CN109355411A - A kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi - Google Patents
A kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi Download PDFInfo
- Publication number
- CN109355411A CN109355411A CN201811493219.4A CN201811493219A CN109355411A CN 109355411 A CN109355411 A CN 109355411A CN 201811493219 A CN201811493219 A CN 201811493219A CN 109355411 A CN109355411 A CN 109355411A
- Authority
- CN
- China
- Prior art keywords
- salmonella typhi
- bacteremia
- bile
- sample
- pcr method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
This application discloses a kind of quickly detection bacteremic blood culture PCR methods of Salmonella typhi, include the following steps, step S1: culture 4~6h of bacteremia sample；Step S2: being added bile, is prepared into final concentration of 0.3~5% haemocyte mixed liquor, cracks human blood cell；Step S3:PBS washing removal human genome interference；Step S4: Salmonella typhi genomic DNA is extracted；Step S5: Salmonella typhi fliC gene is detected with PCR method.As a result, by using the haemocyte in bile cracking bacteremia sample, after centrifugation, PBS washing removal human genome obtains purer bacterial genomes template, carries out PCR reaction as template, amplification efficiency significantly improves.
Description
Technical field
The present invention relates to Salmonella typhi detections, more particularly to a kind of quickly detection bacteremic blood culture of Salmonella typhi
PCR method.
Background technique
Every year, the whole world about 21,000,000 Salmonella typhis (Salmonellaenterica serovar Typhi,
S.Typhi) cases of infection, especially in developing country, about 200,000 people die of enteric fever every year.In China, enteric fever
Disease incidence is in downward trend year by year, but new epidemic characteristic also occurs.Uneven horizontal region morbidity, case is mostly to distribute, and is risen
Disease concealment, irregularly application also masks the clinical symptoms of typhoid and increases the patient of Asymptomatic Carriers clinical antibiotics
Number.Therefore establishing sensitive special method seems especially urgent to the antidiastole of S.Typhi in bacteremia.
Currently, patient's blood culture or coproculture separation S.Typhi pathogen be still clinical diagnosis typhoid most
Important method.But the positive rate of blood culture or excrement culture detection S.Typhi are low, only about 45~70% typhoid
Patient's blood culture or excrement culture are positive.Moreover, blood culture or excrement cultivation cycle are long, it usually needs 2~5 days time could obtain
Culture report.Serological method (widal's reaction) detects S.Typhi antibody clinically extensive utilization, widal's reaction principle
It is to detect in blood samples of patients that whether there is or not specific S.Typhi antibody as antigen by the detection of Salmonella thallus of inactivation, but due to existing
Often there is false positive or false negative in nonspecific antigen-antibody reaction.
Compared to above-mentioned method, molecular diagnosis (PCR method) is undoubtedly with greater advantage.It can only on PCR law theory
Specific amplification segment (specificity) can detecte lower level viable bacteria or dead bacterium (sensibility).Since S.Typhi is in blood
The interference of a large amount of human genomes, directly extracts base from untreated bacteremia sample in low carrying capacity and blood in liquid
Because group being used as pcr template, then S.Typhi target gene is expanded, expanding effect is bad or there are false positive or false negative phenomenons.
Summary of the invention
The purpose of the invention is to provide a kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi, solutions
One or more in certainly above-mentioned prior art problem.
According to an aspect of the present invention, a kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi is provided,
Include the following steps,
Step S1: culture 4~6h of bacteremia sample；
Step S2: being added bile, is prepared into the bile and bacteremia sample mixed liquor of bile final concentration of 0.3~5%, splits
Solve human blood cell；
Step S3:PBS washing removal human genome interference；
Step S4: Salmonella typhi genomic DNA is extracted；
Step S5: Salmonella typhi fliC gene is detected with PCR method.
By the present invention in that with the haemocyte in bile cracking bacteremia sample, after centrifugation, PBS washing removal people's gene
Group obtains purer bacterial genomes template, carries out PCR reaction as template, amplification efficiency significantly improves.
In some embodiments: in step S1, the culture of 3~5ml LB liquid medium is added in every milliliter of bacteremia sample
5h。
In some embodiments: in step S1, bacteremia sample cultivation temperature is 35~39 DEG C.
In some embodiments: bile is added in the bacteremia sample after culture in step S2, is made dense eventually
The haemocyte mixed liquor that degree is 1% is incubated for 5~20min at 35~39 DEG C, cracks human blood cell.
In some embodiments: bile is small fel bovis.
In some embodiments: in step S3, the bacteremia sample after cracking being subjected to centrifugal treating, centrifugal treating
Afterwards, supernatant is abandoned, sediment is collected in PBS washing.
In some embodiments: centrifugal rotational speed 7000-13000rpm, centrifugation time 5-20min.
In some embodiments: PBS washing times are at least once.
In some embodiments: in step S4, being extracted by paramagnetic particle method kit for extracting bacterial genome and washed through PBS
The bacterial genomes in bacteremia sample afterwards, 30-80 microlitres of water-soluble genomic DNA, packing, -15~25 DEG C freeze.
In some embodiments: in step S5, using the bacterial genomes of extraction as template, detecting S.Typhi gene
FliC, fliC upstream primer TACACCCCGAAAGAAACTGC, fliC downstream primer TTAAGCTCACCGCCTGTTCT expand piece
Segment length 692bp, 50 μ l PCR reaction systems: 25 μ l 2x mix each 4 μ l of buffer, 10 μM of fliC F, fliC R are extracted
2 μ l of genomic DNA template, water complements to 50 μ l, amplification condition: 94 DEG C of 5min；94 DEG C 30 seconds, 60 DEG C 30 seconds, 72 DEG C of 1min,
30 circulations；72℃10min.
Detailed description of the invention
Fig. 1 is a kind of small fel bovis cracking of quickly detection bacteremic blood culture PCR method of Salmonella typhi of the invention
Haemocyte schematic diagram；
Fig. 2 be the quickly detection bacteremic blood culture PCR method of Salmonella typhi of the invention a kind of ox bile with
S.Typhi co-cultures the schematic diagram for not influencing bacterial growth；
Fig. 3 is a kind of the thin of the OXLM extraction of quickly detection bacteremic blood culture PCR method of Salmonella typhi of the invention
Bacterium genome is compared with the quality for the bacterial genomes that conventional method is extracted.
Specific embodiment
Illustrate with reference to the accompanying drawing, invention is further described in detail.
Bacteremia sample preparation:
By the S.Typhi bacterium solution of culture to OD600=0.1,10 times of gradient dilution bacterium solutions of PBS, every pipe takes 10 μ l bacterium solution points
Kind LB solid medium, 37 DEG C of overnight incubations count S.Typhi clump count, and calculate OD600Detection of Salmonella bacterium colony is formed when=0.1
Unit (cfu/ml).
S.Typhi bacterium solution when by OD600=0.1 is successively diluted with 10 times of gradients of LB liquid medium, finally uses 4.9ml
Sterile whole blood is mixed with 100 μ l dilution bacterium solution, is prepared into the bacteremia sample of certain bacterial content.
Conventional method extracts pcr template:
5ml bacteremia sample (4 × 105、4×104、4×103、4×102、4×101、4×100, 0cfu/ml) respectively plus
Enter 20ml LB liquid medium, 37 DEG C, 250rpm is cultivated 5 hours, and 4000rpm is centrifuged 10min, abandons supernatant, and PBS is washed twice,
Precipitating is collected, bacterial genomes kit (the raw work in Shanghai, paramagnetic particle method) extracts genome, and 50 microlitres of water-soluble genomic DNAs divide
Dress, -20 DEG C freeze.
It is extracted using bile cracking haemocyte method (ox bile lysising RBC method, OBLM) of the invention
Pcr template:
5ml simulates bacteremia sample (4 × 105、4×104、4×103、4×102、4×101、4×100, 0cfu/ml) plus
Enter 20ml LB liquid medium, 37 DEG C, 250rpm is cultivated 5 hours, addition 1.25ml ox bile (20%) to final concentration 1%,
37 DEG C are continued to be incubated for 10 minutes cracking haemocytes, and 10000rpm is centrifuged 10min, abandons supernatant, and PBS is washed twice, and collects thallus, magnetic
Pearl method kit for extracting bacterial genome (the raw work in Shanghai, paramagnetic particle method) extraction bacterial genomes, 50 microlitres of water-soluble genomic DNAs,
Packing, -20 DEG C freeze.
Conventional blood culture method detects S.Typhi bacteremia sample:
5ml bacteremia sample (4 × 102、4×101、4×100, 0cfu/ml) Blood culture bottle is added, 5h and observe blood for 24 hours
Culture bottle positive alarm condition.
Blood culture PCR method of the present invention detects S.Typhi bacteremia sample:
5ml bacteremia sample (4 × 102、4×101、4×100, 0cfu/ml) be added 20ml LB liquid medium, 37 DEG C,
250rpm is cultivated 5 hours, and OBLM extracts S.Typhi genome, detects S.Typhi with PCR.
PCR detects S.Typhi:
Using the bacterial genomes of extraction as template, S.Typhi gene fliC is detected.FliC upstream primer
TACACCCCGAAAGAAACTGC, fliC downstream primer TTAAGCTCACCGCCTGTTCT, expanding fragment length 692bp.50μl
PCR reaction system: 25 μ l 2x mix buffer, 10 μM of fliC F, fliCR each 4 μ l, 2 μ of genomic DNA template of extraction
L, water complement to 50 μ l.Amplification condition: 94 DEG C of 5min；94 DEG C 30 seconds, 60 DEG C 30 seconds, 72 DEG C of 1min, 30 recycle；72℃
10min。
Ox bile (small fel bovis) cracks haemocyte:
4ml LB liquid medium is added in the sterile whole blood of 1ml, simulates blood culture mixed liquor, adds 250 μ l ox bile
(20%) solution is prepared into the ox bile bile and bacteremia sample mixed liquor of bile final concentration of 1%, 37 DEG C of incubation 10min
Haemocyte is cracked, 100 μ l mixed liquors are drawn, microscope low power microscopic observation haemocyte cracks situation.
Ox bile and S.Typhi is co-cultured:
By the S.Typhi bacterium solution of culture to OD600=0.1, ox bile (20%) solution is added, is prepared into final concentration of
1% ox bile S.Typhi mixed liquor, 37 DEG C of incubation 10min, while the S.Typhi bacterium solution ox bile is not added as pair
According to the influence that observation ox bile survives to S.Typhi.
Ox bile can crack completely haemocyte:
After different amounts of ox bile is added in blood cell suspension, microscope low power lens is shown, final concentration of 1%, 3% and
5% ox bile can crack haemocyte well, and not add the blood cell shape of ox bile (0%) complete, see Fig. 1.
Ox bile does not influence S.Typhi survival:
Take culture to OD600Ox bile is added in=0.1 bacterium solution, and (final concentration of 1%) is incubated for 10 minutes, and 10 times of gradients are dilute
Interpretation of the law counts Colony Forming Unit, the bacterium solution of ox bile is not added as control.As the result is shown, be not added ox bile processing phase
Than ox bile is added, and (final concentration of 1%) does not influence S.Typhi survival, sees Fig. 2.
The method of the present invention OXLM is compared with the quality for the bacterial genomes that conventional method is extracted:
Genome in bacterium blood-LB mixed liquor, the genome gel electrophoresis of extraction are extracted with OXLM and conventional method respectively.Knot
Fruit is as shown in Figure 3A, and conventional method extracts lots of genes group (mainly human blood cell's genome), and that OXLM is extracted is thin
Bacterium genome has no on electrophoretogram.Compared with the genome that conventional method is extracted, the bacterial genomes that OXLM is extracted can be significant
Reduce the amount of background genes group.Using the genome of extraction as template, S.Typhi fliC gene is expanded.As shown in Figure 3B, with
The bacterial genomes that OXLM is extracted are able to detect as pcr template down to 4 × 102The bacteremia sample of cfu/ml；And with routine
The genome that method is extracted is only able to detect 4 × 10 as pcr template5Bacteremia sample.
(A) conventional method is compared with the pcr template that OBLM is extracted, swimming lane 1-7: the pcr template that conventional method is extracted, swimming
The pcr template that road 8-14:OBLM is extracted；(B) genome extracted in conventional manner with OBLM is template, and PCR detects S.Typhi
Sensibility compares, swimming lane 1 and 8,2 and 9,3 and 10,4 and 11,5 and 12,6 and 13,7 and 14 corresponding sample be respectively 4 × 105,
4×104, 4 × 103, 4 × 102, 4 × 101, 4 × 100, the bacteremia of 0cfu/ml.
Blood culture PCR method is compared with conventional blood culture method detection S.Typhi bacteremia sample ability:
S.Typhi bacteremia sample passes through the increasing bacterium of 5h, and blood culture PCR method is able to detect that down to 4cfu/ml bacterium amount
Bacteremia sample.And passing through the increasing bacterium of 5h, none S.Typhi bacteremia sample report of conventional blood culture method is positive；Through
After increasing bacterium for 24 hours, 4 × 102With 4 × 101The bacteremia sample blood culture report of cfu/ml is positive, however the bacterium blood of 4cfu/ml bacterium amount
Disease sample blood culture is still negative, the results are shown in Table 1.Blood culture method can quickly and accurately identify S.Typhi bacteremia
1 blood culture PCR method of table is compared with conventional blood culture method detection bacteremia sample ability
Note: "+" represents in three repetitions one as the positive；"-" represents in three repetitions one as feminine gender.
To sum up, bile (Bile) is the juice of hepatocytes secrete, is stored in gall-bladder, and bile is by cholate, BILE PIGMENTS, gallbladder
The composition such as sterol, lecithin, potassium, sodium, calcium.Bile has cationic detegent effect, optionally dissolves phosphorus on cell membrane
Rouge and memebrane protein destroy cell membrane, make cell cracking.Ox bile is the bile extracted in small cattle gallbladder, is made after being dehydrated
At the bile powder of commercialization, the physicochemical property of bile can be retained to the greatest extent after redissolving.Therefore, Ox bile can be cracked
Haemocyte.For enterobacteriaceae lactobacteriaceae especially S.Typhi by long-term evolution to bile tolerant, ox bile is used as intestines
A kind of additive of the selective medium-Mai Kangkai culture medium of Bacteriaceae.This experiment discovery, if directly extracting bacteremia sample
This genomic DNA, the amount of human genome make next step PCR amplification S.Typhi far more than the amount (Fig. 3 A) of bacterial genomes
The amplification efficiency of fliC gene significantly reduces (Fig. 3 B).Therefore, this research is by using in ox bile cracking bacteremia sample
Haemocyte, after centrifugation, PBS washing removal human genome obtains purer bacterial genomes template, carries out PCR as template
Reaction, amplification efficiency significantly improve.
Currently, blood culture is the goldstandard for diagnosing S.Typhi infection, but conventional blood culture method usually requires 3-5 days
Time separates and identifies, and it is generally desirable to fast explicit pathogen infections to determine therapeutic scheme for clinic.Outside intestines heat symptom-complex patient
S.Typhi carrying capacity usually only 0.5-22cfu/ml in all blood, and the detection of PCR method limit is about 103Copies/ml is left
The right side, so a certain amount of S.Typhi (about 10 must be enriched to by the culture of certain time3Cfu/ml it) can be only achieved PCR's
Detection limit.About 20 minutes division generation of bacterium, so the culture of 5 hours keeps blood culture mixed in the case where nutritional sufficiency
It closes single bacterium in liquid and theoretically splits into 215=32768 bacteriums, i.e., 1.3 × 103The bacterium of cfu/ml, the pact more than PCR
103The detection of cfu/ml limits.Therefore blood culture PCR method of the invention passes through blood culture in 5 hours, collects bacterium, extracts thin
Bacterium genomic DNA carries out PCR amplification.
FliC full length gene 1521bp is an important flagellin gene of S.Typhi, encodes whip silk-fibroin.FliC base
Because being guarded in S.Typhi category, and it is special in enterobacteriaceae, therefore it is often used as the target gene of S.Typhi etiological diagnosis.
Blood culture PCR method of the invention, for detecting S.Typhi bacteremia sample.By the blood culture of 5 hours,
Through ox bile cracking haemocyte removal background genes group interference, last PCR detects S.Typhi specific gene fliC, this method
It can detecte the bacteremia sample down to 4cfu/ml.Whole process about 8 hours, the blood culture diagnosis side compared with 3-5 days
Method greatly reduces Diagnostic Time；Meanwhile blood culture PCR method detection bacteremia sample has good sensitivity and special
Property.
The above is only one embodiment of the present invention, it is noted that those skilled in the art,
Without departing from the concept of the premise of the invention, some similar deformation and improvement can be made, these also should be regarded as this
Within the protection scope of invention.
Claims (10)
1. a kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi, it is characterised in that: include the following steps,
Step S1: culture 4~6h of bacteremia sample；
Step S2: being added bile, is prepared into the bile and bacteremia sample mixed liquor of bile final concentration of 0.3~5%, cracks people
Haemocyte；
Step S3:PBS washing removal human genome interference；
Step S4: Salmonella typhi genomic DNA is extracted；
Step S5: Salmonella typhi fliC gene is detected with PCR method.
2. a kind of quickly the detection bacteremic blood culture PCR method of Salmonella typhi, feature according to claim 1 exist
In: in the step S1,3~5mlLB fluid nutrient medium culture 5h is added in every milliliter of bacteremia sample.
3. a kind of quickly the detection bacteremic blood culture PCR method of Salmonella typhi, feature according to claim 1 exist
In: in the step S1, bacteremia sample cultivation temperature is 35~39 DEG C.
4. a kind of quickly the detection bacteremic blood culture PCR method of Salmonella typhi, feature according to claim 1 exist
In: bile is added in the bacteremia sample after culture in the step S2, final concentration of 1% bile and bacterium blood is made
Disease sample mixed liquor is incubated for 5~20min at 35~39 DEG C, cracks human blood cell.
5. a kind of quickly the detection bacteremic blood culture PCR method of Salmonella typhi, feature according to claim 1 exist
In: the bile is small fel bovis.
6. a kind of quickly the detection bacteremic blood culture PCR method of Salmonella typhi, feature according to claim 1 exist
In: in the step S3, the bacteremia sample after cracking is subjected to centrifugal treating, after centrifugal treating, abandons supernatant, PBS washing is received
Collect sediment.
7. a kind of quickly the detection bacteremic blood culture PCR method of Salmonella typhi, feature according to claim 6 exist
In: the centrifugal rotational speed is 7000-13000rpm, centrifugation time 5-20min.
8. a kind of quickly the detection bacteremic blood culture PCR method of Salmonella typhi, feature according to claim 6 exist
In: the PBS washing times are at least once.
9. a kind of quickly the detection bacteremic blood culture PCR method of Salmonella typhi, feature according to claim 1 exist
In: in the step S4, extracted in the bacteremia sample after PBS is washed by paramagnetic particle method kit for extracting bacterial genome
Bacterial genomes, 30-80 microlitres of water-soluble genomic DNA, packing, -80~25 DEG C freeze.
10. a kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi according to claim 9, feature
It is: in the step S5, using the bacterial genomes of extraction as template, detects S.Typhi gene fliC, fliC upstream primer
TACACCCCGAAAGAAACTGC, fliC downstream primer TTAAGCTCACCGCCTGTTCT, expanding fragment length 692bp, 50 μ l
PCR reaction system: 25 μ l 2x mix each 4 μ l of buffer, 10 μM fliCF, fliCR, the 2 μ l of genomic DNA template of extraction,
Water complements to 50 μ l, amplification condition: 94 DEG C of 5min；94 DEG C 30 seconds, 60 DEG C 30 seconds, 72 DEG C of 1min, 30 recycle；72℃10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811493219.4A CN109355411A (en) | 2018-12-07 | 2018-12-07 | A kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811493219.4A CN109355411A (en) | 2018-12-07 | 2018-12-07 | A kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109355411A true CN109355411A (en) | 2019-02-19 |
Family
ID=65331735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811493219.4A Withdrawn CN109355411A (en) | 2018-12-07 | 2018-12-07 | A kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109355411A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102102124A (en) * | 2010-06-17 | 2011-06-22 | 深圳市疾病预防控制中心 | Multiplex fluorescence PCR (Polymerase Chain Reaction) detection method and detection kit for typhoid/paratyphoid saimonella |
| CN102250879A (en) * | 2011-06-03 | 2011-11-23 | 广州英诺生物医药技术有限公司 | Preparation method of pathogenic bacterium DNAs (Deoxyribonucleic Acids) in clinical blood sample and kit |
| US20150293093A1 (en) * | 2012-11-13 | 2015-10-15 | The General Hospital Corporation | Vitro assays for detecting salmonella enterica serotype typhi |
| CN108727503A (en) * | 2017-04-18 | 2018-11-02 | 武汉博沃生物科技有限公司 | VZV recombinates gE- flagellum plain fusion proteins and its preparation method and application |
-
2018
- 2018-12-07 CN CN201811493219.4A patent/CN109355411A/en not_active Withdrawn
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102102124A (en) * | 2010-06-17 | 2011-06-22 | 深圳市疾病预防控制中心 | Multiplex fluorescence PCR (Polymerase Chain Reaction) detection method and detection kit for typhoid/paratyphoid saimonella |
| CN102250879A (en) * | 2011-06-03 | 2011-11-23 | 广州英诺生物医药技术有限公司 | Preparation method of pathogenic bacterium DNAs (Deoxyribonucleic Acids) in clinical blood sample and kit |
| US20150293093A1 (en) * | 2012-11-13 | 2015-10-15 | The General Hospital Corporation | Vitro assays for detecting salmonella enterica serotype typhi |
| CN108727503A (en) * | 2017-04-18 | 2018-11-02 | 武汉博沃生物科技有限公司 | VZV recombinates gE- flagellum plain fusion proteins and its preparation method and application |
Non-Patent Citations (4)
| Title |
|---|
| MUHAMMAD NASRUM MASSI等: ""Rapid diagnosis of typhoid fever by PCR assay using one pair of primers from flagellin gene of Salmonella typhi"", 《JOURNAL OF INFECTION AND CHEMOTHERAPY》 * |
| TANKOUO-SANDJONG等: ""Salmonella enterica subsp. enterica serovar Typhi strain N2391_04 phase 1 flagellin (fliC)gene, partial cds"", 《GENBANK》 * |
| 王月玲等: ""增菌PCR法检测小鼠沙门氏菌"", 《上海实验动物科学》 * |
| 郭继中等: ""血清高迁移率族蛋白B1在急性化脓性胆管炎发生中的作用及意义研究"", 《中华消化内镜杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| De Groote et al. | Relationships between Mycobacterium isolates from patients with pulmonary mycobacterial infection and potting soils | |
| CN104313130B (en) | A kind of functionalized magnetic nano particle of efficiently concentrating microorganism and preparation and application | |
| CN104073469B (en) | The separation of cracking aquatic pathogenic bacteria phage and screening technique | |
| CN102816850A (en) | Method for simultaneously detecting salmonella typhimurium, escherichia coli O157:H7 and listeria monocytogenesis | |
| Chen et al. | Development of O-serogroup specific PCR assay for detection and identification of Vibrio parahaemolyticus | |
| CN102943113B (en) | Loop-mediated isothermal amplification detection primer groups of Escherichia coli 0157, detection method and reagent kit | |
| Wang et al. | Detection of Vibrio cholerae O1 and O139 in environmental water samples by an immunofluorescent-aggregation assay | |
| CN105420394A (en) | Primer pair, probe and kit for detecting bacterium MCR-1 gene | |
| CN107513575A (en) | A kind of method and its application for detecting the bacterium infection of cloth Shandong | |
| Lauwers et al. | Serotyping Campylobacter jejuni and Campylobacter coli on the basis of thermostable antigens | |
| CN104232784A (en) | Multiplex PCR (polymerase chain reaction) method for testing three main pathogens in beef | |
| CN105506153A (en) | Kit and method for detecting aeromonas veronii | |
| CN110512008A (en) | Detect multiple PCR reagent kit and its application of a kind of common ten food-borne pathogens | |
| CN101748214B (en) | Pullorum-typhoid salmonella PCR detection method, nucleic acid and primer therein | |
| CN102277422A (en) | Method for rapid detection of Listeria monocytogenes viable bacteria in liquid milk | |
| CN106434994A (en) | Rapid detecting mycoplasma ovipneumoniae method | |
| CN101724692B (en) | Primer and diagnosis method used for diagnosing mulberry bacterial wilt disease | |
| CN105859883A (en) | Immunomagnetic bead containing OmpU antibody, preparation of immunomagnetic bead and method for capturing pathogenic vibrios and detecting pathogenic vibrios through multiplex PCR by utilizing immunomagentic bead | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN109355411A (en) | A kind of quickly detection bacteremic blood culture PCR method of Salmonella typhi | |
| CN106702016A (en) | Method for rapidly detecting salmonellae | |
| TW200840870A (en) | Method of pre-treating in pleural effusion for detection of mycobacterium tuberculosis | |
| CN103993072B (en) | The multiple PCR detection kit of the pathogenic sweetfish pseudomonas of a kind of Rapid identification and method thereof | |
| CN105219763A (en) | A kind of extracting and purifying method of mycobacterium tuberculosis dna | |
| CN108251547A (en) | The IC-PCR detection primers group of klebsiella pneumoniae and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20190219 |
|
| WW01 | Invention patent application withdrawn after publication |