CN109402173A

CN109402173A - A kind of method of heterogenous expression PEPR1 albumen

Info

Publication number: CN109402173A
Application number: CN201811280271.1A
Authority: CN
Inventors: 汤娇; 孙亚东; 韩志富; 柴继杰; 石巍
Original assignee: Institute of Apicultural Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Apicultural Research of Chinese Academy of Agricultural Sciences
Priority date: 2018-10-30
Filing date: 2018-10-30
Publication date: 2019-03-01

Abstract

The present invention provides a kind of method of heterogenous expression PEPR1 albumen.This method comprises: in pFastBac^TMHemolin signal peptide is added before 1 BamH1 restriction enzyme site and obtains pFastBac^TMHem carrier；With BamH1 and Sal1 digestion PEPR1 gene, using BamH1 and Xho1 digestion pFastBac^TMHem carrier connects after digestion, constructs heterogenous expression carrier；Heterogenous expression carrier transfection insect cell after cultivating the cell, harvests cell and supernatant, and supernatant obtains the correct PEPR1 albumen of conformation through chromatographing after purification, and expression quantity reaches 2.24mg/L.The present invention overcomes the disadvantages that the prior art can not be obtained the PEPR1 albumen of correct conformation or be used other eukaryotic expression systems PEPR1 expressing quantity low using prokaryotic expression system, improve the expression quantity of the correct PEPR1 albumen of conformation, have saved cost.

Description

A kind of method of heterogenous expression PEPR1 albumen

Technical field

The present invention relates to gene engineering technology fields, and in particular, to a kind of method of heterogenous expression PEPR1 albumen.

Background technique

PEPR1 is a full asphalt mixture Receptor-like protein ki-nase (leucine-rich in model plant arabidopsis Repeats receptor kinase, LRR-RK), LRR-RK family is divided into 16 subfamilies, is that a kind of research is the most deep Receptor protein kinase, composition include the extracellular identification structural domain of a full asphalt mixture class, single pass transmembrane area, intracellular kinase Structural domain.PEPR1 albumen belongs to the 6th family member of LRR-RK, has 27 LRR units, N-terminal and C-terminal in the extracellular region of PEPR1 Respectively there is a pair of of cysteine to form " cap " structure to stablize the hydrophobic core of extracellular region.

The identification of PEPR1 receptor protein kinase is a kind of endogenous polypeptide molecule secreted by plant itself, is called damage Hurt molecule associative mode, is secreted after stimulated when plant wound occurs or is damaged, born of the same parents can be activated after identification Interior kinase activity causes a series of immune responses such as active oxidative burst, the callose deposition of plant, helps plant resistant germ Invasion.It is external to obtain PEPR1 albumen, it can be used for screening novel small-molecule drug, filtering out can be immune anti-with activated plant The small-molecule drug answered, when germ invasion, plant can resist the infringement of germ, and development of new Anti-bacterium drug promotes to plant The disease-resistant phenotype of object and the yield for improving plant.

Current research contents, which is concentrated mainly on, probes into the extracellular identification structural domain of this kind of receptor protein of PEPR1 is how to know The mechanism being activated after not extracellular signal identifing source.Main means are to obtain fine the three of albumen by X-ray diffraction technology Structure is tieed up, illustrates the above problem on a molecular scale.Due to only one hydrophobic transmembrane region of PEPR1 albumen, this is in body Outer recombination full-length proteins are a very big obstructions.Since the hydrophobic transmembrane of albumen is by the firmly anchor of the albumen on cell membrane It is scheduled on the region on cell membrane, transmembrane region is more, and albumen is more stable on cell membrane, if the more memebrane protein of transmembrane region is in vitro Cell membrane can be simulated in regrouping process using chemical reagent such as detergents, and then successfully obtains the external success table of memebrane protein It reaches, but for the albumen of only one hydrophobic transmembrane, such as PEPR1 albumen, the full-length proteins with transmembrane region are in vitro It is extremely unstable during expression, therefore will lead to albumen and do not express the either formation incorrect albumen of conformation in vitro.Therefore The extremely disadvantageous stability in albumen on cell membrane in single hydrophobic transmembrane, the strategy that can be taken at present are only by PEPR1 egg White extracellular regions carry out amplification in vitro and are building up on expression vector appropriate, then obtain the extracellular structure of its Stable conformation The albumen in domain.

Protein macromolecule carries diversified physiological function in vivo, studies the structure and function of protein Understand physiological regulating control, organism metabolism for the mankind to be of great significance, but generally require to obtain in vitro with correct conformation and The recombinant protein of physiological function just can guarantee smooth development and the implementation success of a series of researchs.Prokaryotic expression system very great Cheng Improve the problems such as recombinant exogenous protein expression quantity is not high and downstream separation difficulty of processing is big to degree.Wherein expressing fusion protein The expression pattern of technology is: prokaryotic promoter → SD sequence → initiation codon → protokaryon structural gene segment → target gene sequence Column → terminator codon are more commonly used expression vectors, are particularly suitable for the expression of micromolecule polypeptide and albumen.However due to PEPR1 albumen is macromolecular eukaryon exocytosis albumen, often forms packet using prokaryotic expression system heterogenous expression PEPR1 albumen Contain body, the correct albumen of conformation cannot be obtained.The prior art produces PEPR1 albumen, but expression quantity using eukaryotic expression system It is not high, usually in 0.09mg/L.Such expression quantity is far from satisfying demand of the Follow-up Industry to PEPR1 albumen.Therefore, Being badly in need of one kind can be improved PEPR1 expressing quantity, low-cost method to make up the deficiencies in the prior art.

Summary of the invention

It is an object of the present invention to provide a kind of method of heterogenous expression PEPR1 albumen, this method can be improved PEPR1 The expression quantity of albumen, and the conformation of obtained PEPR1 albumen is correct, meets expection.

It is a further object to provide a kind of expression vectors of heterogenous expression PEPR1 albumen.

The main technical schemes that the present invention uses are as follows: in view of there is no include subregion, this hair for the extracellular code area PEPR1 The extracellular domain of the bright PEPR1 directly amplified from arabidopsis gene group.Structural domain point is carried out to PEPR1 gene order Analysis, using signal peptide prediction website (SignalP) and hydrophobic transmembrane predict website (TMHMM) predict PEPR1 it is hydrophobic across Film area and signal peptide region.This section of region before hydrophobic transmembrane is extracellular region.In view of PEPR1 albumen belongs to secretion Albumen, the N-terminal signal peptide of itself can lead synthetic peptide chain to carry out later period modification and processing in endomembrane system, and It leads outside the protein secretion to cell membrane processed, after the completion of the function of signal peptide, signal peptide can be cut away in the later period, at For mature secretory protein.By primarily determining that PEPR1 transmembrane region is 770-792aa after software prediction.Transmembrane region front end boundary Place can do several fragment lengths the amino acid of front and back 3-4 more, have error to cause egg to prevent predicted position and practical cutting position White false folding.Finally the determining extracellular section length of PEPR1 is 1-767aa, and amino acid sequence is as shown in SEQ ID NO.1.

The selection of restriction enzyme be built upon in objective gene sequence can not occur being selected be located at gene two The cleavage sequence of both restriction enzymes of side, otherwise in the digestion experimentation for carrying out the later period, the carrier of being connected into Gene order can be cut by restriction enzyme, to be unable to get successful recombinant plasmid.Based on mentioned above principle, this hair It is bright when screening restriction enzyme site, selected two couples of restriction enzyme BamH1 and Xho1, Bgl2 and Sal1.BamH1 and Bgl2 are mutual For isocaudarner, Xho1 and Sal1 isocaudarner each other.This two groups of isocaudarners carry out digestion to target gene, each in each group of isocaudarner Choose one, two-by-two collocation carry out using.Altogether there are four types of combination: BamH1 and Xho1, BamH1 and Sal1, Bgl2 and Xho1, Bgl2 and Sal1.Simultaneously present invention discover that there is no both restriction enzymes of BamH1 and Sal1 in PEPR1 gene Corresponding restriction enzyme site.Therefore this combination of selection BamH1 and Sal1 carries out digestion.The reasonable utilization of aforementioned four kinds of combinations can be with Evade in target gene to the maximum extent and restriction enzyme site sequence occur, the reduction later period eliminates the work of restriction enzyme site using point mutation It measures.

Foreign vector is carrier pFastBac^TMAfter Hem is handled using both restriction enzymes of BamH1 and Xho1 It is spare.And the restriction enzyme site at target gene both ends is just in BamH1&Xho1, BamH1&Sal1, Bgl2&Xho1, Bgl2&Sal1 this It is selected in four kinds of combinations, such target fragment could smoothly be connected into the carrier cut.It is not present in PEPR1 gene order The restriction enzyme site of both restriction enzymes of BamH1 and Sal1, therefore select digestion of the BamH1 and Sal1 as gene both ends Site, rather than " BamH1 and Xho1 ", " Bgl2 and Xho1 " or " Bgl2 and Sal1 ".When the later period using BamH1 and Sal1 this two When kind restriction enzyme cuts PEPR1, PEPR1 gene will not be cut off by both enzymes.Then according to codon Fault-tolerance principle base is subjected to point mutation, both eliminated the restriction enzyme site in this way, while also not will cause the prominent of amino acid Become.After having selected restriction enzyme site, at the end of (restriction enzyme site) 5 ' and 3 ' again respectively plus suitable protection base.The present invention The exon of PEPR1 gene is as shown in SEQ ID NO.2.

In terms of the building of foreign vector, inventor fully considers the selection principle and heterogenous expression carrier signal of restriction endonuclease The signal transfer functions of peptide, the suppression haemocyte that rod-shaped viral source is introduced by the screening of restriction enzyme site and in expression vector are poly- Collect the signal peptide of element Hemolin signal peptide replacement PEPR1 albumen itself.The signal peptide of PEPR1 albumen itself is its sequence N-terminal Preceding 28 amino acid.One section of rod-shaped disease is added in the front end connecting on the heterogenous expression carrier that the present invention constructs with target gene N-terminal The hemolin Hemolin signal peptide in malicious source.

Further, the foreign vector is carrier pFastBac^TMHem is in carrier pFastBac^TM1 BamH1 Hemolin signal peptide is added before restriction enzyme site to obtain, the nucleotide sequence of the Hemolin signal peptide such as SEQ ID NO.3 institute Show.

Important function of the signal peptide in protein expression process, usually by this kind of vegetable protein of PEPR1 in insect Heterogenous expression is carried out in cell.Whether still may be used due to that can not learn that the signal peptide of vegetable protein itself is transferred in insect cell It, will be rod-shaped in insect cell expression system normally to exercise itself function, therefore in a preferred embodiment of the invention Virus expression carrier pFastBac-^TM1 is transformed, and the carrier being newly transformed is pFastBac^TM-Hem.Exist pFastBac-^TMThe suppression haemocyte in one section of baculoviral source is added on the front end portion connecting on 1 carrier with target gene N-terminal Acrasin (Hemolinpeptide) signal peptide.Present inventors have unexpectedly found that using Hem signal peptide than the N-terminal using PEPR1 itself Signal peptide effect is more preferable, can be identified by insect system, shear and guide the sequence for passing through endoplasmic reticulum as secretion signal Peptide.The present invention adds the His label convenient for purifying in the C-terminal of target gene simultaneously, adds 6 using on 3 ' -5 ' end primers A Mstidine codon sequence and termination codon subsequence read reading frame downwards always until to His label has been read Then codon has read terminator codon.Translation terminates.

Select pFastBac^TMThe carrier that this present invention of-Hem is newly transformed needs the purpose that will be connected into as expression vector The target fragment that native signal peptide before genetic fragment (PEPR1 exon genes) removes, therefore is connected into is PEPR1-29-767, Eliminate 28 amino acid of N-terminal.PEPR1 albumen of the invention is to select pFastBac^TM- Hem carrier adds PEPR1-29- 767 genetic fragments can obtain correct PEPR1 extracellular region protein (the amino acid sequence such as SEQ ID NO.1 institute for folding expression Show), and improve the expression quantity of PEPR1.

It is dissected based on overall technology design of the invention with technological invention point, the present invention provides a kind of heterogenous expressions The method of PEPR1 albumen, comprising steps of

(1) carrier of the hemolin Hemolin signal peptide containing baculoviral source is constructed；

(2) clone obtains PEPR1 exon genes, PEPR1 exon genes is connected on the carrier of step (1), is obtained Heterogenous expression carrier；

(3) heterogenous expression carrier transfection insect cell obtains recombinant baculovirus, and virus infection insect cell, culture should After insect cell, cell and supernatant are harvested, supernatant obtains the correct PEPR1 albumen of conformation through chromatographing after purification.

In the above method, the construction method of step (1) described carrier is in pFastBac^TMAdd before 1 BamH1 restriction enzyme site Enter Hemolin signal peptide and obtains pFastBac^TMHem carrier；The nucleotide sequence of the Hemolin signal peptide such as SEQ ID Shown in NO.3.

The amino acid sequence of PEPR1 albumen described in the above method of the present invention is as shown in SEQ ID NO.1.

The nucleotide sequence of PEPR1 exon genes described in the above method of the present invention is as shown in SEQ ID NO.2.

In heterogenous expression PEPR1 protein process provided by the invention, the PEPR1 exon genes of step (2) are connected into carrier It is preceding to use BamH1 and Sal1 digestion PEPR1 exon genes.

Further, in step (2), obtained carrier is constructed using BamH1 and Xho1 digestion step (1), after digestion with The connection of PEPR1 exon genes, constructs heterogenous expression carrier.

In heterogenous expression PEPR1 protein process provided by the invention, another committed step is using Expression After System ESF AF culture medium expands culture insect cell, then it is rod-shaped with the recombination obtained after step (3) transfection insect cell The aforementioned insect cell for expanding culture of virus infection, can obtain the correct PEPR1 albumen of further amounts of conformation in this way.

The present invention is equally grasped respectively using SF900II culture medium and Expression System ESF AF culture medium After the insect cell of work expands culture, the insect cell (Hi5 cell or SF21 cell line) of same number grade, Expression The correct PEPR1 albumen of conformation significantly improves in the experimental group of System ESF AF culture medium, and eliminating is due to Hi5 cell Total quantitative change is more and PEPR1 albumen is caused to become more possibility.

In a preferred embodiment of the invention, in the step of the method for the present invention (3), using the Divine Land Yi Qiao company It is 0.3 × 10 that insect cell is diluted to cell concentration by Expression System ESF AF culture medium⁶-1×10⁶A/mL, It is incubated overnight, when growing into 1.6 × 10⁶-2.0×10⁶When a/mL, the rod-shaped disease of the recombination containing PEPR1 of volume ratio 1:50 is added Poison collects cell culture supernatant after culture.

The present invention provides the PEPR1 albumen that the above method is prepared.

On the other hand, the present invention provides a kind of heterogenous expression carriers for expressing PEPR1 albumen, on the carrier with purpose base Because the hemolin Hemolin signal peptide in one section of baculoviral source is added in the front end of N-terminal connection.

Preferably, above-mentioned heterogenous expression carrier is carrier pFastBac^TMHem is in carrier pFastBac^TM1 BamH1 Hemolin signal peptide is added before restriction enzyme site to obtain, the nucleotide sequence of the Hemolin signal peptide such as SEQ ID NO.3 institute Show.

Further, the present invention provides the obtained PEPR1 of method, this method of above-mentioned heterogenous expression PEPR1 albumen Albumen, above-mentioned heterogenous expression carrier are being screened the small-molecule drug that can be immunoreacted with activated plant, development plants antimicrobial medicine, mentioned Application in high plant disease-resistant phenotype or raising plant products.

Based on the above-mentioned technical proposal, the present invention achieve it is following the utility model has the advantages that

(1) the method for the present invention solves can not correctly be expressed always using escherichia coli prokaryotic expression system for a long time The technical problem of PEPR1 albumen.Since PEPR1 albumen belongs to the vegetable protein of secretion class, during protein folding, secretion Need intramolecular disulfide bond be properly formed and late protein surface it is glycosylation modified, but in prokaryotic expression system Lack this glycosylation modified process and is easy to cause the mispairing of disulfide bond.The method of the present invention uses Hi5 and SF21 thin for the first time Born of the same parents system carries out in-vitro recombination expression to the full asphalt mixture receptoroid albumen PEPR1 in plant Arabidopsis thaliana.

(2) isocaudarner combination of two is used in plasmid construction link, discovery does not have BamH1 and Sal1 in PEPR1 gene The corresponding restriction enzyme site of both restriction enzymes, therefore this combination of BamH1 and Sal1 is selected to carry out digestion.In restricted Enzyme cutting reasonable utilization, which can be evaded to the maximum extent in target gene, there is restriction enzyme site sequence, reduce the later period using point mutation come The workload for eliminating restriction enzyme site greatly improves the utilization rate and building efficiency of carrier.

(3) process formed due to different destination protein external source is multifarious, the method for heterogenous expression also each not phase Together, expression vector used, signal peptide, culture medium, cultivation temperature can influence the expression quantity of albumen, and the present invention is carried by transformation Body, selection are suitable for the signal peptide of cell secreting, expressing, obtain the carrier for being more suitable for PEPR1 protein expression pFastBac^TMHem is facilitated outer by selecting suitable kinds of culture medium Expression System ESF AF culture medium The successful secretion of source protein and expression improve the yield for obtaining correct recombinant protein.

(4) present invention can be in gel permeation chromatography using irreducibility (no DTT) detection in a small amount of detection of expression stages The proportionate relationship between the protein molecular and aggregation of correct conformation is just analyzed before, greatly saves cost and time.

Detailed description of the invention

Fig. 1 is the process schematic of Bac-to-Bac baculovirus expression system of the present invention.

Fig. 2 is the pcr amplification product gel electrophoresis figure of PEPR1 gene, is gone out using primer amplification shown in SEQ ID NO.4-5 PEPR1 gene size be about 2217bp, show genetic fragment between 2000-3000bp in figure.

Fig. 3 is pFastBac^TM1 baculovirus vector map and multiple cloning sites diagram.

Fig. 4 A is pFastBac^TMHem baculovirus vector map, pFastBac^TMHem baculovirus vector is in carrier pFastBac^TMHemolin signal peptide is added before 1 BamH1 restriction enzyme site to obtain, the nucleotides sequence of the Hemolin signal peptide Column are as shown in SEQ ID NO.3；Fig. 4 B is pFastBac^TMThe multiple cloning sites of Hem, restriction enzyme site represent as shown in the figure Actual cleavage site, underscore mark potential terminator codon.The signal peptide of building is translated since ATG, is translated The signal peptide of Hemolin is directly merged with the target gene N-terminal of heterogenous expression.

Fig. 5 is the PEPR1 purification knot that Hi5 cell is expressed under Expression System ESF AF culture medium culture Fruit figure, A figure are to purify PEPR1 albumen using gel permeation chromatography method, and the gel chromatography of PEPR1 albumen is as a result, transverse and longitudinal coordinate Elution volume and ultraviolet absorption value (λ=280) are respectively represented, PEPR1 is correct, and elution site is as shown by arrows.B figure is that figure A is corresponding The sample collected at elution site carries out SDS-PAGE and coomassie brilliant blue staining detection.

Fig. 6 is the expression of PEPR1 albumen under different culture medium (SF900 II).A figure is to utilize gel permeation chromatography side Method purifies PEPR1 albumen, and the gel chromatography of PEPR1 albumen is as a result, transverse and longitudinal coordinate respectively represents elution volume and ultraviolet absorption value (λ=280), PEPR1 is correct, and elution site is as shown by arrows.B figure is to scheme A to correspond to the sample progress SDS- collected at elution site PAGE and coomassie brilliant blue staining detection.Compared with Fig. 5, at the correct elution site of PEPR1 albumen UV absorption value be substantially reduced for The 0.75% of Expression System ESF AF culture medium.

Fig. 7 is a small amount of detection of expression of PEPR1 (+DTT and-DTT are compared).A small amount of detections of the PEPR1 of Hi5 cell expression are real Test figure.Eluent carries out SDS-PAGE to cell culture fluid after ni-sepharose purification and coomassie brilliant blue staining, two swimming lanes are respectively Reproducibility (+DTT) and irreducibility (- DTT) testing result to PEPR1 albumen.

Fig. 8 is the western blot testing result of PEPR1 albumen.

Specific embodiment

Following embodiment should not be construed as limiting the invention for further illustrating the contents of the present invention.Not In the case where spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, this is belonged to The range of invention.

If without specializing, the conventional means that technological means used in embodiment is well known to those skilled in the art.

The acquisition of 1 PEPR1 gene extron of embodiment

In view of the extracellular code area PEPR1 is there is no subregion is included, the present invention is directly expanded from arabidopsis gene group The extracellular domain of PEPR1 out.The PCR enzyme of high-fidelity is selected in PCR amplification experiment, prominent to prevent base occurs in amplification procedure Become, the primer sequence is as follows.

PEPR1_29_BamHI_5:CGCGGATCCTTAAACTCAGATGGGCTAAC

(SEQ ID NO.4)

PEPR1_767_6His_SalI_3T:AGGAAGAGTGGCCTTAGCACCCA TCATCATCATCATCATTAAGTCGACGTC(SEQ ID NO.5)

Pcr amplification reaction system: 5 μ L 10 × pfu buffers, 2.5 μ L dNTP (2.5mM), 0.1 μM of upstream and downstream primer Each 1 μ L of 0.5 μ L, pfu polymerase, 0.5 μ L of template add distilled water to 50 μ L.Pcr amplification reaction condition is 95 DEG C, 5min；Totally 30 A circulation: 94 DEG C of 30s, 53 DEG C of 30s, extension of time needed for 72 DEG C of 600bp/min are calculated；72℃10min.The PCR of PEPR1 gene Amplified production gel electrophoresis figure is shown in Fig. 2.Recycling pcr amplification product is operated according to kit specification.

Structure domain analysis is carried out to PEPR1 gene order, using signal peptide prediction website (SignalP) and hydrophobic transmembrane Prediction website (TMHMM) predicts the hydrophobic transmembrane and signal peptide region of PEPR1.This section of region before hydrophobic transmembrane As extracellular region.In view of PEPR1 albumen belongs to secretory protein, the N-terminal signal peptide of itself can lead synthetic peptide chain Later period modification and processing are carried out in endomembrane system, and is led outside the protein secretion to cell membrane processed, when signal peptide After the completion of function, signal peptide can be cut away in the later period, become mature secretory protein.By being primarily determined after software prediction PEPR1 transmembrane region is 770-792aa.Transmembrane region front end boundary can do several fragment lengths the amino acid of front and back 3-4 more, with Anti- predicted position and practical cutting position have error to cause protein misfolding.Finally the determining extracellular section length of PEPR1 is 1- 767aa, amino acid sequence is as shown in SEQ ID NO.1, and nucleotide sequence is as shown in SEQ ID NO.2.

2 heterogenous expression carrier pFastBac of embodiment^TMThe building of Hem

Signal peptide plays a significant role in protein expression process, by this kind of vegetable protein of PEPR1 in insect cell During middle carry out heterogenous expression, due to that can not learn whether still the signal peptide of vegetable protein itself is transferred in insect cell The function of itself can normally be exercised, therefore the present embodiment is by the rhabdovirus expression vector in insect cell expression system pFastBac^TM1 (Fig. 3) is transformed, and the carrier being newly transformed is pFastBac^TM- Hem (Fig. 4 A and Fig. 4 B).Exist pFastBac^TMThe suppression haemocyte that one section of baculoviral source is added on the front end portion connecting on 1 carrier with target gene N-terminal is poly- Collect plain (Hemolinpeptide) signal peptide, nucleotide sequence is as shown in SEQ ID NO.3.

Present inventors have unexpectedly found that it is more preferable than using the N-terminal signal peptide effect of PEPR1 itself using Hem signal peptide, it can be with By the identification of insect system, shears and guide the sequence for passing through endoplasmic reticulum as secreting signal peptide.The present invention is in purpose base simultaneously The His label that the C-terminal of cause adds convenient for purifying adds 6 Mstidine codon sequences and end using on 3 ' -5 ' end primers Only Codon sequences read reading frame downwards until to the codon for having read His label always, it is close then to have read termination Numeral.Translation terminates.

Select pFastBac^TMAs expression vector, the later period connect the carrier that this present invention of Hem is newly transformed with target gene When, purpose that the native signal peptide before the target gene fragment (PEPR1 exon genes) for needing to be connected into removes, therefore is connected into Segment is PEPR1-29-767, eliminates 28 amino acid of N-terminal.

3 PEPR1 gene extron of embodiment and heterogenous expression carrier pFastBac^TMThe system of Hem connection and recombination bacmid It is standby

The selection of restriction enzyme be built upon in objective gene sequence can not occur being selected be located at gene two The cleavage sequence of both restriction enzymes of side, otherwise in the digestion experimentation for carrying out the later period, the carrier of being connected into Gene order can be cut by restriction enzyme, to be unable to get successful recombinant plasmid.Based on mentioned above principle, this reality Example is applied when screening restriction enzyme site, has selected two couples of restriction enzyme BamH1 and Xho1, Bgl2 and Sal1.BamH1 and Bgl2 Isocaudarner each other, Xho1 and Sal1 isocaudarner each other.

This two groups of isocaudarners carry out digestion to the target gene that embodiment 1 obtains, and respectively choose one in each group of isocaudarner, Two-by-two collocation carry out using.Altogether there are four types of combination: BamH1 and Xho1, BamH1 and Sal1, Bgl2 and Xho1, Bgl2 and Sal1。

Present invention discover that not having BamH1 and Sal1 in the PEPR1 gene that embodiment 1 obtains, both are restricted interior simultaneously The corresponding restriction enzyme site of enzyme cutting.Therefore this combination of selection BamH1 and Sal1 carries out digestion.The reasonable utilization of aforementioned four kinds of combinations It can evade to the maximum extent in target gene and restriction enzyme site sequence occur, reduce the later period and restriction enzyme site is eliminated using point mutation Workload.

Foreign vector is that obtained carrier pFastBac is transformed in embodiment 2^TMHem is using both limitations of BamH1 and Xho1 Property restriction endonuclease is spare after being handled.And the restriction enzyme site at target gene both ends selects BamH1 and Sal1, such target fragment is The carrier cut can be smoothly connected into.Later period cuts PEPR1 using both restriction enzymes of BamH1 and Sal1 When, PEPR1 gene will not be cut off by both enzymes.Then base is carried out by point mutation according to the fault-tolerance principle of codon, The restriction enzyme site had both been eliminated in this way, while also not will cause the mutation of amino acid.After having selected restriction enzyme site, in (digestion position Point) 5 ' and 3 ' end again respectively plus suitably protect base.After selecting above-mentioned restriction enzyme site, to foreign vector and The enzymatic cleavage methods of PEPR1 gene are all made of this field routine techniques, obtain PEPR1 gene and carrier pFastBac^TMThe connection of Hem Product.

PEPR1 albumen of the invention is to select pFastBac^TMHem carrier adds PEPR1-29-767 genetic fragment, can The correct PEPR1 extracellular region protein for folding expression is obtained, and improves the expression quantity of PEPR1, expression quantity reaches 2.24mg/L.

The competent cell BL21 (DE3) or DH5 α for preparing or buying are taken out from -80 DEG C of refrigerators, will prepare conversion Connection product is added in 100ul or 25ul competent cell (depending on the concentration of competent cell and efficiency), on ice It places 15 minutes, then warm bath 90 seconds in 42 DEG C of water-baths, immediately takes out and be put in 5 minutes on ice, 600 μ l LB liquid are added Culture medium, draws culture solution and is evenly coated in the LB with ammonia benzyl antibiotic at 37 DEG C of 180 revs/min of oscillations recovery 1 hours of culture On plate, 37 DEG C of incubators are incubated overnight.The a certain number of monoclonal colonies of picking are managed in the EP equipped with 1ml corresponding resistant culture medium In, 37 DEG C of 220 revs/min of oscillations recovery 10-12 hours of culture take 1ul bacterium solution to do template and carry out PCR identification, or extract Plasmid carries out digestion identification, is identified as positive monoclonal and sequencing company is sent to be sequenced, and correctly clone is sequenced, saves plasmid It is stand-by in -20 DEG C of refrigerators.

The upper correct plasmid of pacing sequence is transformed into competent cell DH10Bac, to when recovery culture, is recombinated for guarantee Sufficiently, 5-6 hour of recovery is needed, takes 30ul culture medium later, is evenly coated in three kinds of antibiotic with the glass bar after sterilizing On (kanamycins, gentamicin, tetracycline) plate, it is put in 37 DEG C of incubators and is protected from light 40-48 hour of culture.It is 40-48 small The spot of blue or white can be clearly seen in Shi Hou, in picking white dot Yu Sankang culture medium, after 37 DEG C of cultures, take 1ul Bacterium solution does template, carries out PCR identification, primer (SEQ ID NO.4 or 5) of the primer one end from gene magnification, other end is The upper intrinsic M13 aligning primer of Bacmid, the correct positive colony of clip size are the bacmid of recombination.After identification is positive, root Viral cosmid Bacmid is extracted according to kit specification, takes 1-2 μ l recombination bacmid to carry out agarose gel electrophoresis after extraction, really Whether the content for recognizing the recombination bacmid of extraction is enough, and recombinant baculovirus clay is put in 4 DEG C and saves backup.

The expression of 4 PEPR1 albumen of embodiment

1, viral coating

Followed by the production of virus, viral production is made of insect cell, therefore is ready to first Positioned at the insect cell of suitable growth phase and suitable concentration.It uses two kinds of insect cells altogether in this experiment, is SF21 respectively With Hi5 insect cell (being shown in Table 1).

1 cell strain list of table

SF21 cell can be used for the production and culture expression of virus；Hi5 insect cell is served only for culture expression.Insect is thin Born of the same parents use suspension training method, are logarithmic growth.The manufacturing process of virus is called transfection, and all operations are ultra-clean in iuntercellular It is carried out in platform, the specific steps are as follows:

(1) it prepares solution A: taking a new 1.5mL sterile centrifugation tube, bar made from 5-7 μ l embodiment 3 is added in pipe Shape viral cosmid (PEPR1 recombinates Bacmid) adds the SF900II training of the 100 non-added with antibiotic of μ l (streptomysin and penicillin) Base (being purchased from GIBCO company, the present embodiment cell culture medium all refers to SF900II culture medium) is supported, gently pressure-vaccum mixes.

(2) it prepares solution B: taking a new 1.5mL sterile centrifugation tube, 5-7 μ l transfection reagent is added in pipe (cellfectin is purchased from Invitrogen), adds the SF900II culture medium of the 100 non-added with antibiotic of μ l, gently pressure-vaccum is mixed It is even.If the number for transfecting Bacmid is more, a Mix solution for standby can be configured.Mix solution composition include transfection reagent and The SF900II culture medium of nonreactive, the Mix solution of solution B proportionally amplify each ingredient of solution B；Such as in single experiment Experimenter needs to do the transfection of 5 kinds of different baculoviral clays in operation, can prepare the Mix solution of 5 doses solution Bs, mesh Be guarantee that every part of solution A with baculoviral clay can mix with identical solution B is completed, reduction manual operation Error.

(3) solution B is added in solution A, gently pressure-vaccum mixes, and is named as solution C.Solution C is put into 28 DEG C of incubators Stand 30 minutes.

(4) the Sf21 cell in good condition in logarithmic growth phase, cell concentration 1.5~2.5 × 10 are chosen⁶A cell/ Milliliter is laid on cell 6 orifice plates, and each hole total number of cells control is 1~1.5 × 10⁶It is a, and finally by the culture medium in cell hole Volume polishing to 2mL volume, the light rolling culture plate in front and back or left and right is uniformly distributed in cell in hole.Culture plate is put into 28 DEG C incubator stands 10 minutes or so, keeps cell sufficiently adherent.

(5) after cell is completely adherent, original culture medium is sucked, 1-1.5mL nonreactive culture medium is added in each hole, gently Shake six orifice plates, abundant rinse cell.The purpose of this step is the antibiotic removed in original culture medium, because antibiotic can shadow Ring transfection efficiency.The rinse culture medium in six orifice plates is sucked, it is stand-by to add 1mL nonreactive culture medium.

(6) solution C is gently added in the cell of six orifice plates after pressure-vaccum mixes, light six orifice plates that shake make its uniform fold.

(7) six orifice plates are placed in 28 DEG C of incubators, stand 5 hours.

(8) liquid is changed.Culture medium containing transfection reagent and clay is siphoned away, each hole be added 2-3mL contain penicillin and The SF900II culture medium of streptomycin resistance.Continue stationary culture 3-4 days in 28 DEG C of incubators.

(9) observation transfection phenomenon, and first generation virus is collected, culture solution is drawn in 15mL centrifuge tube, 2000 revs/min of centrifugations 5 minutes, supernatant was to recombinate PEPR1 baculoviral, is named as P1, is kept in dark place in 4 DEG C.It is whether bright for observation transfection phenomenon It is aobvious, control group experiment can be done, is conducive to compare.The too long meeting cell cracking of incubation time after virus transfection, content release influence Virus State, the time of stationary culture was preferably not more than 5 days.P1 virus, amount is less and titre is low, is not used to great expression mesh Albumen, it is therefore desirable to expand P2 (second generation) and P3 (second generation) virus.Under normal conditions, only the third generation is arrived in amplification to virus, Because the ability for continuing the expressing viral foreign protein of amplification can be declined.P2 virus detects in a small amount for destination protein, really After fixed expression, amplification P3 virus evaluates albumen behavior etc. for the large-scale purification of destination protein.

The process schematic for the Bac-to-Bac baculovirus expression system that the present invention uses is shown in Fig. 1.

2, the expression of albumen

The expression of a small amount of testing goal albumen of 2.1 insect cells

Before mass propgation purifying protein, first need whether to express and protein expression using detecting albumen in a small amount Amount number；General to carry out protein expression test with P2 or P3 virus, the cell of test is the culture that suspends, the type Sf21 of cell With Hi5 cell it can be selected that Hi5 cell is more suitable for the expression of secretory protein.The method and experiment condition of test it is following (by In this research last comparison result be Hi5 cell expression effect it is more preferable, therefore here by taking the expression of Hi5 cell as an example):

(1) cell density: Hi5 cell is more stringent for density requirements, preferably in 1.6-2.0 × 10⁶Between a/mL. Ensure that cell state is good and is in logarithmic growth phase.

(2) after cell grows to suitable density, each glass culture bottle dispenses 25-30mL cell, adds in every bottle of cell Enter P2 or P3 virus.If not surveying virus titer, the virus quantity being added need to do gradient test, different albumen or difference The viral situation of batch may be different.Starting can be according to virus: cell volume is 1:50 addition.

(3) temperature and incubation time cultivated: Hi5 cell is cultivated before virus does not infect in 28 DEG C of suspensions, and 120 revs/min； It will be placed on 22 DEG C of suspensions in cell after infecting after virus infection is added to cultivate, 120 revs/min；Time of infection 48 hours.48 is small When after use 4000 revs/min, be centrifuged 10 minutes separation supernatant cells.It if expressing secretory protein, is secreted into culture medium , then cell precipitation is abandoned after being centrifuged, takes supernatant；It is anti-then take precipitating.Secreting, expressing albumen, supernatant directly pour into 200 μ l affinity columns beads；The wash buffer of 2 2ml is added, finally affinity column is flowed through with 300ul elution buffer, flows through Elution buffer is retained, in addition loading buffer loading, is detected with SDS-PAGE.

Secretory protein this for PEPR1 can use a small strategy in SDS-PAGE detection, can be quickly and easily What kind of the truly expressed amount for understanding the secretory protein of correct conformation is.The albumen used in conventional SDS-PAGE experiment It is, in order to open the disulfide bond in protein, to be easier experimenter containing DTT in sample loading buffer component Observe the molecular size range of protein sample.But for secretory protein this for PEPR1, during heterogenous expression often It, can be real without using gel permeation chromatography using the loading buffer without containing DTT with the appearance of protein masses The PEPR1 albumen that external source acquisition can be offered an explanation before testing is the protein masses of the correct albumen of conformation or abnormal conformation. Remove DTT (dithiothreitol dithio) in the formula of the loading buffer used when loading, due to the work of dithiothreitol dithio With being to open the disulfide bond that is formed in protein.Albuminoid is secreted there is many disulfide bond, and disulfide bond is easy to happen mistake and matches Change to form aggregation to so as to cause protein conformation, detecting albumen by SDS-PAGE again after DTT is added can be wrong by one The albumen that a little disulfide bond mispairing are formed is considered as the albumen of correct conformation, therefore removes molecular weight on the SDS-PAGE after DTT The depth of protein band is only the expression quantity of correct conformational protein on the correct position of size, passes through the ratio of right+DTT and-DTT It is right, it will be appreciated that correct ratio of the conformational protein in Tot Prot.The present embodiment adds DTT by comparing and DDT is not added to carry out The method of SDS-PAGE result qualitatively judges which band is the correct PEPR1 albumen of conformation in PAGE glue, then root The expression quantity of the PEPR1 albumen of correct conformation is probably measured according to the width and depth difference of the band, because elute Albumen can include the correct PEPR1 albumen of conformation, the aggregation of abnormal conformation and some foreign proteins, have many bands on glue, First wanting which qualitative band is the correct albumen of conformation, is then probably quantified further according to width and the depth, practical expression quantity Numerical value needs to refer to the depth and width of the protein band of-DTT.See Fig. 7

Pass through the molecular weight of albumen in the elution site and SDS-PAGE result of albumen in gel permeation chromatography experimental result Size judges that the conformation of expressed albumen is correctly that, such as Fig. 5, PEPR1 elution site has been indicated in gel chromatography result, out Between 62-69ml, the upper molecular weight of albumen of SDS-PAGE is 114kDa for peak position, is consistent with the actual molecular weight of PEPR1.Due to PEPR1 albumen carries out hybrid experiment with His label, using the antibody of His label, 114kDa position detection to egg White, illustrating that the present invention obtains albumen is the PEPR1 albumen with His label.See Fig. 8.

The cell line that whether determining albumen is expressed and optimized according to testing result is (in SF21 cell and Hi5 cell two Selection expression quantity is more in kind cell line, the less Hi5 cell line of foreign protein.Hi5 cell line is compared to SF21 cell line, Hi5 cell line is more suitable for the expression for secreted protein when expressing foreign protein, and foreign protein amount is less, the correct egg of conformation White expression quantity is higher, and Hi5 cell line is selected to be used to express PEPR1 albumen directly in the two in the present embodiment.

The mass propgation of 2.2 albumen and purifying

According to the optimization situation that a small amount of testing goal albumen are last, expression system is expanded to 500~600mL, for detecting The albumen behavior of destination protein and protein content, finally expansion culture to 2~3L carries out mass propgation again, to obtain the egg of sufficient amount It is white for used in later experiments.Used culture medium is the SF900 II of GIBCO company without blood when mass propgation and when a small amount of detections Clear culture medium (1 ×) 1000ml, is first added 5ml penicillin streptomycin mixed liquor (GIBCO company) when using, to prevent from making Cell contamination is caused when being passed on culture medium.When cultivating cell, discovery can not add fetal calf serum into cell culture medium (FBS), the normal growth and heterogenous expression function of insect cell be will not influence.

The novel Insect cellculture method of one kind is provided in the present invention can significantly improve the PEPR1 egg of correct conformation White expression quantity.The specific method is as follows: the concentration that infects of Hi5 cell is 1.6-2.0 × 10⁶Between a/mL, in virus infection It noon before that day to this period at night, is cultivated using the Expression System ESF AF of the Divine Land Yi Qiao company purchase Base replaces II cell culture medium of SF900, and by Hi5 cell, (concentration is probably in 2.5-3.2 × 10⁶A/mL) it expands culture, it is dilute It releases to cell concentration probably 0.3 × 10⁶A/mL, is incubated overnight；It counts within second day to work as and grows into 1.6-2.0 × 10⁶A/mL When, it is infected.Incubation time, cultivation temperature and revolving speed are with above Hi5 cell in II cell culture of SF900 in subsequent step Incubation step in base is completely the same.Using the expressing quantity obtained after above method culture cell and use GIBCO company II serum free medium of SF900 can refer to Fig. 5 and Fig. 6 to cultivate the expressing quantity difference obtained after cell.With Fig. 5 phase Than UV absorption value is substantially reduced as Expression System ESF AF culture at the correct elution site of PEPR1 albumen in Fig. 6 The 0.75% of base.After illustrating that carrying out insect cell using Expression System ESF AF culture medium expands culture, then turn Enter the heterogenous expression carrier containing PEPR1, the expression quantity of the PEPR1 albumen of correct conformation can be significantly improved.

Since albumen PEPR1 is the albumen of secreting, expressing in this research.In the C-terminal of target gene, 6 × His is added to purify Label, therefore purify destination protein with Ni-NTA His label binding medium.The extraction process of secretory protein is following, and (extraction process exists 4 DEG C of cold houses carry out):

(1) 4000 revs/min of large capacity centrifuge are used, after being centrifuged 10 minutes harvest supernatants, supernatant is added to the Ni- regenerated In NTA affinity column, supernatant is made to slow transit through affinity media by gravity.To guarantee joint efficiency, every 100mL culture medium is used 1 Ni-NTA affinity column, and twice of loading.Every 2~3mL of Ni-NTA affinity column column material.

(2) contain the Ni-NTA wash buffer rinse affinity media of 15mM imidazoles with 10mL.

(3) step (2) are repeated twice, washes away foreign protein as much as possible.

(4) with the albumen combined on the Ni-NTA elution buffer elution media of 5mL twice.Protein eluate gives over into one Step is purified and is sampled, and is labeled as Elution (E).

The destination protein being then further purified using the method for gel permeation chromatography, using the ACTA of GE company The automatic loading elution system of Purifer, the loading volume that loading loop is carried in system is 2ml, it is necessary first to protein concentration pipe Elution is concentrated within loading volume 2ml.(10kD, the 30kD and 50kD) type for being suitable for using protein isolate amount, such as Destination protein is 100kD, and 10kD, 30kD is finally used relatively to be suitble to；Concentration will affect using the lesser concentration tube of molecular weight Speed will lead to the loss of part destination protein if excessive, using 4 DEG C of centrifuges of low temperature, 3200-4000 turns/min carries out dense Contracting.

After sample is added in loading loop, loading and elution process, gel can be carried out automatically by setting program Filtration chromatography is separated according to the difference of the molecular weight of protein molecule, different chromatography column volume and different size column Material can generate different separating effects, in the common two kinds of specification (Hiload in laboratory^TM16/600 Superdex^TM200pg and Superdex^TM200 10/300GL) chromatographic column in, Superdex^TM200 10/300GL are suitable for separating the egg of 20~600kD It is white；Hiload200 is suitable for largely separating and preparing the albumen that molecular weight is about 20~600kD, in separation 60-120kD size Protein when, Hiload200 is compared with Superdex^TM200 10/300GL effects are more preferable；It is shown by experimental result, PEPR1 born of the same parents Outskirt albumen is more suitable for isolating and purifying using Hiload200.

Although above having used general explanation, specific embodiment and test, the present invention is made to retouch in detail It states, but on the basis of the present invention, it can be made some modifications or improvements, this is apparent to those skilled in the art 's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to claimed Range.

Sequence table

<110>China Agriculture Industitute Bee Research Center

<120>a kind of method of heterogenous expression PEPR1 albumen

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 739

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 1

Leu Asn Ser Asp Gly Leu Thr Leu Leu Ser Leu Leu Lys His Leu Asp

1 5 10 15

Arg Val Pro Pro Gln Val Thr Ser Thr Trp Lys Ile Asn Ala Ser Glu

20 25 30

Ala Thr Pro Cys Asn Trp Phe Gly Ile Thr Cys Asp Asp Ser Lys Asn

35 40 45

Val Ala Ser Leu Asn Phe Thr Arg Ser Arg Val Ser Gly Gln Leu Gly

50 55 60

Pro Glu Ile Gly Glu Leu Lys Ser Leu Gln Ile Leu Asp Leu Ser Thr

65 70 75 80

Asn Asn Phe Ser Gly Thr Ile Pro Ser Thr Leu Gly Asn Cys Thr Lys

85 90 95

Leu Ala Thr Leu Asp Leu Ser Glu Asn Gly Phe Ser Asp Lys Ile Pro

100 105 110

Asp Thr Leu Asp Ser Leu Lys Arg Leu Glu Val Leu Tyr Leu Tyr Ile

115 120 125

Asn Phe Leu Thr Gly Glu Leu Pro Glu Ser Leu Phe Arg Ile Pro Lys

130 135 140

Leu Gln Val Leu Tyr Leu Asp Tyr Asn Asn Leu Thr Gly Pro Ile Pro

145 150 155 160

Gln Ser Ile Gly Asp Ala Lys Glu Leu Val Glu Leu Ser Met Tyr Ala

165 170 175

Asn Gln Phe Ser Gly Asn Ile Pro Glu Ser Ile Gly Asn Ser Ser Ser

180 185 190

Leu Gln Ile Leu Tyr Leu His Arg Asn Lys Leu Val Gly Ser Leu Pro

195 200 205

Glu Ser Leu Asn Leu Leu Gly Asn Leu Thr Thr Leu Phe Val Gly Asn

210 215 220

Asn Ser Leu Gln Gly Pro Val Arg Phe Gly Ser Pro Asn Cys Lys Asn

225 230 235 240

Leu Leu Thr Leu Asp Leu Ser Tyr Asn Glu Phe Glu Gly Gly Val Pro

245 250 255

Pro Ala Leu Gly Asn Cys Ser Ser Leu Asp Ala Leu Val Ile Val Ser

260 265 270

Gly Asn Leu Ser Gly Thr Ile Pro Ser Ser Leu Gly Met Leu Lys Asn

275 280 285

Leu Thr Ile Leu Asn Leu Ser Glu Asn Arg Leu Ser Gly Ser Ile Pro

290 295 300

Ala Glu Leu Gly Asn Cys Ser Ser Leu Asn Leu Leu Lys Leu Asn Asp

305 310 315 320

Asn Gln Leu Val Gly Gly Ile Pro Ser Ala Leu Gly Lys Leu Arg Lys

325 330 335

Leu Glu Ser Leu Glu Leu Phe Glu Asn Arg Phe Ser Gly Glu Ile Pro

340 345 350

Ile Glu Ile Trp Lys Ser Gln Ser Leu Thr Gln Leu Leu Val Tyr Gln

355 360 365

Asn Asn Leu Thr Gly Glu Leu Pro Val Glu Met Thr Glu Met Lys Lys

370 375 380

Leu Lys Ile Ala Thr Leu Phe Asn Asn Ser Phe Tyr Gly Ala Ile Pro

385 390 395 400

Pro Gly Leu Gly Val Asn Ser Ser Leu Glu Glu Val Asp Phe Ile Gly

405 410 415

Asn Lys Leu Thr Gly Glu Ile Pro Pro Asn Leu Cys His Gly Arg Lys

420 425 430

Leu Arg Ile Leu Asn Leu Gly Ser Asn Leu Leu His Gly Thr Ile Pro

435 440 445

Ala Ser Ile Gly His Cys Lys Thr Ile Arg Arg Phe Ile Leu Arg Glu

450 455 460

Asn Asn Leu Ser Gly Leu Leu Pro Glu Phe Ser Gln Asp His Ser Leu

465 470 475 480

Ser Phe Leu Asp Phe Asn Ser Asn Asn Phe Glu Gly Pro Ile Pro Gly

485 490 495

Ser Leu Gly Ser Cys Lys Asn Leu Ser Ser Ile Asn Leu Ser Arg Asn

500 505 510

Arg Phe Thr Gly Gln Ile Pro Pro Gln Leu Gly Asn Leu Gln Asn Leu

515 520 525

Gly Tyr Met Asn Leu Ser Arg Asn Leu Leu Glu Gly Ser Leu Pro Ala

530 535 540

Gln Leu Ser Asn Cys Val Ser Leu Glu Arg Phe Asp Val Gly Phe Asn

545 550 555 560

Ser Leu Asn Gly Ser Val Pro Ser Asn Phe Ser Asn Trp Lys Gly Leu

565 570 575

Thr Thr Leu Val Leu Ser Glu Asn Arg Phe Ser Gly Gly Ile Pro Gln

580 585 590

Phe Leu Pro Glu Leu Lys Lys Leu Ser Thr Leu Gln Ile Ala Arg Asn

595 600 605

Ala Phe Gly Gly Glu Ile Pro Ser Ser Ile Gly Leu Ile Glu Asp Leu

610 615 620

Ile Tyr Asp Leu Asp Leu Ser Gly Asn Gly Leu Thr Gly Glu Ile Pro

625 630 635 640

Ala Lys Leu Gly Asp Leu Ile Lys Leu Thr Arg Leu Asn Ile Ser Asn

645 650 655

Asn Asn Leu Thr Gly Ser Leu Ser Val Leu Lys Gly Leu Thr Ser Leu

660 665 670

Leu His Val Asp Val Ser Asn Asn Gln Phe Thr Gly Pro Ile Pro Asp

675 680 685

Asn Leu Glu Gly Gln Leu Leu Ser Glu Pro Ser Ser Phe Ser Gly Asn

690 695 700

Pro Asn Leu Cys Ile Pro His Ser Phe Ser Ala Ser Asn Asn Ser Arg

705 710 715 720

Ser Ala Leu Lys Tyr Cys Lys Asp Gln Ser Lys Ser Arg Lys Ser Gly

725 730 735

Leu Ser Thr

<210> 2

<211> 2301

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

atgaagaatc ttggggggtt gttcaaaatt cttctgcttt tcttctgtct ctttctatcg 60

acccacataa tttccgtttc ttgtttaaac tcagatgggc taactctact ctctcttctg 120

aagcatttgg atagagtacc accacaagtt acttcgacat ggaaaataaa cgcatctgaa 180

gcaactccat gtaactggtt cggtatcact tgtgacgatt ctaagaatgt tgcgtctctc 240

aacttcactc gttctagggt ttcaggtcaa ttgggtccgg aaattgggga gctcaaaagc 300

ttgcagattt tggatctgag tactaacaat ttctccggga ctataccttc cactttagga 360

aactgtacca aactcgctac tctagatttg tctgaaaatg gattctctga taagatccca 420

gatactctcg atagcttgaa gaggttggag gtgctttatc tttacataaa cttcctcact 480

ggtgagttac ctgaatcctt gtttcgaatt ccgaagctgc aggttttata tcttgactat 540

aacaatctca ccggtccgat tcctcaaagt attggtgatg ctaaggagct tgtggagctg 600

agtatgtatg cgaatcagtt ctctggtaac atccctgagt cgattgggaa tagcagtagt 660

ctgcagattc tttatttgca caggaacaag ttagttggtt cattacctga aagtctcaat 720

cttttgggga atctcactac tctgtttgtt ggtaacaaca gtctacaagg gccggttcgt 780

ttcggatcac ctaattgcaa gaatttgttg actttagatt tgtcatacaa tgaattcgaa 840

ggcggtgttc cacctgcatt gggaaattgc agtagccttg acgctttagt cattgtgagt 900

ggtaacttgt caggtacaat cccttcctca ttgggtatgt tgaagaatct cacaattctt 960

aacctttccg agaatcgtct ctctgggagt atccccgcag agctcgggaa ctgcagtagc 1020

ttgaacttgt tgaagctgaa cgataaccag cttgtaggcg gaataccgag tgcattaggt 1080

aagctgagga agctagaaag tctggagctt ttcgaaaacc ggttttcggg tgagattcct 1140

attgagatat ggaagagtca gagtcttacg cagttgctag tttatcaaaa caatctcact 1200

ggtgaactac ctgtggaaat gactgagatg aagaagctaa agatcgctac gctgttcaac 1260

aacagctttt atggagcgat accaccgggt ttaggtgtga acagcagctt agaagaggtt 1320

gactttattg gtaacaaact tacaggagag ataccgccaa atctatgcca tggaaggaag 1380

ttgagaatac tcaacttggg ttctaatctg cttcatggta caataccagc ttctattggt 1440

cactgtaaga ccatcaggag attcatcctt agagaaaata acctttcagg tcttcttcct 1500

gagttttctc aggatcatag tctttctttt cttgatttca atagcaacaa cttcgaagga 1560

ccaatcccgg gcagcctcgg aagctgtaag aatctctcga gtattaacct atctcgaaac 1620

agattcacgg ggcagatacc tccacaactt gggaatctac aaaaccttgg ttacatgaat 1680

ctttctcgta atcttcttga agggtctcta ccagctcagc tatctaactg tgtgagttta 1740

gagcgttttg atgttggctt caactcatta aacggttcag ttccttcaaa ctttagtaac 1800

tggaaaggct tgacgacttt agttctcagc gagaaccggt tttcaggagg tattccacag 1860

ttcttgcctg agcttaagaa gctgtcaact ctgcagattg ctagaaatgc ttttggtggt 1920

gagattcctt cgtcgattgg gttgatagag gatctgatct atgacttgga ccttagtgga 1980

aacggattga caggtgaaat tccagccaag ttgggagatc tcatcaagtt aacaagactc 2040

aacatatcta acaacaattt gacaggatct ttatcggttc tcaaaggtct tacctcattg 2100

ctacatgttg atgtctccaa caatcagttc acaggtccaa taccagataa cttggagggt 2160

cagttgttat ctgagccgtc gtcgttttca ggaaatccaa acctctgcat tccacattcc 2220

ttctctgcta gcaacaatag ccgcagcgcg ttaaagtact gtaaagatca atctaaaagc 2280

aggaagagtg gccttagcac c 2301

<210> 3

<211> 60

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

atggcgttca agagtatagc agttttaagc gcctgcataa ttgtgggttc agcgcttccg 60

<210> 4

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

cgcggatcct taaactcaga tgggctaac 29

<210> 5

<211> 51

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

aggaagagtg gccttagcac ccatcatcat catcatcatt aagtcgacgt c 51

Claims

1. a kind of method of heterogenous expression PEPR1 albumen, which is characterized in that comprising steps of

(2) clone obtains PEPR1 exon genes, PEPR1 exon genes is connected on the carrier of step (1), obtains external source Expression vector；

(3) heterogenous expression carrier transfection insect cell, obtains recombinant baculovirus, and virus infection insect cell cultivates the insect After cell, cell and supernatant are harvested, supernatant obtains the correct PEPR1 albumen of conformation through chromatographing after purification.

2. the method according to claim 1, wherein the construction method of step (1) described carrier be pFastBac^TMHemolin signal peptide is added before 1 BamH1 restriction enzyme site and obtains pFastBac^TMHem carrier；The Hemolin The nucleotide sequence of signal peptide is as shown in SEQ ID NO.3.

3. the method according to claim 1, wherein the amino acid sequence of PEPR1 albumen such as SEQ ID NO.1 institute Show.

4. method according to claim 1 to 3, which is characterized in that the PEPR1 exon genes of step (2) are connected into load BamH1 and Sal1 digestion PEPR1 exon genes are used before body.

5. method according to claim 1 to 3, which is characterized in that in step (2), using BamH1 and Xho1 digestion Step (1) constructs obtained carrier, connect after digestion with PEPR1 exon genes, constructs heterogenous expression carrier.

6. method according to claim 1 to 3, which is characterized in that in step (3), after obtaining recombinant baculovirus, Culture is expanded using Expression System ESF AF culture medium to insect cell, then is invaded with the recombinant baculovirus obtained Dye expands the insect cell after culture, and purifying obtains the PEPR1 albumen of correct conformation.

7. according to the method described in claim 6, it is characterized in that, in step (3), using the Divine Land Yi Qiao company It is 0.3 × 10 that insect cell is diluted to cell concentration by Expression System ESF AF culture medium⁶-1×10⁶A/mL, It is incubated overnight, when growing into 1.6 × 10⁶-2.0×10⁶When a/mL, the recombinant baculovirus containing PEPR1 is added, is collected after culture Cell culture supernatant.

8. the PEPR1 albumen that method as claimed in claim 1 to 7 is prepared.

9. a kind of heterogenous expression carrier for expressing PEPR1 albumen, which is characterized in that connect on the carrier with target gene N-terminal The hemolin Hemolin signal peptide in one section of baculoviral source is added in front end；Carrier is preferably pFastBac^TMHem, It is in carrier pFastBac^TMHemolin signal peptide is added before 1 BamH1 restriction enzyme site to obtain, the Hemolin signal peptide Nucleotide sequence is as shown in SEQ ID NO.3.

10. method as claimed in claim 1 to 7 or PEPR1 albumen according to any one of claims 8 are as claimed in claim 9 outer Source expression vector can be with the small-molecule drug of activated plant immune response or development plants antimicrobial medicine or raising Genes For Plant Tolerance in screening Application in sick phenotype or raising plant products.