CN109371153B - Wheat 2B chromosome root depth related KASP marker and application thereof - Google Patents
Wheat 2B chromosome root depth related KASP marker and application thereof Download PDFInfo
- Publication number
- CN109371153B CN109371153B CN201811343752.2A CN201811343752A CN109371153B CN 109371153 B CN109371153 B CN 109371153B CN 201811343752 A CN201811343752 A CN 201811343752A CN 109371153 B CN109371153 B CN 109371153B
- Authority
- CN
- China
- Prior art keywords
- sequence
- wheat
- primer
- kasp
- root
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses KASP markers deeply related to wheat 2B chromosome root systems and application thereof. The invention provides a KASP primer, which consists of a primer 1 shown in a sequence 1 in a sequence table or a derivative thereof, a primer 2 shown in a sequence 2 in the sequence table or a derivative thereof and a primer 3 shown in a sequence 3 in the sequence table. The KASP molecular marker can provide strong selection sites, improve the accuracy of selection of deep-root breeding materials and realize the goal of auxiliary selection of root system depth by the molecular marker.
Description
Technical Field
The invention belongs to the technical field of molecular biology and crop breeding, and particularly relates to a KASP marker deeply related to a wheat 2B chromosome root system and application thereof.
Background
Wheat is a main grain crop in arid and semi-arid regions, the development of wheat production is severely restricted by drought and water shortage, and a large amount of agricultural water needs to be input to reduce the influence of drought stress on the yield and quality of the wheat. Therefore, the cultivation of drought-resistant water-saving wheat varieties is a strategic measure for guaranteeing the food safety and the water resource safety in China. The root system is used as the main organ for plant body to absorb water and nutrients, and has important function in form and physiological regulation. Therefore, the development of drought-resistant related root system characters for breeding selection is helpful for improving the drought resistance of wheat, and is a hotspot of current research.
The deep root system is beneficial to the wheat to absorb the moisture stored in the deep soil, thereby reducing the waste of water resources, and in addition, the good moisture circulation can promote the stomata to open and simultaneously maintain the moisture balance in the body, thereby ensuring the grain filling in the drought environment. Research shows that the root depth is increased by 30cm under natural field conditions, so that more water equivalent to 10mm of precipitation can be absorbed in the grain filling period, and the yield is increased by 0.5t per hectare. Thus, deep roots are considered as important target traits for drought resistance improvement. However, the deep identification process of the root system is heavy, and even if the deep identification process is closely related to drought resistance, the deep identification process is difficult to directly apply. The molecular marker can establish a 'molecular fingerprint' for the root depth, so that the development of the functional marker related to the root depth of wheat is particularly urgent. With the rapid development of Wheat genomics and high-throughput sequencing technology, the number of Wheat polymorphic markers is increasing day by day, and the number of SNP markers contained in newly developed Wheat 660K SNParray is over 60 ten thousand. Therefore, the whole genome correlation analysis is developed by combining a high-throughput gene chip technology, and the development of high-quality molecular markers for root depth detection is expected, so that the establishment of the high-throughput detection method based on the high-quality molecular markers has extremely high theoretical and application values.
Disclosure of Invention
An object of the present invention is to provide a KASP primer.
The primer provided by the invention consists of a primer 1 shown as a sequence 1 in a sequence table or a derivative thereof, a primer 2 shown as a sequence 2 in the sequence table or a derivative thereof and a primer 3 shown as a sequence 3 in the sequence table.
In the primers, the derivative of the primer 1 shown in the sequence 1 in the sequence table is a single-stranded DNA molecule shown in the sequence 1, and the 5' end of the single-stranded DNA molecule is connected with a fluorescent sequence (specifically, an FAM sequence label in the embodiment);
the derivative of the primer 2 shown in the sequence 2 in the sequence table is formed by connecting the 5' end of a single-stranded DNA molecule shown in the sequence 1 with another fluorescent sequence (specifically, a HEX sequence label in the embodiment).
In the primer, the fluorescent group sequence is a fluorescent sequence FAM or a fluorescent sequence HEX.
In the above primers, the molar ratio of the primer 1 or a derivative thereof, the primer 2 or a derivative thereof, and the primer 3 is 1:1: 1.
PCR reagents containing the above primers are also within the scope of the present invention.
In the examples, the final concentration of the forward primer F1 having the FAM tag sequence, the forward primer F2 having the HEX tag sequence and the reverse primer R in the KASP reaction system was 0.6. mu.M.
A kit containing the above primers or the PCR reagent is also within the scope of the present invention.
The application of the primer or the PCR reagent or the kit in at least one of the following 1) to 4) is also within the protection scope of the invention:
1) identifying or assisting in identifying the depth of the wheat root system;
2) preparing a product for identifying or assisting in identifying the depth of the wheat root system;
3) detecting or screening or breeding wheat with excellent root systems;
4) preparing and detecting or screening or breeding wheat products with excellent root systems.
In the above application, the wheat with excellent root system is deep-root wheat.
The invention also aims to provide a method for identifying or assisting in identifying the root depth of wheat.
The method provided by the invention comprises the following steps: performing KASP reaction on wheat to be treated by using the primer, detecting a reaction product,
the root depth of the wheat to be detected with the color of the fluorescent sequence connected with the 5 'end of the DNA molecule shown in the reaction product generation sequence 1 is greater than that of the wheat to be detected with the color of the fluorescent sequence connected with the 5' end of the DNA molecule shown in the reaction product generation sequence 2.
The 3 rd purpose of the invention is to provide a method for breeding wheat with excellent root systems.
The method provided by the invention is used for breeding the wheat to be tested, wherein the color of the KASP reaction product obtained by the method is the color of the DNA molecule 5' end shown in the sequence 1 connected with the fluorescence sequence, and the wheat with excellent root system is obtained.
Experiments prove that the invention provides a molecular marker (primer) for screening deep roots in the field of wheat molecular breeding, a method and application. Analysis shows that the KASP marker which is developed based on the SNP marker and the flanking sequence thereof and is positioned on the wheat 2B chromosome can accurately type the candidate sites related to the deep root and predict the root system depth of the wheat. The molecular marker-assisted selective breeding technology can effectively avoid the influence of environmental factors and human errors on the phenotype identification. The KASP molecular marker can provide strong selection sites, improve the accuracy of selection of deep-root breeding materials and realize the goal of auxiliary selection of root system depth by the molecular marker.
Drawings
FIG. 1 shows the results of KASP markers in 17 Chinese Main cultivars and the corresponding root depth comparison results.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The following examples further illustrate the present invention but are not to be construed as limiting the invention. The experimental techniques or procedures referred to in the following examples are conventional experimental techniques or procedures known in the art unless otherwise specified.
Example 1 positioning of wheat root depth related SNP site and establishment of molecular marker and detection method
First, natural group
A natural population is formed by collecting 323 parts of wheat germplasm from a northern winter wheat area and a Huang-Huai winter wheat area in China.
Second, identifying the depth of the root system in the middle stage of grouting of natural population by tube planting method
And excavating a soil pit with the depth of 180cm by using an excavator. Polyvinyl chloride (PVC) pipes (thickness 3.2mm, diameter 11cm) of corresponding lengths were placed in order in the pit. Cutting Polyethylene (PE) film tube (thickness 0.2mm, diameter 10cm) with corresponding length, sealing one end with a heat sealing machine, and punching 3cm above the seal with a puncher. Loading equivalent soil (prepared by mixing loam and compound organic fertilizer at a mass ratio of 50: 1) into a thin film tube, wherein the soil volume weight of the soil column is 1.13g cm-3And then the column was placed into the PVC pipe. Watering each tube to 80% of field water capacity, sowing 8 seeds, covering soil for 2cm, and thinning to 3 plants when the seedlings grow to the three-leaf stage. During the growth period, equal water is supplemented in the wintering period, the green turning period and the jointing period respectively, and the water is supplemented to 75-80% of the field water capacity each time. Root depth survey in middle stage of groutingThe soil column is drawn out, the PE pipe is carefully cut open, the bottom end is washed, and when the wheat root at the bottom is found, the distance between the position and the stem base part, namely the root depth, is recorded. The experiment was repeated three times, in a randomized block design.
Development of three, KASP markers
In order to facilitate the monitoring of the root system depth of the wheat candidate material, the following KASP marker primers are designed, and two forward PCR primers (F1 and F2) are designed based on the difference site (G/A) according to the KASP design principle and are respectively added with tag sequences: FAM (5 'GAAGGTGACCAAGTTCATGCT 3') and HEX (5 'GAAGGTCGGAGTCAACGGATT 3') were designed, and a universal reverse primer R was designed, the primer sequence is shown below:
forward primer F1: 5' ACATCAATACAGCATGATACGGATG 3 ' (SEQ ID NO: forward primer F1 with FAM sequence tag at the 5' end)
Forward primer F1 with FAM tag sequence: 5' GAAGGTGACCAAGTTCATGCTACATCAATACAGCATGATACGGATG 3 ' (FAM sequence tag added to the 5' end of forward primer F1)
Forward primer F2: 5 'ACATCAATACAGCATGATACGGATA 3 (SEQ ID NO: 2: 5' of forward primer F2 with HEX sequence tag)
Forward primer F2 with HEX tag sequence: 5' GAAGGTCGGAGTCAACGGATTACATCAATACAGCATGATACGGATA 3 ' (HEX sequence tag added to the 5' end of forward primer F2)
Reverse primer R: 5 'GGTCACTTTTCCTCGCGTTC 3' (SEQ ID NO: 3)
Method for detecting root system depth by KASP mark
1. KASP marker PCR amplification
Extracting genome DNA of a wheat variety to be detected as a template, and carrying out KASP reaction by using the forward primer F1 with the FAM tag sequence, the forward primer F2 with the HEX tag sequence and the reverse primer R.
The KASP reaction was performed on 384-well fluorescent quantitation plates, and the total volume of the mixed reaction system per well was 5.0. mu.L. According to QuantstrudioTM7Flex fluorescence quantifier (Applied Biosystems by Life Technologies), KASP Low mix reagent from LGC company; the primers were synthesized by Shanghai Invitrogen Biotechnology Ltd. The primers were synthesized and diluted to 100. mu.M, the KASP Primer mix Primer system comprised two tagged primers of 12. mu.L each, a universal reverse Primer of 30. mu.L, ddH2O46. mu.L, totaling 100. mu.L. The reaction mixture is shown in table 1 below:
table 1 shows the KASP reaction system
The final concentrations of the forward Primer F1 having a FAM tag sequence, the forward Primer F2 having a HEX tag sequence, and the reverse Primer R in the Primer mixture in the KASP reaction system were all 0.6. mu.M;
the PCR amplification reaction conditions were as follows: pre-denaturation at 95 ℃ for 15 min; the first step of amplification reaction: denaturation at 95 ℃ for 20sec, gradient annealing and extension at 65 ℃ for 60sec, 10 cycles, wherein the annealing and extension temperature is reduced by 1 ℃ in each cycle; second step amplification reaction, denaturation at 95 ℃ for 20sec, annealing at 57 ℃ and extension for 60sec, 30 cycles; storing at 12 deg.C.
Using QuantstrudioTMAnd (3) collecting the fluorescent signals of the amplified products by a 7Flex fluorescent quantitative instrument to obtain fluorescent color signals of different varieties, wherein the amplified products with FAM sequence labels are blue fluorescent signals, and the amplified products with HEX sequence labels are red fluorescent signals (FAM sequence label primers are G sites, and HEX sequence label primers are A sites).
Combining the root system detection results of 323 parts of wheat germplasm to form a natural population (table 2), it can be seen that: the root depth of the wheat to be detected, which generates blue fluorescence by the reaction product, is greater than that of the wheat to be detected, which generates red fluorescence by the reaction product.
TABLE 2 KASP marker test results and root system results
Therefore, the root depth of the wheat to be detected can be detected by using the forward primer F1, the forward primer F2 and the reverse primer R, and the specific method comprises the following steps:
carrying out KASP reaction on the wheat to be detected by using a forward primer F1 with a FAM sequence label, a forward primer F2 with a HEX sequence label and a reverse primer R, and detecting a fluorescent signal of the KASP reaction; the root depth of the wheat to be detected, which generates blue fluorescence by the reaction product, is greater than that of the wheat to be detected, which generates red fluorescence by the reaction product.
Example 2 application of KASP marker in detecting deep-rooted wheat variety
Firstly, a sample to be tested
17 wheat varieties from the Huang-Huai-winter wheat area and the northern winter wheat area in China are collected and planted in the institute of crop science of Chinese academy of agricultural sciences in 2015-2016 (the variety information is shown in the following table 3).
Table 3 shows variety information
Second, identifying root depth by tube planting method
The root depth of 17 wheat varieties was measured in the same manner as in example 1, and the results are shown in Table 1 below.
Three, KASP marker detection
Respectively extracting the total DNA of the genome of the leaves of 17 triticale varieties in the trefoil stage;
PCR amplification was performed using the total genomic DNA as a template, and a forward primer F1 having a FAM tag sequence, a forward primer F2 having a HEX tag sequence, and a reverse primer R.
The PCR amplification system and the PCR amplification conditions were the same as those in example 1.
Using QuantstrudioTMThe fluorescence signal of the amplified product was collected by 7Flex fluorescence quantitative analyzer.
The root depth of the wheat to be detected, which generates blue fluorescence by the reaction product, is greater than that of the wheat to be detected, which generates red fluorescence by the reaction product.
The results are shown in Table 4:
the fluorescence signals of 10 varieties of amplification products were red, and the fluorescence signals of 7 varieties of amplification products were blue.
TABLE 4 KASP marker test results and root system results
The average root depth of blue fluorescence signals and red fluorescence signals is counted, and the result is shown in fig. 1, and it can be seen that the difference between the root depths of two groups of varieties is significant at the level of 0.05 through analysis of variance (P is less than 0.05), the average root depth of the variety to be detected corresponding to the wheat generating blue fluorescence in the booting stage is 119.8cm, and the average root depth of the variety corresponding to the red fluorescence in the booting stage is 94.7 cm.
Thus, the root depth of the wheat variety that produces blue fluorescence is greater than the wheat variety that produces red fluorescence.
The KASP molecular marker of the invention has definite sequence and primer, and can be directly used in molecular marker-assisted selective breeding after case implementation.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> institute of crop science of Chinese academy of agricultural sciences
<120> wheat 2B chromosome root system depth-related KASP marker and application thereof
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 46
<212> DNA
<213> Artificial sequence
<400> 1
gaaggtgacc aagttcatgc tacatcaata cagcatgata cggatg 46
<210> 2
<211> 46
<212> DNA
<213> Artificial sequence
<400> 2
gaaggtcgga gtcaacggat tacatcaata cagcatgata cggata 46
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
ggtcactttt cctcgcgttc 20
Claims (7)
1. A KASP primer group consists of a derivative shown as a sequence 1 in a sequence table, a derivative shown as a sequence 2 in the sequence table and a primer 3 shown as a sequence 3 in the sequence table.
2. The primer set according to claim 1, wherein:
the molar ratio of the derivative shown in the sequence 1 in the sequence table, the derivative shown in the sequence 2 in the sequence table and the primer 3 is 1:1: 1.
3. PCR reagents comprising the primer set according to any one of claims 1 to 2.
4. A kit comprising the primer set according to any one of claims 1 to 2 or the PCR reagent according to claim 3.
5. Use of the primer set of any one of claims 1-2 or the PCR reagent of claim 3 or the kit of claim 4 in at least one of the following 1) -4):
1) the depth of the wheat root system is identified in an auxiliary manner;
2) preparing a product for assisting in identifying the depth of the wheat root system;
3) detecting or screening or breeding wheat with excellent root systems;
4) preparing and detecting or screening or breeding wheat products with excellent root systems.
6. A method for assisting in identifying the root depth of wheat comprises the following steps: performing KASP reaction on wheat to be tested by using the primer set of any one of claims 1-2, detecting the reaction product,
the average root depth of the wheat to be detected with the color of the fluorescent sequence connected with the 5 'end of the DNA molecule shown in the sequence 1 generated by the reaction product is greater than that of the wheat to be detected with the color of the fluorescent sequence connected with the 5' end of the DNA molecule shown in the sequence 2 generated by the reaction product.
7. A method for breeding wheat with excellent root system comprises the following steps:
performing KASP reaction on wheat to be tested by using the primer set of any one of claims 1-2, detecting the reaction product,
and breeding the wheat to be tested, wherein the color of the KASP reaction product obtained by the method of claim 6 is the color of the DNA molecule 5' end shown in the sequence 1 connected with the fluorescence sequence, and obtaining the wheat with excellent root system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811343752.2A CN109371153B (en) | 2018-11-13 | 2018-11-13 | Wheat 2B chromosome root depth related KASP marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811343752.2A CN109371153B (en) | 2018-11-13 | 2018-11-13 | Wheat 2B chromosome root depth related KASP marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109371153A CN109371153A (en) | 2019-02-22 |
| CN109371153B true CN109371153B (en) | 2021-08-31 |
Family
ID=65384905
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811343752.2A Active CN109371153B (en) | 2018-11-13 | 2018-11-13 | Wheat 2B chromosome root depth related KASP marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109371153B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107805673A (en) * | 2017-11-20 | 2018-03-16 | 中国农业科学院作物科学研究所 | A kind of SNP marker related to Wheat Seedling root traits and application |
| CN108060262A (en) * | 2018-02-08 | 2018-05-22 | 中国农业科学院作物科学研究所 | KASP marks relevant with wheat root character and its application |
-
2018
- 2018-11-13 CN CN201811343752.2A patent/CN109371153B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107805673A (en) * | 2017-11-20 | 2018-03-16 | 中国农业科学院作物科学研究所 | A kind of SNP marker related to Wheat Seedling root traits and application |
| CN108060262A (en) * | 2018-02-08 | 2018-05-22 | 中国农业科学院作物科学研究所 | KASP marks relevant with wheat root character and its application |
Non-Patent Citations (1)
| Title |
|---|
| "Genome-wide association study reveals genomic regions controlling root and shoot traits at late growth stages in wheat";Long Li, et al.;《Annals of Botany》;20190409;第124卷;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109371153A (en) | 2019-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109706263A (en) | Chain SNP marker and application with wheat stripe rust resisting ospc gene QYr.sicau-1B-1 | |
| CN107805673B (en) | SNP (Single nucleotide polymorphism) marker related to root system characters of wheat in seedling stage and application | |
| CN107217098A (en) | The KASP molecular labeling related to wheat anti growing out character and its application | |
| CN103952402A (en) | SNP (single nucleotide polymorphism) site related to characters of plant root system and application thereof | |
| CN106939342A (en) | A kind of and the cream-coloured chain SNP marker of millet, primer and application | |
| CN108374054A (en) | Suitable for one group of rice SSR molecular marker of capillary electrophoresis detection technology and its application | |
| CN109385466A (en) | The KASP Functional marker of resistance gene of rice blast Pi2 a kind of and its application | |
| CN114657277A (en) | KASP molecular marker related to wheat grain length and application thereof | |
| CN108456743B (en) | SNP (Single nucleotide polymorphism) marker related to flowering period and mature period of soybean as well as detection primer, method and application thereof | |
| CN106498048A (en) | A kind of QTL related to soybean nodulation number, SNP marker and application | |
| CN109234443B (en) | Wheat 6B chromosome root depth related KASP marker and application thereof | |
| CN109371153B (en) | Wheat 2B chromosome root depth related KASP marker and application thereof | |
| CN108531642B (en) | SSR molecular markers for identifying corn varieties and application thereof | |
| KR102167788B1 (en) | A primer set for discrimination of clubroot disease-resistant cultivar and idenditication method by using the same | |
| CN106755413A (en) | Nitrogen in Rice absorbs site qNUE6 and its molecule labelling method | |
| CN106701967A (en) | Molecular marker for regulating and controlling major QTL (Quantitative Trait Loci) of included angle of corn leaves and application method of mMolecular marker | |
| CN105821153A (en) | Molecular marker related to oilseed rape pod-shattering resistance quantitative trait loci (QTL) and application | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN107746895B (en) | Molecular marker for improving barley harvest index QTL site under low-phosphorus condition and application | |
| CN114908188A (en) | Application of KASP molecular marker related to wheat grain weight and grain length and primer composition thereof | |
| KR102332688B1 (en) | Molecular marker based on nuclear genome sequence for discriminating Panax ginseng 'SeonHyang' cultivar and uses thereof | |
| CN115852021A (en) | SNP molecular marker for identifying wheat grain weight and grain length and application thereof | |
| CN107365873A (en) | Molecular labeling and its application with the millet leaf sheath color linkage of characters | |
| CN108504760B (en) | QTL excavation and application of excellent salt-tolerant resources of rice | |
| CN102925440B (en) | SLAF-seq-based developed elytrigia elongata 1E chromosome specific molecular markers and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Long Inventor after: Jing Ruilian Inventor after: Liu Xia Inventor after: Mao Xinguo Inventor after: Wang Jingyi Inventor after: Chang Xiaoping Inventor before: Jing Ruilian Inventor before: Li Long Inventor before: Liu Xia Inventor before: Mao Xinguo Inventor before: Wang Jingyi Inventor before: Chang Xiaoping |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |