CN109355355A - It is a kind of for target dna enrichment kit, preparation method and application - Google Patents
It is a kind of for target dna enrichment kit, preparation method and application Download PDFInfo
- Publication number
- CN109355355A CN109355355A CN201811584853.9A CN201811584853A CN109355355A CN 109355355 A CN109355355 A CN 109355355A CN 201811584853 A CN201811584853 A CN 201811584853A CN 109355355 A CN109355355 A CN 109355355A
- Authority
- CN
- China
- Prior art keywords
- dna
- double chain
- probe
- chain dna
- homologous recombination
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Abstract
This application discloses a kind of kits for target dna enrichment, preparation method and application.The kit of the application, including double chain DNA probe and homologous recombination enzyme；Double chain DNA probe has biotin labeling；Homologous recombination enzyme is used in conjunction with the single stranded DNA of sample to be tested, and promotes double chain DNA probe in conjunction with the homology single stranded DNA in sample to be tested.The application is used for the kit of target dna enrichment, can target the single-stranded target DNA in enrichment sample to be tested using the target recognition reaction of homologous recombination enzyme using double chain DNA probe；And double chain DNA probe homology single-stranded target DNA identification and enrichment based on homologous recombination enzyme, high-efficient, uniformity and stability are good, the enrichment particularly suitable for more target DNA or the lower target dna of copy number.In the kit of the application, the double chain DNA probe preparation method of core component is simple, easy to operate and at low cost.
Description
Technical field
This application involves DNA to be enriched with field, more particularly to a kind of kit for target dna enrichment, preparation method
And application.
Background technique
The fast development and application of new-generation sequencing technology (NGS) and platform make it possible that multizone is sequenced simultaneously.
Although genome sequencing cost constantly declines, interested target gene or region is selected to be sequenced and analyzed still
So it is more in line with currently practical and cost-effectiveness.Therefore, target dna beneficiation technologies are as the most frequently used before new-generation sequencing technology
One of technology.
Currently used target area beneficiation technologies mainly there are several types of: 1) based on the method for primer amplified；
2) method based on oligonucleotide probe hybrid capture；3) method based on the hybridization of reversed probe.These three common methods have
Its respective Pros and Cons.
Method based on primer specificity amplification generally compares direct convenience, but the feelings especially more for target area
Condition needs to carry out multiplex amplification using multiple groups primer pair, and often occurs when multiplex amplification wrong between each specific primer
The case where accidentally expanding, and multiplex amplification is difficult to ensure the amplification efficiency of every pair of primers.
Method based on oligonucleotide probe hybrid capture is able to detect large batch of target area.It often applies entirely outer in people
It shows in the capture sequencing of son.This method can capture and detect a variety of variation types, such as single nucleotide variations, small insertion and lack
It loses, or even copy number variation etc..But the reagent of hybrid capture and probe price are more expensive in this method, and hybridize and catch
The time obtained will be grown, generally will be 16 hours to 48 hours.
Method based on the hybridization of reversed probe refers to that target area two sides complement thereof is contained at one section of both ends of design
Oligonucleotide probe.With target molecule hybridize and extend connect after form single stranded circle.It is set again by the universal sequence on probe
Meter primer is expanded.The part advantage that there is this method primer amplified and oligonucleotide hybridization to capture, probe design
Complexity, hybridization efficiency and molecule utilization rate be not high.
Therefore, in order to meet increasingly extensive gene sequencing demand, research and develop a kind of more effective target dna enrichment reagents or
Method is the research emphasis of this field.
Summary of the invention
The purpose of the application is to provide the new kit for target dna enrichment of one kind, preparation method and application.
To achieve the goals above, the application uses following technical scheme:
The one side of the application discloses a kind of kit for target dna enrichment, including double chain DNA probe and homologous
Recombinase；Double chain DNA probe has biotin labeling；Homologous recombination enzyme is used in conjunction with the single stranded DNA of sample to be tested, and is promoted
Double chain DNA probe is in conjunction with the homology single stranded DNA in sample to be tested；It, will be using the biotin labeling in double chain DNA probe
Homology single stranded DNA under homologous recombination enzyme effect in conjunction with double chain DNA probe is separated, is enriched with, and plays the effect of target dna enrichment
Fruit.Wherein, double chain DNA probe is actually a double chain DNA fragment, and double chain DNA probe has biotin labeling, can be
In adenyl-deoxyribonucleotide, thymidylic acid, deoxycytidylic acid and guanine deoxyribonucleoside acid extremely
It is few a kind of with biotin labeling, or biotin labeling is carried out to double chain DNA probe otherwise.
It should be noted that the key of the application is to make the identification of homologous nucleic acid and target using homologous recombination enzyme
With, the sample to be tested target dna with double chain DNA probe homology is separated, thus play target dna enrichment effect.Generally
For, homologous recombination enzyme is that nucleic acid-protein compound is combined into single stranded DNA, then, will be single under the action of homologous recombination enzyme
Chain DNA is integrated on the double-stranded DNA of homology therewith；But the application creativeness, reverse operating, using double-stranded DNA as spy
Needle removes the single-stranded target DNA in targeting sample to be tested with double-stranded DNA；So including double-stranded DNA in the kit of the application
Probe and homologous recombination enzyme.
Wherein, homologous recombination enzyme can use existing conventional use of homologous recombination enzyme, such as RecA, RecBCD,
RecF, RecO, RecR, Rad51, Mre11-Rad50 etc., still, in the preferred embodiment of the application, it is preferred to use RecA or
Rad51。
Preferably, the length of double chain DNA probe is 50bp-100bp.
It should be noted that in a kind of implementation of the application interrupted by the double-stranded DNA to long segment,
To obtain the double chain DNA probe of short chain；Therefore, the length of 50bp-100bp is the conventional length of most of double chain DNA probes,
It is not excluded for the range after interrupting there are the length of dsdna segment probe less than or greater than the application restriction.
Preferably, the kit of the application further includes the magnetic bead of Avidin modification, and magnetic bead will be for that will have biotin labeling
Double chain DNA probe separation.
Preferably, the kit of the application further includes homologous recombination enzyme group installed reagents and/or homologous recombination enzymatic hydrolysis assembling examination
Agent.
It should be noted that magnetic bead can modify magnetic bead using commercially available Avidin, for ease of use, the application by its
It is combined in the kit of the application；It, can also be with likewise, homologous recombination enzyme group installed reagents, homologous recombination enzymatic hydrolysis group installed reagents
According to the corresponding group installed reagents of the commercially available acquisition of specific homologous recombination enzyme or system of solutions installed reagents, for ease of use, the application
It is assembled into the kit of the application.
It should also be noted that, being the Beads enrichment biology using Avidin modification in a kind of implementation of the application
The double chain DNA probe of element label, the purpose is to separate the single-stranded target DNA in conjunction with double chain DNA probe homology；It can
To understand, the not unique selection of magnetic bead, such as can also be by the way that the double chain DNA probe of biotin labeling is fixed on film, mistake
On the solid carriers such as filter column, separate single-stranded target DNA in combination, or will using the film or Filter column of Avidin modification
Double chain DNA probe separation, to realize that single-stranded target DNA is separated.
The another side of the application discloses double chain DNA fragment with biotin labeling and homologous recombination enzyme as DNA richness
Collect the application of reagent.
It should be noted that the key of the application is that, creative utilizes double-stranded DNA and homologous recombination enzyme, to list
Chain DNA reversely targets effect, single-stranded target DNA is separated from sample to be tested, to realize concentration effect.
The another side of the application discloses a kind of preparation method of double chain DNA probe for target dna enrichment, including adopts
PCR amplification is carried out with DNA of the amplimer to sample to be tested, also, during PCR amplification, dATP, dGTP of use,
At least one of dCTP and dTTP have biotin labeling；Pcr amplification product, that is, double chain DNA probe；Wherein, amplimer energy
All or part of sequence of the target dna of the amplification sample to be tested of enough specificity.
It should be noted that in the kit of the application, why reverse operating, using double-stranded DNA as probe, be exactly because
Conventional PCR amplification can be directly used for double chain DNA probe to obtain, preparation method is simply, conveniently；Especially with respect to existing
Oligonucleotide probe hybrid capture for, single-stranded hybrid capture probe is typically only capable to using the synthesizing single-stranded DNA of artificial chemistry, at
This height is unfavorable for more targets, large batch of synthesis；And the double chain DNA probe of the application can be prepared using PCR amplification, for
More targets can directly design multiple groups amplimer, carry out PCR amplification respectively and obtain the double chain DNA probe for being directed to different targets,
Method is simple, easy to operate, at low cost.
Preferably, the preparation method of the application further includes carrying out interrupting processing to pcr amplification product, obtains length and is
The double chain DNA probe of 50bp-100bp.
It should be noted that the PCR amplification of the application prepares double chain DNA probe, high-fidelity is required it is lower, as long as with to
There is the target dna of test sample sheet homology can play recognition reaction；Therefore, if the target dna to be enriched with is gathered in one
A bigger region, or to be enriched with whole gene, then Long fragment PCR amplification can be carried out, each amplification region can be grown
Up to 20kb；But as double chain DNA probe, length is in 100bp or so optimum, therefore, for length greater than 100bp's
Pcr amplification product, the application is further crushed it using the conventional processing method that interrupts, to obtain 50bp-100bp
Double chain DNA probe.
Preferably, the preparation method of the application further includes to pcr amplification product or interrupting the product of processing and purifying, and is obtained
Obtain double chain DNA probe.
It should be noted that after the completion of PCR amplification, or after interrupting processing, generally require double chain DNA probe from reactant
It is extracted in system, is then re-used as probe and is added in the assembling reaction system of homologous recombination enzyme, therefore, the preparation of the application
Method further comprises purification step, can be using conventional pcr amplification product purification process, example as specific way of purification
Such as paramagnetic particle method, agarose gel electrophoresis partition method, DHPLC purifying, are not specifically limited herein.
The double chain DNA probe of the preparation method preparation for disclosing the application on one side again of the application.
The survey of the kit for disclosing the application on one side again of the application or the double chain DNA probe of the application in target dna
Application in sequence or library construction.
Kit based on the application, disclosed herein as well is a kind of methods of target dna enrichment, include the following steps,
Protein nucleic acid compound preparation step, including the single stranded DNA of homologous recombination enzyme and sample to be tested is assembled into stabilization
Protein nucleic acid compound；
Homologous recombination step, including with target dna there is the double-stranded DNA of homology to visit using with biotin labeling
Needle is reacted with protein nucleic acid compound, and under the action of homologous recombination enzyme, double chain DNA probe is in conjunction with single-stranded target dna；
Biotin labeling separating step will be in combination homologous including the use of the biotin labeling in double chain DNA probe
Property single-stranded target DNA separation, enrichment.
Wherein, homologous recombination enzyme and single stranded DNA are assembled into protein nucleic acid compound, can be with reference to conventional homologous recombination enzyme
The group installed reagents and method used when in conjunction with single stranded DNA, are not specifically limited herein.
It should be noted that an object of the application DNA enrichment method, creative utilization homologous recombination enzyme and sample to be tested
Single stranded DNA be assembled into stable protein nucleic acid compound；Then the double-strand with target dna homology designed in advance is utilized
DNA probe, i.e. double chain DNA fragment in conjunction with protein nucleic acid compound homology, and utilize the life having on double chain DNA probe
Object element label, the single-stranded target DNA of sample to be tested is separated, and realizes target dna enrichment.The enrichment method of the application, one
Aspect can effectively be combined target dna using the promotion recognition effect of homologous recombination enzyme, separate；On the other hand,
The double chain DNA probe preparation method that the application enrichment method uses is simple, for traditional single-stranded probe, the application's
It only needs to carry out conventional PCR amplification in a kind of implementation or pcr amplification product is carried out to interrupt processing, can be obtained pair
Ssdna probe, preparation simply, conveniently, reduce the probe cost of target dna enrichment.
Preferably, an object of the application DNA enrichment method further includes de-assembly step, and de-assembly step includes, in biology
After element label separating step, using system of solutions installed reagents, dissociate the single-stranded target DNA of enrichment from protein nucleic acid compound
Come.
It should be noted that the effect of protein nucleic acid compound is, the promotion identification of homologous recombination enzyme and homology are utilized
Combination, enable has the single-stranded target DNA of homology accurate and effective and double chain DNA probe with double chain DNA probe
In conjunction with, and then facilitate and separate single-stranded target DNA, realize enrichment；It is appreciated that if necessary to obtain individually single-stranded mesh
DNA product is marked, then needs to dissociate single-stranded target DNA from protein nucleic acid compound using conventional de-assembly method and come；
Certainly, if by single-stranded target DNA separation and concentration, or there are other purposes, it is also not necessary to de-assembly steps.
Preferably, an object of the application DNA enrichment method further includes carrying out denaturation treatment to the nucleic acid of sample to be tested, is obtained
Single stranded DNA.
Preferably, sample to be tested is carried out before or after carrying out denaturation treatment interrupting processing.
It should be noted that in general, the DNA sample of extraction is all duplex structure, and segment is all long；And this
The target dna enrichment method of application, needs the single stranded DNA using short-movie section, and therefore, an object of the application DNA enrichment method is also
Can further include denaturation, will denatured double stranded be it is single-stranded, or sample to be tested is interrupted and is processed into short-movie section.Certainly, right
In the sample that the application is exactly short segment DNA, then do not need to interrupt processing.
Preferably, in an object of the application DNA enrichment method, biotin labeling separating step is specifically repaired using Avidin
The magnetic bead of decorations carries out.
Preferably, in an object of the application DNA enrichment method, homologous recombination enzyme be RecA, RecBCD, RecF, RecO,
At least one of RecR, Rad51 and Mre11-Rad50.It is furthermore preferred that homologous recombination enzyme is RecA or Rad51.
Preferably, in an object of the application DNA enrichment method, the length of double chain DNA probe is 50bp-100bp.
Preferably, double chain DNA probe used in an object of the application DNA enrichment method is obtained using following methods preparation
:
PCR amplification is carried out using DNA of the amplimer to sample to be tested, also, during PCR amplification, use
At least one of dATP, dGTP, dCTP and dTTP have biotin labeling；Pcr amplification product, that is, double chain DNA probe；Wherein,
Amplimer is capable of all or part of sequence of the target dna of the amplification sample to be tested of specificity.
It should be noted that the length of the double chain DNA probe of the application is 50bp-100bp, therefore, for being greater than 100bp
Pcr amplification product, the application further can also include carrying out interrupting processing to pcr amplification product.In addition, in order to obtain
Pure double chain DNA probe, the application further can also include to pcr amplification product or interrupting the product of processing and purifying,
Such as the purifying of magnetic beads for purifying or other means.
The another side of the application discloses sequencing or library construction of an object of the application DNA enrichment method in target dna
In application.
The application's discloses a kind of library constructing method of target dna on one side again, including uses an object of the application DNA
Enrichment method is enriched with target dna, then carries out subsequent library construction step again.
The application's discloses a kind of sequencing approach of target dna on one side again, including the library construction side using the application
Method prepares sequencing library, and then the sequencing library of preparation is sequenced.
Due to using the technology described above, the beneficial effects of the present application are as follows:
The application is used for the kit of target dna enrichment, using double chain DNA probe, is known using the target of homologous recombination enzyme
It does not act on, the single-stranded target DNA in enrichment sample to be tested can be targeted；And the double chain DNA probe based on homologous recombination enzyme is same
Source property single-stranded target DNA identification and enrichment, high-efficient, uniformity and stability are good, particularly suitable for more target DNA or copy
The enrichment of the lower target dna of number.In the kit of the application, the double chain DNA probe preparation method of core component is simple, easy
Operation, and it is at low cost.
Detailed description of the invention
Fig. 1 is the flow diagram of target dna enrichment method in the embodiment of the present application；
Fig. 2 is the schematic illustration that homologous recombination enzyme is enriched with target dna in the embodiment of the present application；
Fig. 3 is the agarose gel electrophoresis results figure of the sequencing library constructed in the embodiment of the present application one；
Fig. 4 is the agarose gel electrophoresis results figure of the sequencing library constructed in the embodiment of the present application two.
Specific embodiment
Homologous recombination refers to DNA points occurred between non-sister chromatid or on same chromosome containing homologous sequence
Reconfiguring between son or within molecule.Homologous recombination needs a series of protein catalysis, i.e. homologous recombination enzyme.It is homologous heavy
Group enzyme when playing a role, usually first with one section of single stranded DNA be combined into stable protein nucleic acid compound, then again with it is single-stranded
There is DNA the double-stranded DNA of homology to combine, recombinate.
The application is exactly that the homologous identity of homologous recombination enzyme is utilized, creative using double-stranded DNA as hybridization probe,
The single-stranded target DNA of sample to be tested is separated, is enriched with.Wherein, double chain DNA probe is specially designed and target dna has
There is a double chain DNA fragment of homology.
Therefore, the application has developed a kind of kit for target dna enrichment comprising double chain DNA probe and homologous
Recombinase；Double chain DNA probe has biotin labeling；Homologous recombination enzyme is used in conjunction with the single stranded DNA of sample to be tested, and is promoted
Double chain DNA probe is in conjunction with the homology single stranded DNA in sample to be tested；It, will be using the biotin labeling in double chain DNA probe
Homology single stranded DNA under homologous recombination enzyme effect in conjunction with double chain DNA probe is separated, is enriched with, and plays the effect of target dna enrichment
Fruit.
On the basis of an object of the application DNA enrichment kit, the application further provides a kind of target dna enrichment
Method comprising following steps: protein nucleic acid compound preparation step, including by the single-stranded of homologous recombination enzyme and sample to be tested
DNA is assembled into stable protein nucleic acid compound；Homologous recombination step, including using with biotin labeling and target
There is DNA the double chain DNA probe of homology to react with protein nucleic acid compound, and under the action of homologous recombination enzyme, double-stranded DNA is visited
Needle is in conjunction with single-stranded target dna；Biotin labeling separating step will including the use of the biotin labeling in double chain DNA probe
Homology single-stranded target DNA in combination is separated, is enriched with.
The above target dna enrichment method be in the case where having prepared double chain DNA probe, target dna enrichment
Method.But for the sample to be tested completely new for one, an object of the application DNA enrichment kit or method, key is all
It is the design of double chain DNA probe.Therefore, the application is designed into target dna enrichment from double chain DNA probe, then to it is final build library,
The whole flow process of sequencing, as shown in Figure 1, including production double-chain probe step 11, pretreatment determined nucleic acid step 12, compound group
Fill the techniques such as step 13, concentration and separation step 14, the building library NGS step 15, sequencing and data analysis step 16.
Wherein, double-chain probe step 11 is made, the designed target dna probe made of the application is double-stranded DNA.Specific system
Make method and size can be according to the regional characteristics flexible design to be enriched with.If not other around the region to be enriched with
The region for wanting enrichment then only can carry out the product amplification of 50-100bp or so in this region design primer, and amplified production is i.e. double
Ssdna probe.It, then can be with if the region clustering to be enriched with is in a bigger region, or to be enriched with whole gene
Long segment amplification is carried out, each amplification region can be up to 20kb；In the side by pcr amplification product using ultrasonication or digestion
Formula is broken into the small fragment of 50bp-100bp, i.e. acquisition double chain DNA probe.The double chain DNA probe of this example, when production, need to use portion
Point or whole biotin biotin modification base, i.e., base is some or all of in used dNTPs during PCR
Biotin labeling.
Determined nucleic acid step 12 is pre-processed, the DNA of sample to be tested can be long or short, single-stranded or double-strand DNA.
It such as can be the fragmentation DNA in various sources, or single-stranded short segment DNA after treatment with heavy sulfites.Anyway, this Shen
In target dna enrichment method please, participate in reaction need be 50-100nt single stranded DNA；Therefore, for conventional genome
For DNA, need to pre-process the nucleic acid of sample to be tested, such as interrupt processing or denaturation treatment etc..
Compound assembling steps 13 refer to using homologous recombination enzyme, such as RecA or Rad51, by the single-stranded of sample to be tested
DNA fragmentation is assembled into stable protein nucleic acid compound in the group installed reagents of homologous recombination enzyme, the protein nucleic acid compound
That is the compound of Single-stranded DNA fragments and the assembling of homologous recombination enzyme.
Concentration and separation step 14, including the double chain DNA probe prepared to be added in protein nucleic acid compound, such as Fig. 2
Shown, under the action of homologous recombination enzyme, single-stranded target nucleic acid in protein nucleic acid compound, i.e. target dna can be identified and be tied
It closes on the double chain DNA probe of homology therewith；Then affine using strepto- by the biotin labeling on double chain DNA probe
The coated magnetic bead of element, double chain DNA probe is separated, and at the same time by single-stranded target DNA separation in combination, elution, is played
The effect of target dna enrichment；Finally, come out single-stranded target DNA from protein nucleic acid complex dissociation using system of solutions installed reagents,
Obtain the single-stranded target DNA of enrichment.
The application de-assembly separation product, i.e., the product to get off from protein nucleic acid complex dissociation are single stranded DNAs.It uses
Conventional single-stranded library constructing method carries out NGS library construction, i.e. the building library NGS step 15, and library is finally carried out upper machine
It is sequenced and data is analyzed, is i.e. sequencing and data analysis step 16.
The application is described in further detail below by specific embodiment.Following embodiment only to the application carry out into
One step explanation, should not be construed as the limitation to the application.
Embodiment one
This example is designed and is prepared for using the region EGFR T790M in human genome as target dna, for the target dna
Double chain DNA probe, and homologous recombination enzyme RecA is used, target dna is enriched with, as follows in detail:
1. target area design of primers
This example devises specificity amplification primer Probe-EG-F and Probe-EG-R for the region EGFR T790M, expands
The segment that volume increase object is the 113bp including target fragments.Probe-EG-F is sequence shown in Seq ID No.1, Probe-
EG-R is sequence shown in Seq ID No.2, and amplified production is sequence shown in Seq IDNo.3.
Seq ID No.1:5 '-GGACAACCCCCACGTGTGCCGC-3 '
Seq ID No.2:5 '-CTTTGTGTTCCCGGACATAGTCCA-3 '
Seq ID No.3:
5’-GGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCACGC
AGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAG-3’
2. making the double chain DNA probe of target area
Human source gene group DNA is expanded using the specific primer of design, double chain DNA probe is obtained, specifically, 50
The PCR reaction system of μ L include: human source gene group DNA 50ng, 1 μ L of Takara rTaq archaeal dna polymerase, 10 ×
5 μ L of rTaqbuffer, 10 μM of 1 μ L of Probe-EG-F, 10 μM of Probe-EG-R1 μ L, dCTP/dGTP/dTTP (2.5mM
Each) the Biotin label 1 μ L of dATP of 3 μ L, 2.5mM, supplement deionized water to 50 μ L.
PCR reaction condition is 98 DEG C of initial denaturation 2min, is recycled subsequently into 30: 98 DEG C of denaturation 30s, 60 DEG C of annealing
30s, 72 DEG C of extension 1min, after circulation terminates, 72 DEG C of extension 5min, 4 DEG C of preservations.
5 μ L are taken to carry out 2% agarose gel electrophoresis identification PCR product.The results show that PCR amplification obtains about 113bp
Target fragments.
PCR product is purified using QIAquick PCR Purification Kit (50) (28104), is finally washed
The de- double chain DNA probe for obtaining 30 μ L.
3. sample to be tested is handled
Source of people peripheral blood 2mL is taken, leucocyte genomic DNA is extracted and is used as to enrichment DNA.Extracting genome DNA uses
DNeasy Blood&Tissue Kits (QIagen Cat No./ID:69504), concrete operation step is detailed in kit explanation
Book.
The genomic DNA of extraction is interrupted using ultrasound to 100bp or so, and it is pure using 1.8 × Ampure XPbeads
Change, and carry out qubit and quantify, quantitative result is 125.8ng/ μ L.
4. protein nucleic acid compound assembles
1 μ g is taken to wait for rich segment DNA, 98 DEG C of denaturation 2min, are placed in 2min on ice immediately after in PCR instrument, obtain
Single stranded DNA.
Protein nucleic acid compound assembles reaction system are as follows: 1 μ g of single stranded DNA to be detected, RecA albumen (NEBM0249S) 2.5
μ L, assembling 5 μ L of buffer, supplement deionized water to 20 μ L.
Wherein, group installed reagents of the assembling buffer, that is, homologous recombination enzyme with single stranded DNA ining conjunction with, wherein contain RecA albumen with
Ingredient necessary to nucleic acid assembles, including ATP or ATP analog 5mM, 70mMTris-HCI (pH7.6), 10mM MgCl2With
5mM DTT。
Brief centrifugation after mixing, 37 DEG C of reaction 15min in PCR instrument.
5. enrichment and separation
5 μ g of double chain DNA probe is added into the protein nucleic acid compound of 20 μ L assembling product, is enriched with buffer 5 being added
μ L, supplement deionized water are mended to 50 μ L.
Wherein, the examination that enrichment buffer, that is, homologous recombination enzyme identifies and promotes single stranded DNA in conjunction with the double-stranded DNA of homology
Agent, wherein including 70mM Tris-HCI (pH7.6), 10mM MgCl2With 5mM DTT.
Brief centrifugation after mixing, 37 DEG C of reaction 20min in PCR instrument.
DynabeadsTMMyOneTMStreptavidin T1beads (65602) takes 20 μ L, washes twice afterwards with 50 μ
Lbinding buffer is resuspended.It is mixed with sample above, is placed at room temperature for 15min.
Upper magnetic frame is inhaled and abandons supernatant.It is rinsed 3 times using enrichment buffer, each 5min.Beads is resuspended with water, room temperature is put
Set 5min.PK (in QIAGEN kit), the 50 DEG C of warm bath 10min of 2 μ L are added, then 99 DEG C of 4min.Upper magnetic frame removal
beads.Supernatant is recovered in new pipe.
6. library construction
Enriched product is Single-stranded DNA fragments, therefore, uses ACCEL-1S PLUS DNALIBRARYKIT
(SWIFT Biosciences Cat.Nos 10024) carries out Illumina microarray dataset library construction, and library construction is detailed in examination
Agent box explanation.
Final library takes 5 μ L to carry out 2% agarose gel electrophoresis detection, as a result as shown in Figure 3.In Fig. 3, the first swimming lane is
DNAmarker, the second swimming lane are the library of building；Fig. 3's at about 300bp the results show that have target fragments, with expected phase
Symbol.It should be noted that, although target DNA fragments are the length of 100bp or so, but pass through library construction, the first-class place of adjunction
Reason, final library construction product should have target fragments in about 300bp or so.
7. sequencing
The sequencing library of this example building is detected using quantitative fluorescent PCR Quality Control, is used the results show that it meets subsequent sequencing
Demand.Therefore, this example further uses Illumina company NextSeq500 microarray dataset to carry out the sequencing of 75bp both-end.
By machine data under high-flux sequence after Quality Control is filtered, BWA comparison is carried out, for assessing the specificity in library,
The results are shown in Table 1 for analysis.
1 sequencing data of table analyzes result
Table 1 the results show that being enriched with using the double chain DNA probe of this example after, have in the valid data that are sequenced
16.13% reads is the data of target area EGFR T790M, shared in people's full-length genome considerably beyond the region
Ratio；The experimental result illustrates that the double chain DNA probe of this example and target dna enrichment method based on the double chain DNA probe can
It is very effective that target area is enriched with.
Embodiment two
This example is directed to five targets using five sections of regions of BRCA1 gene in human genome as target dna respectively
DNA has designed and prepared 5 groups of double chain DNA probes, then visits 5 groups of double chain DNA probe mixed in equal amounts as mixing double-stranded DNA
Needle is enriched with five target dnas using homologous recombination enzyme RecA, as follows in detail:
1. target area design of primers
This example has separately designed 5 pairs of specificity amplification primers pair for five sections of regions of gene BRCA1, needed for capable of covering
The target area to be enriched with.5 pairs of specificity amplification primers to be respectively as follows: Probe-BRCA1-1F/R, Probe-BRCA1-2F/R,
Probe-BRCA1-3F/R, Probe-BRCA1-4F/R, Probe-BRCA1-5F/R, 5 pairs of specificity amplification primers pair up and down
Swimming primer is sequentially sequence shown in Seq ID No.4 to 13.
Probe-BRCA1-1F:Seq ID No.4:5 '-TAAAGTTCATTGGAACAGAAAG-3 '
Probe-BRCA1-1R:Seq ID No.5:5 '-CTTACCAGATGGGACACTCTAAG-3 '
Probe-BRCA1-2F:Seq ID No.6:5 '-CCCTACCCTGCTAGTCTGGAGTTG-3 '
Probe-BRCA1-2R:Seq ID No.7:5 '-AATGGAGCCACATAACACATTCAA-3 '
Probe-BRCA1-3F:Seq ID No.8:5 '-TCTTTATAATTTATAGATTTTGCAT-3 '
Probe-BRCA1-3R:Seq ID No.9:5 '-GCATCATTACCAAATTATATAC-3 '
Probe-BRCA1-4F:Seq ID No.10:5 '-TTCTCAAACAATTTAATTTCAG-3 '
Probe-BRCA1-4R:Seq ID No.11:5 '-TTCTTGGGATATTCAACACTTAC-3 '
Probe-BRCA1-5F:Seq ID No.12:5 '-TATTTTACAGATGCAAACAGCTA-3 '
Probe-BRCA1-5R:Seq ID No.13:5 '-GTTTTACCAAGGAAGGATTTTCGG-3 '
2. making target area double chain DNA probe
5 pairs of specificity amplification primers are respectively adopted to progress PCR amplification, the reaction system of each PCR amplification are as follows: people in this example
Source genomic DNA 50ng, 1 μ L of Takara rTaq archaeal dna polymerase, 10 × rTaqbuffer5 μ L, 10 μM of 1 μ L of forward primer,
10 μM of 1 μ L of reverse primer, 3 μ L of dCTP/dGTP/dTTP (2.5mMeach), 2.5mM Biotin mark 1 μ L of dATP, supplement
Deionized water is to 50 μ L.
PCR reaction condition is 98 DEG C of initial denaturation 2min, is recycled subsequently into 30: 98 DEG C of denaturation 30s, 60 DEG C of annealing
30s, 72 DEG C of extension 1min, after circulation terminates, 72 DEG C of extension 5min, 4 DEG C of preservations.
PCR after reaction, takes the PCR product of 5 μ L to carry out 2% agarose gel electrophoresis identification.The results show that 5 couples of spies
Specific amplification primers meet expected target fragments to all amplifying respectively.
5 PCR products use QIAquick PCR Purification Kit (50) (28104) to be purified respectively, wash
The de- product for obtaining 30 μ L.By the purified product mixed in equal amounts of 5 PCR amplifications, that is, obtain the double chain DNA probe of this example.
3. sample to be tested is handled
The genomic DNA prepared using embodiment one, the genomic DNA of extraction is interrupted using ultrasound to 100bp or so,
And purified using 1.8 × Ampure XP beads, and carry out qubit and quantify, quantitative result is 102.9ng/ μ L.
4. protein nucleic acid compound assembles
1 μ g is taken to wait for rich segment DNA, 98 DEG C of denaturation 2min, are placed in 2min on ice immediately after in PCR instrument, obtain
Single stranded DNA.
Protein nucleic acid compound assembles reaction system are as follows: 1 μ g of single stranded DNA to be detected, RecA albumen (NEBM0249S) 2.5
μ L, assembling 5 μ L of buffer, supplement deionized water to 20 μ L.
Wherein, assembling buffer is the same as example 1.
Brief centrifugation after mixing, 37 DEG C of 15min in PCR instrument.
5. enrichment and separation
5 μ g of double chain DNA probe is added into the protein nucleic acid compound of 20 μ L assembling product, is enriched with buffer 5 being added
μ L, supplement deionized water are mended to 50 μ L.
Wherein, enrichment buffer is the same as example 1.
Brief centrifugation after mixing, 37 DEG C of reaction 20min in PCR instrument.
DynabeadsTMMyOneTMStreptavidin T1beads (65602) takes 20 μ L, washes twice afterwards with 50 μ
Lbinding buffer is resuspended.It is mixed with sample above, is placed at room temperature for 15min.
Upper magnetic frame is inhaled and abandons supernatant.It is rinsed 3 times using enrichment buffer, each 5min.Beads is resuspended with water, room temperature is put
Set 5min.PK (in QIAGEN kit), the 50 DEG C of warm bath 10min of 2 μ L are added, then 99 DEG C of 4min.Upper magnetic frame removal
beads.Supernatant is recovered in new pipe.
6. library construction
Enriched product is Single-stranded DNA fragments, therefore, uses ACCEL-1S PLUS DNALIBRARYKIT
(SWIFT Biosciences Cat.Nos 10024) carries out Illumina microarray dataset library construction, and library construction is detailed in examination
Agent box explanation.
Final library takes 5 μ L to carry out 2% agarose gel electrophoresis detection, as a result as shown in Figure 4.In Fig. 4, the first swimming lane is
DNAmarker, the second swimming lane are the library of building；Fig. 4's at about 300bp the results show that have target fragments, with expected phase
Symbol.
7. sequencing
The sequencing library of this example building is detected using quantitative fluorescent PCR Quality Control, is used the results show that it meets subsequent sequencing
Demand.Therefore, this example further uses Illumina company NextSeq500 microarray dataset to carry out the sequencing of 75bp both-end.
By machine data under high-flux sequence after Quality Control is filtered, BWA comparison is carried out, for assessing the specificity in library,
The results are shown in Table 2 for analysis.
2 sequencing data of table analyzes result
Table 2 the results show that being enriched with using the mixing double chain DNA probe of this example after, the valid data that are sequenced
In have 25.73% reads be the five sections of regions target area BRCA1 data, considerably beyond the region in people's full-length genome
In shared ratio；The mixing double chain DNA probe and the target based on the mixing double chain DNA probe that the experimental result illustrates this example
DNA enrichment method very effective can be enriched with multiple target areas.
The foregoing is a further detailed description of the present application in conjunction with specific implementation manners, and it cannot be said that this Shen
Specific implementation please is only limited to these instructions.For those of ordinary skill in the art to which this application belongs, it is not taking off
Under the premise of from the application design, a number of simple deductions or replacements can also be made.
SEQUENCE LISTING
<110>people and scientific and technological (Changsha) Co., Ltd of future biological
<120>a kind of kit for target dna enrichment, preparation method and application
<130> 18I27611
<160> 13
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213>artificial sequence
<400> 1
ggacaacccc cacgtgtgcc gc 22
<210> 2
<211> 24
<212> DNA
<213>artificial sequence
<400> 2
ctttgtgttc ccggacatag tcca 24
<210> 3
<211> 113
<212> DNA
<213>artificial sequence
<400> 3
ggacaacccc cacgtgtgcc gcctgctggg catctgcctc acctccaccg tgcagctcat 60
cacgcagctc atgcccttcg gctgcctcct ggactatgtc cgggaacaca aag 113
<210> 4
<211> 22
<212> DNA
<213>artificial sequence
<400> 4
taaagttcat tggaacagaa ag 22
<210> 5
<211> 23
<212> DNA
<213>artificial sequence
<400> 5
cttaccagat gggacactct aag 23
<210> 6
<211> 24
<212> DNA
<213>artificial sequence
<400> 6
ccctaccctg ctagtctgga gttg 24
<210> 7
<211> 24
<212> DNA
<213>artificial sequence
<400> 7
aatggagcca cataacacat tcaa 24
<210> 8
<211> 25
<212> DNA
<213>artificial sequence
<400> 8
tctttataat ttatagattt tgcat 25
<210> 9
<211> 22
<212> DNA
<213>artificial sequence
<400> 9
gcatcattac caaattatat ac 22
<210> 10
<211> 22
<212> DNA
<213>artificial sequence
<400> 10
ttctcaaaca atttaatttc ag 22
<210> 11
<211> 23
<212> DNA
<213>artificial sequence
<400> 11
ttcttgggat attcaacact tac 23
<210> 12
<211> 23
<212> DNA
<213>artificial sequence
<400> 12
tattttacag atgcaaacag cta 23
<210> 13
<211> 24
<212> DNA
<213>artificial sequence
<400> 13
gttttaccaa ggaaggattt tcgg 24
Claims (10)
1. a kind of kit for target dna enrichment, it is characterised in that: including double chain DNA probe and homologous recombination enzyme；
The double chain DNA probe has biotin labeling；
The homologous recombination enzyme is used in conjunction with the single stranded DNA of sample to be tested, and promotes the double chain DNA probe and sample to be tested
In homology single stranded DNA combine；
Using the biotin labeling in the double chain DNA probe, by under homologous recombination enzyme effect in conjunction with double chain DNA probe
The separation of homology single stranded DNA, enrichment, play the effect of target dna enrichment.
2. kit according to claim 1, it is characterised in that: the length of the double chain DNA probe is 50bp-100bp.
3. kit according to claim 1, it is characterised in that: the homologous recombination enzyme be RecA, RecBCD, RecF,
At least one of RecO, RecR, Rad51 and Mre11-Rad50；
Preferably, homologous recombination enzyme is RecA or Rad51.
4. kit according to claim 1-3, it is characterised in that: further include the magnetic bead of Avidin modification, institute
Magnetic bead is stated for separating the double chain DNA probe with biotin labeling；
It preferably, further include homologous recombination enzyme group installed reagents and/or homologous recombination enzymatic hydrolysis group installed reagents.
5. the application of double chain DNA fragment and homologous recombination enzyme with biotin labeling as DNA enrichment reagents.
6. a kind of preparation method of the double chain DNA probe for target dna enrichment, it is characterised in that: including using amplimer
PCR amplification is carried out to the DNA of sample to be tested, also, during PCR amplification, dATP, dGTP, dCTP and dTTP of use
At least one of have biotin labeling；Pcr amplification product, that is, double chain DNA probe；
The amplimer is capable of all or part of sequence of the target dna of the amplification sample to be tested of specificity.
7. preparation method according to claim 6, it is characterised in that: it further include carrying out interrupting processing to pcr amplification product,
Obtain the double chain DNA probe that length is 50bp-100bp.
8. preparation method according to claim 7, it is characterised in that: further include to pcr amplification product or interrupting processing
Product is purified, and double chain DNA probe is obtained.
9. according to the double chain DNA probe of the described in any item preparation method preparations of claim 6-8.
10. kit according to claim 1-5 or double chain DNA probe as claimed in claim 9 are in target dna
Sequencing or library construction in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811584853.9A CN109355355A (en) | 2018-12-24 | 2018-12-24 | It is a kind of for target dna enrichment kit, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811584853.9A CN109355355A (en) | 2018-12-24 | 2018-12-24 | It is a kind of for target dna enrichment kit, preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109355355A true CN109355355A (en) | 2019-02-19 |
Family
ID=65329289
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811584853.9A Pending CN109355355A (en) | 2018-12-24 | 2018-12-24 | It is a kind of for target dna enrichment kit, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109355355A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH11151100A (en) * | 1997-11-19 | 1999-06-08 | Aisin Cosmos Kenkyusho:Kk | Detection of nucleic acid by probe |
-
2018
- 2018-12-24 CN CN201811584853.9A patent/CN109355355A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH11151100A (en) * | 1997-11-19 | 1999-06-08 | Aisin Cosmos Kenkyusho:Kk | Detection of nucleic acid by probe |
Non-Patent Citations (3)
| Title |
|---|
| FANG GANG 等: "RecA-mediated Triple-stranded DNA Structure Formed by 100bp dsDNA and Extracted by Affinity Capture", 《中国生物工程杂志》 * |
| KABOEV，O.等: "Improved RecA-assisted fluorescence assay for DNA strand exchange reaction", 《BIOTECHNIQUES》 * |
| 宋建明等: "用PCR 技术标记双链DNA 探针", 《西安医科大学学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107190329B (en) | Fusion based on DNA is quantitatively sequenced and builds library, detection method and its application | |
| JP6722179B2 (en) | Universal blocking oligo system for multiple capture reactions and improved hybridization capture method | |
| EP3329010B1 (en) | Nucleic acids and methods for detecting chromosomal abnormalities | |
| CN105238859B (en) | A kind of method for obtaining chicken full-length genome high density SNP marker site | |
| CN105368930B (en) | The determination method that enzymes combinations are sequenced in genotyping technique is sequenced | |
| CN108998508B (en) | Construction method of amplicon sequencing library, primer group and kit | |
| CN108753954B (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| CN110218781B (en) | Composite amplification system of 21 micro haplotype sites, next generation sequencing and typing kit and typing method | |
| CN109486923B (en) | Primer system for sequencing multiple amplicons, application thereof and method for constructing sequencing library | |
| US11155862B2 (en) | Method for rapidly constructing amplicon library through one-step process | |
| WO2014164838A1 (en) | Quantification of cell-specific nucleic acid markers having a particular methylation state | |
| CN110004225B (en) | Tumor chemotherapeutic drug individualized gene detection kit, primers and method | |
| CN105936940B (en) | Nucleic acid sequence for detecting deafness gene and application thereof | |
| CN106757379A (en) | Lung cancer polygenic variation library constructing method | |
| CN114958997A (en) | Method for detecting chaperone gene | |
| CN106834286B (en) | Primer combination for one-step method rapid construction of amplicon library | |
| CN109097467A (en) | Based on the breast cancer parting detecting reagent of illumina platform and application | |
| WO2015196752A1 (en) | A method and a kit for quickly constructing a plasma dna sequencing library | |
| CN102943107A (en) | Method of analyzing target nucleic acid of biological samples | |
| CN112592981B (en) | Primer group, kit and method for DNA archive construction | |
| CN106282361B (en) | Gene capturing kit for capturing genes related to blood diseases | |
| CN108588200A (en) | A kind of R-Loop high-throughput sequencing libraries construction method | |
| CN102559856B (en) | Method for deleting vector segments in sequencing library | |
| CN109355355A (en) | It is a kind of for target dna enrichment kit, preparation method and application | |
| CN109355288A (en) | A kind of methods and applications of target dna enrichment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190219 |
|
| RJ01 | Rejection of invention patent application after publication |