 10;

an upstream primer KDMO-F: the sequence is shown in SEQ ID NO.4,

a downstream primer KDMO-R: the sequence is shown as SEQ ID NO. 5;

carrying out PCR reaction by taking the extracted DNA as a template and Bar-F, Bar-R and DMO-F, DMO-R as primers, and then carrying out agarose gel electrophoresis detection analysis on an amplification product; 20 μ L of PCR detection reaction system containing 2 × taq Mix 10 μ L, 10mmol upstream and downstream primers 1 μ L, and template DNA 1 μ L, ddH₂O7 ul. The reaction condition is pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 40s, annealing at 59 ℃ for 40s, extension at 72 ℃ for 30s, and 35 cycles; finally, extension is carried out for 5min at 72 ℃.

(2) Test strip detection molecule detection

The transplanted seedlings were tested using Bar test paper from Envir logix, Inc. according to the instructions. If the test strip only displays the uppermost strip (control line), the test sample does not contain the detected Bar protein; if the test strip shows only the next strip (test line), indicating that the test failed, the test needs to be performed again; if the test strip 2 shows that the strips are all displayed, the Bar protein is contained in the sample to be tested, as shown in figure 5.

(3) Basta resistance identification

The Basta with the concentration of 200mg/L is dipped by a brush and smeared on the surfaces of half leaves of healthy transgenic soybeans and untransformed soybeans, and after 7d, the symptoms of the leaves are observed, if the leaves do not normally react any more, the plants have Basta herbicide resistance, otherwise, the plants do not have the Basta herbicide resistance, as shown in figure 6.

The positive results of PCR, test paper and Basta tests show that the gene is indeed inserted into the soybean genome. The detected T0 generation material is subjected to the next detection.

(III) homozygous transgenic Soybean Screen

(1) T1 generation transgenic plant identification

Seeds obtained by selfing T0 transgenic plants (W3-1) are respectively sown in plastic pots only containing vermiculite, 6 seeds are sown in each pot, when the first three compound leaves are completely unfolded, the leaves are selected to be smeared with Basta, meanwhile, PCR is carried out for identification, and the progeny separation result is 9: 4. the results show that: the character expressed by the exogenous gene accords with the separation ratio of a pair of dominant genes in the separation generation and accords with Mendelian inheritance law.

(2) T2 generation transgenic plant identification

And (3) selfing the identified positive plants T1, respectively, harvesting seeds of T2 generations, placing the harvested seeds in a greenhouse for germination according to the method, after the first three-leaf compound leaves are completely unfolded, detecting the positive plants by using three methods of PCR, Basta and test paper, recording, and performing subsequent experiments.

(3) And identifying the herbicide resistance of T2 and T3 transgenic soybeans.

Carrying out herbicide resistance identification on the T2 transgenic plants obtained by screening by using a pot culture method; and with receptor material W82 as control, performing the experiment in greenhouse of Nanjing agriculture university under artificial control with day and night temperature of 25/20 deg.C, relative humidity of 70-80%, photoperiod of 18/6h (light/dark), and light intensity of 600umol.m^-2s^-1(PPFD)CO₂The concentration is 400ppm, after the third compound leaf of the fifth leaf is completely unfolded, the concentration of herbicide spraying treatment on the identified plant is 560g/ha (the normal dose of the farmland is 280g/ha), after the herbicide is sprayed for 7d, the top growing tissue of the plant without herbicide resistance is bent downwards, commonly called 'low head', then the whole plant is dried up and dies, and the pesticide dose is 2 times of the normal dose, which indicates that the plant has obvious herbicide resistance. As shown in fig. 7.

(4) Photosensitivity identification of soybean with DMO gene

Transgenic soybean W3-1 and receptor material W82 were respectively sown in plastic pots containing vermiculite and nutrient soil (vermiculite: nutrient soil 1: 1), and experiments were carried out in Nanjing university of agriculture, Clematis, Nanjian, plant illumination incubator (RX3-500D type incubator) with illumination intensity of 10000LX, day and night temperature of 25/20 deg.C, relative humidity of 70-80%, and photoperiod of 18/6h (light/dark). After 15d, the first three compound leaves of the receptor material are found to be deformed and curled, and are needle-shaped, and the other leaves are deformed; the transgenic plant leaves are normal and have no malformation or curling phenomenon. But the whole plant shows the phenomena of spindly growth and seedling falling; indicating insufficient illumination intensity of the incubator. The above phenomena show that: when the DMO gene-transferred soybean is in a low light condition, the leaves are normally unfolded, and the plant grows normally. As shown in fig. 8.

(5) Expression level analysis of DMO gene in transgenic plant

The expression of the DMO gene of the T3 generation transgenic line is detected by adopting a fluorescence quantitative method, as shown in figure 9, the expression level of the DMO gene of the transgenic line is obviously improved after herbicide spraying, which indicates that the DMO gene is normally expressed in the transgenic line. The specific method comprises the following steps:

extracting total RNA of leaves of transgenic plants, negative plants and non-transgenic plants 12h after herbicide spraying, inverting the total RNA into cDNA, and designing a pair of specific primers according to the sequence of the DMO gene.

Forward primer RT DMO-F, SEQ ID NO.7

Reverse primer RT DMO-R, SEQ ID NO.8

The soybean eukaryotic elongation factor is used as an internal reference factor, and the amplification primers are as follows:

forward primer Actin-F, SEQ ID NO.11

Reverse primer Actin-R, SEQ ID NO.12

The fluorescent quantitative PCR reaction is carried out on a Bio-Rad fluorescent quantitative PCR instrument, and the reaction system refers to TaKaRa SYBR Premix Ex Taq^TMAnd (5) a reagent instruction. The fluorescent quantitative PCR reaction system (25uL) comprises: SYBY Premix Ex Taq (2X)12.5 uL; forward and reverse primers 0.5ul each, cDNA 50ng, ddH₂O9.5 ul. Fluorescent quantitative PCR reaction program: after pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 20s, 40 cycles, and fluorescence signals were collected after the end of each cycle. The soybean eukaryotic elongation factor is used as an internal reference gene, and the relative expression quantity of a target gene is expressed by a formula 2^-ΔCTTo calculate. Δ CT ═ CT_DMO—CT_ActinWherein CT_DMO: is the CT value of the DMO gene, CT_Actin: CT value of soybean eukaryotic elongation factor gene.

(6) Copy number analysis of T3 transgenic plants

And analyzing the copy number of the transgenic material by adopting a SYBR Green I real-time fluorescent quantitative PCR method. The results show that: the DMO gene was successfully integrated into the soybean genome in low copy form.

The method mainly comprises the steps of indirectly obtaining PCR amplification data through the intensity of a fluorescence signal in the PCR reaction process, making a standard curve according to the principle that a CT (cycle thresholds) value and an initial template logarithm value are in an inverse proportion linear relation, obtaining a correlation equation of the CT value and the initial template number, substituting the sample CT value into the equation to obtain the initial template number of a target gene, and obtaining the copy number of the exogenous gene in a genome through comparing the initial template number of a soybean endogenous reference gene.

However, this method is used, and since it is necessary to ensure that amplification data is valid, it is necessary to analyze an amplification curve and a dissolution curve. The ideal amplification curve is generally smooth, which indicates that the amplification is stable; while the ideal dissolution curve shows a single-peak type curve, if two or more peaks appear, it is indicated that non-specific amplification such as primer dimer occurs, in this experiment, it can be seen through the analysis of the dissolution curves (fig. 10, fig. 11) of Lectin and DMO genes that the gene dissolution curves are all single peaks, indicating that non-specific amplification does not occur during the amplification process, and the amplification is stable, therefore, it is determined that the data of quantitative PCR amplification is reliable, and can be used for the analysis of this experiment.

The specific method comprises the following steps:

extracting DNA of transgenic plants and non-transgenic plants, and plasmids containing target genes. Diluting the extracted non-transgenic plant DNA and plasmid by 10 times, carrying out fluorescence quantification by using the diluted DNA as a template to obtain respective CT values, and making respective standard curves (see figure 12) by utilizing the linear relation between the CT values and the initial template number, wherein the lectin gene standard curve is y-2.6974X +26.769, the DMO gene standard curve is y-3.5736X +16.319, and the formula X0/R0 is 10^{[(CT,X-IX)/SX]-[(CT,R-IR)/SR)]}The copy number of the plant (wherein IX, SX, IR, SR, respectively represent the intercept and the slope of the standard curve of the desired gene, and IR, SR, respectively represent the intercept and the slope of the standard curve of the lectin gene) was calculated, and the analysis results are shown in Table 1.

The fluorescent quantitative primer of the target gene:

Copy-F:GCACCATCGTCAACCACTAC(SEQ ID NO.13)

Copy-R:GTCGTCCGTCCACTCCTG(SEQ ID NO.14)

fluorescent quantitative primer for reference gene:

Lectin-F:CTGGTGATCAAGTCGTCGCT(SEQ ID NO.15)

Lectin-R；GTTGGCCAAATCCCAAGACG(SEQ ID NO.16)。

TABLE 1 plant copy number analysis results

The results show that: the DMO gene was successfully transferred into the soybean plant genome in low copy form.

According to the invention, by adopting a transgenic technology, an exogenous DMO gene is introduced into a soybean genome and is normally transcribed and expressed, so that the transgenic soybean expression resistance with herbicide resistance is obtained stably, the environment is not polluted, the blank of the prior art can be filled, a novel and practical method is provided for breeding soybean resistant varieties by using a genetic engineering technology, and the breeding process of the soybean biotechnology is effectively promoted.

Sequence listing

<110> Nanjing university of agriculture

Peking University

Institute of Crop Science, Chinese Academy of Agricultural Sciences

<120> a method for improving herbicide dicamba resistance and plant photosensitivity of soybeans by transferring DMO gene

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1020

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaccttcg tccgcaatgc ctggtatgtg gcggcgctgc ccgaggaact gtccgaaaag 60

ccgctcggcc ggacgattct cgacacaccg ctcgcgctct accgccagcc cgacggtgtg 120

gtcgcggcgc tgctcgacat ctgtccgcac cgcttcgcgc cgctgagcga cggcatcctc 180

gtcaacggcc atctccaatg cccctatcac gggctggaat tcgatggcgg cgggcagtgc 240

gtccataacc cgcacggcaa tggcgcccgc ccggcttcgc tcaacgtccg ctccttcccg 300

gtggtggagc gcgacgcgct gatctggatc tggcccggcg atccggcgct ggccgatcct 360

ggggcgatcc ccgacttcgg ctgccgcgtc gatcccgcct atcggaccgt cggcggctat 420

gggcatgtcg actgcaacta caagctgctg gtcgacaacc tgatggacct cggccacgcc 480

caatatgtcc atcgcgccaa cgcccagacc gacgccttcg accggctgga gcgcgaggtg 540

atcgtcggcg acggtgagat acaggcgctg atgaagattc ccggcggcac gccgagcgtg 600

ctgatggcca agttcctgcg cggcgccaat acccccgtcg acgcttggaa cgacatccgc 660

tggaacaagg tgagcgcgat gctcaacttc atcgcggtgg cgccggaagg caccccgaag 720

gagcagagca tccactcgcg cggtacccat atcctgaccc ccgagacgga ggcgagctgc 780

cattatttct tcggctcctc gcgcaatttc ggcatcgacg atccggagat ggacggcgtg 840

ctgcgcagct ggcaggctca ggcgctggtc aaggaggaca aggtcgtcgt cgaggcgatc 900

gagcgccgcc gcgcctatgt cgaggcgaat ggcatccgcc cggcgatgct gtcgtgcgac 960

gaagccgcag tccgtgtcag ccgcgagatc gagaagcttg agcagctcga agccgcctga 1020

<210> 2

<211> 1185

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggcctcta gtatgatatc atcacccgtc gtgacaatta ttaacagagt gggggtcagc 60

atggttgctc cttttaccgg ccttaaatcc atggcaggta tccctacccg taagaccaac 120

agtgacatca ccagcattgc aaccaacggc ggacgtgtgc aatgtatgac tttcgtgagg 180

aacgcatggt atgtggcagc tctccccgag gaactctcag aaaaaccatt gggaagaaca 240

atcctggata caccacttgc cttgtacaga cagcctgatg gggttgttgc tgcacttctt 300

gacatctgcc cccataggtt cgctcccctt agtgatggaa ttctggttaa cgggcatctt 360

cagtgcccat accatggact tgaatttgat ggcggtggac aatgcgtgca taatcctcat 420

ggtaatgggg caaggcctgc atctctcaat gtcagatcat ttccagttgt ggaacgcgac 480

gctctcatat ggatatggcc cggcgaccca gctctggctg acccaggagc aattcctgac 540

ttcggatgta gagttgatcc tgcttacaga actgttggag gttatggcca tgtggattgc 600

aattataagc ttcttgtgga taacctcatg gatttggggc atgcacagta cgtgcacaga 660

gcaaatgcac aaacagacgc ttttgacaga cttgagcgcg aggttatcgt cggcgatggg 720

gaaattcaag ctttgatgaa aatccctggc gggacaccaa gtgttcttat ggctaagttc 780

ctccgtggag caaatactcc tgtcgatgcc tggaatgata ttagatggaa caaggtgagc 840

gcaatgttga actttatcgc tgtggcccct gaaggtactc caaaggaaca aagcattcac 900

tccagaggca cacatatctt gacccctgag actgaagcaa gttgtcacta ctttttcggt 960

agcagtcgta atttcggtat cgacgatcct gaaatggatg gtgtgcttag atcttggcag 1020

gctcaggcac tcgttaaaga ggataaggtg gtcgtcgaag ctattgaaag aagaagagct 1080

tatgtggaag ctaatggtat taggcctgca atgttgtcat gtgatgaagc tgctgtcagg 1140

gtgagtaggg agattgagaa gctcgaacag ctcgaggctg catga 1185

<210> 3

<211> 1020

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgactttcg tgaggaacgc atggtatgtg gcagctctcc ccgaggaact ctcagaaaaa 60

ccattgggaa gaacaatcct ggatacacca cttgccttgt acagacagcc tgatggggtt 120

gttgctgcac ttcttgacat ctgcccccat aggttcgctc cccttagtga tggaattctg 180

gttaacgggc atcttcagtg cccataccat ggacttgaat ttgatggcgg tggacaatgc 240

gtgcataatc ctcatggtaa tggggcaagg cctgcatctc tcaatgtcag atcatttcca 300

gttgtggaac gcgacgctct catatggata tggcccggcg acccagctct ggctgaccca 360

ggagcaattc ctgacttcgg atgtagagtt gatcctgctt acagaactgt tggaggttat 420

ggccatgtgg attgcaatta taagcttctt gtggataacc tcatggattt ggggcatgca 480

cagtacgtgc acagagcaaa tgcacaaaca gacgcttttg acagacttga gcgcgaggtt 540

atcgtcggcg atggggaaat tcaagctttg atgaaaatcc ctggcgggac accaagtgtt 600

cttatggcta agttcctccg tggagcaaat actcctgtcg atgcctggaa tgatattaga 660

tggaacaagg tgagcgcaat gttgaacttt atcgctgtgg cccctgaagg tactccaaag 720

gaacaaagca ttcactccag aggcacacat atcttgaccc ctgagactga agcaagttgt 780

cactactttt tcggtagcag tcgtaatttc ggtatcgacg atcctgaaat ggatggtgtg 840

cttagatctt ggcaggctca ggcactcgtt aaagaggata aggtggtcgt cgaagctatt 900

gaaagaagaa gagcttatgt ggaagctaat ggtattaggc ctgcaatgtt gtcatgtgat 960

gaagctgctg tcagggtgag tagggagatt gagaagctcg aacagctcga ggctgcatga 1020

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tccctacccg taagacca 18

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgacgaccac cttatcct 18

<210> 6

<211> 394

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Ala Ser Ser Met Ile Ser Ser Pro Val Val Thr Ile Ile Asn Arg

1 5 10 15

Val Gly Val Ser Met Val Ala Pro Phe Thr Gly Leu Lys Ser Met Ala

20 25 30

Gly Ile Pro Thr Arg Lys Thr Asn Ser Asp Ile Thr Ser Ile Ala Thr

35 40 45

Asn Gly Gly Arg Val Gln Cys Met Thr Phe Val Arg Asn Ala Trp Tyr

50 55 60

Val Ala Ala Leu Pro Glu Glu Leu Ser Glu Lys Pro Leu Gly Arg Thr

65 70 75 80

Ile Leu Asp Thr Pro Leu Ala Leu Tyr Arg Gln Pro Asp Gly Val Val

85 90 95

Ala Ala Leu Leu Asp Ile Cys Pro His Arg Phe Ala Pro Leu Ser Asp

100 105 110

Gly Ile Leu Val Asn Gly His Leu Gln Cys Pro Tyr His Gly Leu Glu

115 120 125

Phe Asp Gly Gly Gly Gln Cys Val His Asn Pro His Gly Asn Gly Ala

130 135 140

Arg Pro Ala Ser Leu Asn Val Arg Ser Phe Pro Val Val Glu Arg Asp

145 150 155 160

Ala Leu Ile Trp Ile Trp Pro Gly Asp Pro Ala Leu Ala Asp Pro Gly

165 170 175

Ala Ile Pro Asp Phe Gly Cys Arg Val Asp Pro Ala Tyr Arg Thr Val

180 185 190

Gly Gly Tyr Gly His Val Asp Cys Asn Tyr Lys Leu Leu Val Asp Asn

195 200 205

Leu Met Asp Leu Gly His Ala Gln Tyr Val His Arg Ala Asn Ala Gln

210 215 220

Thr Asp Ala Phe Asp Arg Leu Glu Arg Glu Val Ile Val Gly Asp Gly

225 230 235 240

Glu Ile Gln Ala Leu Met Lys Ile Pro Gly Gly Thr Pro Ser Val Leu

245 250 255

Met Ala Lys Phe Leu Arg Gly Ala Asn Thr Pro Val Asp Ala Trp Asn

260 265 270

Asp Ile Arg Trp Asn Lys Val Ser Ala Met Leu Asn Phe Ile Ala Val

275 280 285

Ala Pro Glu Gly Thr Pro Lys Glu Gln Ser Ile His Ser Arg Gly Thr

290 295 300

His Ile Leu Thr Pro Glu Thr Glu Ala Ser Cys His Tyr Phe Phe Gly

305 310 315 320

Ser Ser Arg Asn Phe Gly Ile Asp Asp Pro Glu Met Asp Gly Val Leu

325 330 335

Arg Ser Trp Gln Ala Gln Ala Leu Val Lys Glu Asp Lys Val Val Val

340 345 350

Glu Ala Ile Glu Arg Arg Arg Ala Tyr Val Glu Ala Asn Gly Ile Arg

355 360 365

Pro Ala Met Leu Ser Cys Asp Glu Ala Ala Val Arg Val Ser Arg Glu

370 375 380

Ile Glu Lys Leu Glu Gln Leu Glu Ala Ala

385 390

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtgaggaacg catggtatgt 20

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

catcaggctg tctgtacaag g 21

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

acaagcacgg tcaacttcc 19

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

actcggccgt ccagtcgta 19

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggtggttcta tcttggcatc 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctttcgcttc aataacccta 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gcaccatcgt caaccactac 20

<210> 14

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtcgtccgtc cactcctg 18

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ctggtgatca agtcgtcgct 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gttggccaaa tcccaagacg 20

Claims (10)

1. A DNA molecule having a nucleotide sequence shown as SEQ ID No. 3.

2. A recombinant DNA molecule comprising a plant leader peptide sequence and the DNA molecule sequence of claim 1, wherein the nucleotide sequence of the recombinant DNA molecule is shown in SEQ ID No. 2.

3. A recombinant vector, expression cassette or genetically engineered bacterium comprising the DNA molecule of claim 1 or the recombinant DNA molecule of claim 2.

4. The recombinant vector according to claim 3, wherein: the recombinant vector is obtained by inserting the DNA molecule according to claim 1 or the recombinant DNA molecule according to claim 2 into a vector.

5. The genetically engineered bacterium of claim 3, wherein: the recombinant vector of claim 4 is transferred into engineering bacteria to obtain.

6. Use of the DNA molecule of claim 1, the recombinant DNA molecule of claim 2 or the recombinant vector, expression cassette or genetically engineered bacterium of any one of claims 3 to 5 for increasing herbicide dicamba resistance and plant photosensitivity in soybean or for breeding herbicide tolerant dicamba or glufosinate transgenic plants.

7. A method for breeding transgenic plants with herbicide dicamba or glufosinate, characterized in that the DNA molecule of claim 1 or the recombinant DNA molecule of claim 2 is introduced into the genome of the plants and screened to obtain transgenic plants with herbicide dicamba or glufosinate resistance.

8. The method of claim 7, wherein the screening comprises: detecting and screening the obtained T0 generation transgenic plants through herbicide and PCR; screening the homozygous transgenic plants, and screening out herbicide-resistant dicamba positive transgenic plants.

9. The method according to claim 8, wherein the specific primers for PCR detection are:

an upstream primer KDMO-F, the sequence of which is SEQ ID No.4,

the sequence of the downstream primer KDMO-R is SEQ ID No. 5.

10. A method for measuring the relative expression quantity of DMO genes of herbicide-tolerant dicamba or glufosinate-ammonium transgenic plants is characterized in that: designing a specific primer, and determining the expression amount of the DMO gene in herbicide-tolerant dicamba or glufosinate-ammonium transgenic plants by fluorescent quantitative PCR (polymerase chain reaction), wherein the specific primer:

the sequence of the upstream primer RT DMO-F is SEQ ID:7,

the sequence of the downstream primer RT DMO-R is SEQ ID: 8.

Images