CN108588200A - A kind of R-Loop high-throughput sequencing libraries construction method - Google Patents
A kind of R-Loop high-throughput sequencing libraries construction method Download PDFInfo
- Publication number
- CN108588200A CN108588200A CN201810423700.XA CN201810423700A CN108588200A CN 108588200 A CN108588200 A CN 108588200A CN 201810423700 A CN201810423700 A CN 201810423700A CN 108588200 A CN108588200 A CN 108588200A
- Authority
- CN
- China
- Prior art keywords
- library
- throughput sequencing
- construction method
- magnetic bead
- carries out
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Abstract
The invention belongs to biotechnologies, and in particular to a kind of R Loop high-throughput sequencing library construction methods.The DNA/RNA heterozygosis chains co-immunoprecipitation and high throughput sequencing technologies in library are built by single stranded DNA, specific DNA/RNA heterozygosis chains in genome can be captured and are enriched with and carry out library construction, with accurate, efficient, sensitive, reproducible, simple operation and other advantages.
Description
Technical field
The invention belongs to biotechnologies, and in particular to a kind of R-Loop high-throughput sequencing libraries construction method.
Background technology
R-loop refers to the complementary strand pairing worked as in a RNA molecule and its double chain DNA molecule, while will be another
DNA chain excludes and the cyclic structure that is formed.R-loop is a kind of special three chain nucleic acid structure, by a RNA/DNA heterozygosis
Chain and a single stranded DNA are formed.More and more evidences find this unique chromatin Structure in protokaryon and eukaryon at present
Generally existing in biology, plays critical function in many crucial biological processes, including chromatin modification, transcriptional control,
DNA damage reparation and Genome stability etc..
Find the R-loop structures being stabilized in a variety of organisms in recent years, and more and more research shows that R-
The accumulation of loop is related with many human diseases, such as neurodegenerative disease, amplification oligonucleotide disease and cancer etc..R-loop
Removing adjusted by many factors, wherein ribalgilase RNase H can specifically remove the RNA in DNA/RNA heterozygosis chains,
It is one of the Main Factors for removing R-loop structures.
Existing R-Loop full-length genomes detection method is there are serious technological deficiency, and the quality of data is bad, to result
Generate very important influence.
Invention content
In view of the problems of the existing technology, the present invention provides a kind of R-Loop high-throughput sequencing libraries construction method, leads to
Cross DNA/RNA heterozygosis chains co-immunoprecipitation and high throughput sequencing technologies that single stranded DNA builds library, can specificity in genome
DNA/RNA heterozygosis chains are captured and are enriched with and carried out library construction, have accurate, efficiently, sensitive, reproducible, operation letter
The advantages that single.
The R-Loop high-throughput sequencing library construction methods of the present invention, follow the steps below：
(1) extraction genomic DNA carries out fragmentation processing to it；
(2) magnetic bead is added afterwards in step (1) and carries out fragmentation products purifying；
(3) capture magnetic bead, specific capture dna-RNA heterozygosis chains are added afterwards in step (2)；
(4) magnetic bead is added afterwards in step (3) and carries out capture product purification；
(5) 1 reaction system of enzyme is added afterwards in step (4), carries out end reparation；
(6) 2 reaction system of enzyme is added afterwards in step (5), carries out connector connection reaction；
(7) magnetic bead is added afterwards in step (6) and carries out connector connection product purifying；
(8) PCR amplification system is added afterwards in step (7), carries out the amplification in library；
(9) magnetic bead is added afterwards in step (8) to purify the library after amplification, product after purification is upper machine text
Library.
Wherein the fragmentation uses Physical or enzyme process, and the Genome DNA content of extraction is at least 50ng, by gene
Group DNA is broken into 200-500bp.
The capture magnetic bead includes three parts, is [S9.6] Antibody, Protein A and special sex modification respectively
Magnetic bead, the wherein group of the special sex modification of magnetic bead surfaces can combine closely with Protein A.
1 system of enzyme includes T4PNK, T4DNA Polymerase, dNTP and T4DNA ligase Buffer, end
It is 37 DEG C to hold repairing condition, 72 DEG C after 30min, 20min.
2 reaction system of enzyme includes T4DNA ligase, T4DNA ligase Buffer, PEG6000 and RNA
Adapter, it is 20 DEG C that connector, which connects reaction condition, 15min；65 DEG C, 10min；The connector includes Universal Adapter
It is P5 end connectors, including P5 binding sequences and Read1 reading sequences with RNA Adapter, wherein Universal Adapter
Row, RNA Adapter are P7 end connectors, including P7 binding sequences, and Index sequences and Read2 read sequence.
The amplification system includes buffer solution, archaeal dna polymerase, dNTPs and a pair of of upstream and downstream primer, sense primer
P5, is library P5 end connector specific primer sequences, and downstream primer P7 is library P7 end connector specific primer sequences.
The library size is 400-500bp.
The upper machine library be suitable for Roche, Illumina, ThermoFisher, Pacific Biosciences,
Hua Da gene, Oxford Nanopore Technologies, Hua Yinkang, big desert gene high-flux sequence platform.
Compared with prior art, the features of the present invention and advantageous effect are：
The present invention provides a kind of R-Loop library constructing methods, and during building library, each reagent component is reacted in control
Dosage and reaction temperature and time, using special Enzyme 1 and Buffer 1, the formula of Enzyme 2 and Buffer 2,
And the base sequence of each primer is designed, including Universal Adapter, RNA Adapter, P5 and P7.
The Library Quality higher of R-Loop library constructing methods structure of the present invention, data more preferably, are adapted to different species
With a variety of sample types, there are accurate, efficiently, sensitive, reproducible, simple operation and other advantages, be advantageously implemented automation behaviour
Make and extensive library concentrates structure, the banking process provided to can be used for different types of microarray dataset, applicability is wide, easily
In popularization.
Description of the drawings
Fig. 1 is the schematic diagram for establishing R-Loop high-throughput sequencing libraries of the present invention；
Fig. 2 is the flow chart for establishing R-Loop high-throughput sequencing libraries of the present invention；
Fig. 3 is 2% agarose gel electrophoresis detection library figure；
Wherein：M:100bp DNA ladder (precious bioengineering (Dalian) Co., Ltd)；1:The libraries R-loop.
Specific implementation mode
Now by taking Illumina platforms as an example, the present invention is further described in conjunction with the embodiments.
Nucleotide sequence involved in the present embodiment is as shown in sequence table.
Embodiment 1：
The method for building R-loop high-throughput sequencing libraries based on single stranded DNA of the present embodiment, follows the steps below：
Universal Adapter nucleic acid sequences are as shown in sequence 1：
5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG
ATCT-3’；
RNA Adapter nucleic acid sequences such as sequence 2 is shown：
5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG-
3'；
P5 nucleic acid sequences such as sequence 3 is shown：5'-AATGATACGGCGACCACCGAGA-3'；
P7 nucleic acid sequences such as sequence 4 is shown：5'-CAAGCAGAAGACGGCATACGA-3'.
(1) extraction patient with breast cancer's canceration tissue gene group DNA carries out fragmentation processing；
Patient's cancerous issue genome is carried out according to blood/tissue/cellular genome extracts kit extraction step
Extract (Tiangeng, article No.：DP304)；Fragmentation processing is carried out to the genome of extraction, interrupts 200-500bp；
(2) magnetic bead is added afterwards in step (1) and carries out fragmentation products purifying；
Use NF-H2Fragmentation products are complemented to 50 μ L by O, 90 μ L AMPure XP beads are added, simultaneously room temperature is quiet for mixing
Set 5min.Reaction tube is placed on magnetic frame, stands 3-5min.Supernatant is abandoned, 200 μ L, 80% ethyl alcohol is added to be eluted, repeats 2~3
It is secondary, with 70 μ L NF-H2O is eluted；
(3) capture magnetic bead, specific capture dna-RNA heterozygosis chains are added afterwards in step (2)；
In step (2) eluted product, pretreated [the S9.6]/Protein A magnetic beads of 10 μ L, NF-H is added2O mend to
100 μ L, room temperature mixing 20min.After magnetic, supernatant is removed, is cleaned three times with 1mL 1X Bind/Wash Buffer, 30 μ L NF-
H2O is eluted, 65 DEG C of incubation 15min, after magnetic, shifts supernatant, the DNA-RNA heterozygosis chains as captured；
(4) magnetic bead is added afterwards in step (3) and carries out capture product purification；
Step (3) after reaction, uses NF-H2O complements to 50 μ L by product is captured, and 90 μ L AMPure XP are added
Beads, mixing are simultaneously stored at room temperature 5min.Reaction tube is placed on magnetic frame, stands 3-5min.Supernatant is abandoned, 200 μ L, 80% second is added
Alcohol is eluted, and is repeated 2~3 times, with 30 μ L NF-H2O is eluted；
(5) 1 reaction system of enzyme is added afterwards in step (4), carries out end reparation；
With 1 reaction system of tabulating.Mixing, 37 DEG C of reactions 30min, 72 DEG C of reaction 20min in thermal cycler.After immediately
Carry out next step operation.
Repair reaction system in 1 end of table
| Component | Volume (μ L) |
| Upper step product | 30 |
| Buffer 1 | 7 |
| Enzyme 1 | 2 |
| NF-H2O | 11 |
(6) 2 reaction system of enzyme is added afterwards in step (5), carries out connector connection reaction；
With 2 reaction systems of tabulating.Mixing, 20 DEG C of reactions 15min, 65 DEG C of reaction 10min in thermal cycler.After immediately
Carry out next step operation.
2 connector coupled reaction system of table
| Component | Volume (μ L) |
| Upper step product | 50 |
| RNA Adapter | 2 |
| Buffer 2 | 27 |
| Enzyme 2 | 1 |
(7) magnetic bead is added afterwards in step (6) and carries out connector connection product purifying；
After reaction, 30 μ L AMPure XP beads are added in step (6), and mixing is simultaneously stored at room temperature 5min.Reaction tube
It is placed on magnetic frame, stands 3-5min.Supernatant is abandoned, 200 μ L, 80% ethyl alcohol is added to be eluted, is repeated 2~3 times, with 50 μ L NF-
H2O is eluted, and is and then purified with 1X XP beads, with 23 μ L NF-H2O is eluted；
(8) PCR amplification system is added afterwards in step (7), carries out the amplification in library；
Reaction system is prepared by table 3, amplified library is carried out by following program.
3 PCR reaction systems of table
| Component | Volume (μ L) |
| Upper step product | 23 |
| 2×KAPA HiFi HotStart ReadyMix | 25 |
| P5 | 1 |
| P7 | 1 |
PCR amplification program：
(9) magnetic bead is added afterwards in step (8) to purify the library after amplification, product after purification is upper machine text
Library.
Step (8) complements to 50 μ L by product is captured after reaction, with 10mM Tris-HCl, and 45 μ L AMPure are added
XP beads, mixing are simultaneously stored at room temperature 5min.Reaction tube is placed on magnetic frame, stands 3-5min.Supernatant is abandoned, 200 μ L 80% are added
Ethyl alcohol is eluted, and is repeated 2~3 times, is eluted with 25 μ L DB, and product after purification is upper machine library.
QPCR quality inspections are carried out to upper machine library：
According to KAPA Library Quantifcation Kit (Kapabiosystems, Cat No.KK4854) explanation
Book is operated, and is detected using 480 real-time fluorescence quantitative PCR instrument of Roche Light Cycler, with reference to the standard in kit
Product carry out the absolute quantitation of library concentration.
QPCR quantitative analysis results are as shown in table 4：
4 qPCR testing results of table
| Sample | QPCR concentration (nM) |
| The libraries R-Loop | 112 |
The library of structure reaches confidential and seeks concentration, can be used for machine sequencing.
Upper machine sequencing is carried out to upper machine library：
Library denaturation, dilution and sequencing are carried out according to NextSeq sequenator operating processes, the results are shown in Table 5.
5 sequencing data Quality Control of table
Electrophoresis detection analysis is carried out to upper machine library：The results are shown in Figure 3 for electrophoretic analysis, and library master tape understands and mainly divides
For cloth in 450bp or so, band brightness is bright, consistent with expected results.
Embodiment 2
The method that the present embodiment is sequenced by PCR and a generation captures the RNA in product to [S9.6] and is expanded and be sequenced
And compared with library sequencing result is built, to verify the sequencing result of embodiment 1.
(1) product is captured to [S9.6] in embodiment 1 and carries out I digestion process of DNase；
(2) 2 reads for randomly selecting sequencing result in embodiment 1, are RL1, RL2 successively；
Detailed sequence is as follows：
RL1 sequences are as shown in sequence 5：
5’-GGGCGGCCGAGGGAGAGGGGAGGGGGCGGCCTCACCTGCGCCACTGCGATGCCCGCCGCCGCCGCC
GCCGAGTCATTATCTCGGGCGGAAGCGAGAAGGGCGGCGAGGGAGGGGGTGGAAGCCCGCAGAGACAAGGGTGGGGA
TGGATCGC-3’
RL2 sequences are as shown in sequence 6：
5’-GACGGAGCAGAGACACGGGACGGGGCAGAGACACGGGACGGAGCAGAGACACGGGACGGAGCAGAG
ACACGGGGGACGGAGGAGAGACAGGGGGGACGGAAGAGAGACGCGGGGCGGGGCAGAGACCGGGGACGGAGCAGAGA
CACGGGAC-3’；
(3) according to its nucleic acid sequence, upstream and downstream primer is separately designed, names F-RL1 and R-RL1, F-RL2 and R- successively
RL2；
Detailed sequence is as follows：
F-RL1 is as shown in sequence 7：5’-GCCGCCGAGTCATTATCT-3’
R-RL1 is as shown in sequence 8：5’-ATCCATCCCCACCCTTGT-3’
F-RL2 is as shown in sequence 9：5’-AGACACGGGACGGGGCAGAG-3’
R-RL2 is as shown in sequence 10：5’-GTCTCTGCTCCGTCCCGTGTCT-3’；
(4) RevertAid First Strand cDNA Synthesis Kit (ThermoFisher, goods is respectively adopted
Number：) and AmpliTaq Gold 360DNA Polymerase (Applied Biosystems, article No. K1622：4398892) into
Row cDNA synthesis and PCR reactions.
Generation sequencing is carried out to amplification and is analyzed.
R-Loop builds the comparison of library sequencing result and RNA amplification generation sequencing result.
6 nucleic acid sequence alignment result of table
| Title | RL1 | RL2 |
| Compare logarithm | 100% | 100% |
As a result show that R-Loop builds the corresponding sequences of random 2 reads of library sequencing data and a RNA amplification generation measures
Sequence alignment number equal 100%, thus illustrate the accuracy in the libraries R-Loop that the present invention is built.
The common R-Loop library constructing methods comparison of R-Loop library constructing methods of the present invention and market is as shown in table 7,
7 sequencing data Quality Control of table
| Banking process | Common R-Loop builds library method | R-Loop of the present invention builds library method |
| It uncaps number | 20 | 13 |
| Tube number | 8 | 5 |
| Experimental procedure | 8 | 5 |
| Test the used time (h) | 6.5 | 4.5 |
| Experimental cost | It is high | It is low |
From 7 comparing result of table it is found that R-Loop of the present invention, which builds library method, not only simplifies experimental implementation flow and step, and shorten
Time saves human cost, while also can avoid pollution and sample sample mixing between sample, reduces because Library development flow complexity causes
Faulty operation risk improves the repeatability and accuracy of experimental result.
Claims (8)
1. a kind of R-Loop high-throughput sequencing libraries construction method, it is characterised in that follow the steps below：
(1) extraction genomic DNA carries out fragmentation processing to it；
(2) magnetic bead is added afterwards in step (1) and carries out fragmentation products purifying；
(3) capture magnetic bead, specific capture dna-RNA heterozygosis chains are added afterwards in step (2)；
(4) magnetic bead is added afterwards in step (3) and carries out capture product purification；
(5) 1 reaction system of enzyme is added afterwards in step (4), carries out end reparation；
(6) 2 reaction system of enzyme is added afterwards in step (5), carries out connector connection reaction；
(7) magnetic bead is added afterwards in step (6) and carries out connector connection product purifying；
(8) PCR amplification system is added afterwards in step (7), carries out the amplification in library；
(9) magnetic bead is added afterwards in step (8) to purify the library after amplification, product after purification is upper machine library.
2. a kind of R-Loop high-throughput sequencing libraries construction method according to claim 1, it is characterised in that the piece
Sectionization uses Physical or enzyme process, the Genome DNA content of extraction to be at least 50ng, genomic DNA is broken into 200-
500bp。
3. a kind of R-Loop high-throughput sequencing libraries construction method according to claim 1, it is characterised in that described catches
It includes three parts to obtain magnetic bead, is the magnetic bead of [S9.6] Antibody, Protein A and special sex modification, wherein magnetic bead respectively
The group of surface specific modification can combine closely with Protein A.
4. a kind of R-Loop high-throughput sequencing libraries construction method according to claim 1, it is characterised in that the enzyme 1
System includes T4 PNK, T4 DNA Polymerase, dNTP and T4 DNA ligase Buffer, and end repairing condition is 37
DEG C, 72 DEG C after 30min, 20min.
5. a kind of R-Loop high-throughput sequencing libraries construction method according to claim 1, it is characterised in that the enzyme 2
Reaction system includes T4 DNA ligase, T4 DNA ligase Buffer, PEG6000 and RNA Adapter, connector connection
Reaction condition is 20 DEG C, 15min；65 DEG C, 10min；The connector includes Universal Adapter and RNA Adapter,
Middle Universal Adapter are P5 end connectors, including P5 binding sequences and Read1 read sequence, and RNA Adapter are
P7 end connectors, including P7 binding sequences, Index sequences and Read2 read sequence.
6. a kind of R-Loop high-throughput sequencing libraries construction method according to claim 1, it is characterised in that the expansion
Increasing system includes buffer solution, archaeal dna polymerase, dNTPs and a pair of of upstream and downstream primer, and sense primer P5 is library P5 end connectors
Specific primer sequence, downstream primer P7 are library P7 end connector specific primer sequences.
7. a kind of R-Loop high-throughput sequencing libraries construction method according to claim 1, it is characterised in that the text
Library size is 400-500bp.
8. a kind of R-Loop high-throughput sequencing libraries construction method according to claim 1, it is characterised in that described is upper
Machine library is suitable for Roche, Illumina, ThermoFisher, Pacific Biosciences, Hua Da gene, Oxford
Nanopore Technologies, Hua Yinkang, big desert gene high-flux sequence platform.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810423700.XA CN108588200A (en) | 2018-05-06 | 2018-05-06 | A kind of R-Loop high-throughput sequencing libraries construction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810423700.XA CN108588200A (en) | 2018-05-06 | 2018-05-06 | A kind of R-Loop high-throughput sequencing libraries construction method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108588200A true CN108588200A (en) | 2018-09-28 |
Family
ID=63619976
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810423700.XA Pending CN108588200A (en) | 2018-05-06 | 2018-05-06 | A kind of R-Loop high-throughput sequencing libraries construction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108588200A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112501249A (en) * | 2019-09-16 | 2021-03-16 | 深圳市真迈生物科技有限公司 | Preparation method, sequencing method and kit of RNA library |
| CN113061648A (en) * | 2021-03-24 | 2021-07-02 | 中山大学 | Method for constructing micro sample m6A modification detection library by aid of Tn5 transposase and application of method |
| CN116287124A (en) * | 2023-05-24 | 2023-06-23 | 中国农业科学院农业基因组研究所 | Single-stranded joint pre-connection method, library construction method of high-throughput sequencing library and kit |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040185484A1 (en) * | 2003-01-29 | 2004-09-23 | Costa Gina L. | Method for preparing single-stranded DNA libraries |
| CN102827830A (en) * | 2012-08-14 | 2012-12-19 | 盛司潼 | Method for capturing nucleic acid fragment |
| US20160168593A1 (en) * | 2014-12-15 | 2016-06-16 | Sangamo Biosciences, Inc. | Methods and compositions for enhancing targeted transgene integration |
| CN107385018A (en) * | 2017-06-22 | 2017-11-24 | 哈尔滨博泰生物科技有限公司 | A kind of method and its application of the RNA high-throughput sequencing libraries structure of optimization |
| CN107557450A (en) * | 2017-10-09 | 2018-01-09 | 湖南大地同年生物科技有限公司 | A kind of reagent and method and its application of rapid build high-throughput sequencing library |
-
2018
- 2018-05-06 CN CN201810423700.XA patent/CN108588200A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040185484A1 (en) * | 2003-01-29 | 2004-09-23 | Costa Gina L. | Method for preparing single-stranded DNA libraries |
| US20120238475A1 (en) * | 2003-01-29 | 2012-09-20 | Leamon John H | Methods of Amplifying and Sequencing Nucleic Acids |
| CN102827830A (en) * | 2012-08-14 | 2012-12-19 | 盛司潼 | Method for capturing nucleic acid fragment |
| US20160168593A1 (en) * | 2014-12-15 | 2016-06-16 | Sangamo Biosciences, Inc. | Methods and compositions for enhancing targeted transgene integration |
| CN107385018A (en) * | 2017-06-22 | 2017-11-24 | 哈尔滨博泰生物科技有限公司 | A kind of method and its application of the RNA high-throughput sequencing libraries structure of optimization |
| CN107557450A (en) * | 2017-10-09 | 2018-01-09 | 湖南大地同年生物科技有限公司 | A kind of reagent and method and its application of rapid build high-throughput sequencing library |
Non-Patent Citations (2)
| Title |
|---|
| LIONEL A. SANZ等: "Prevalent, Dynamic, and Conserved R-Loop Structures Associate with Specific Epigenomic Signatures in Mammals", 《MOLECULAR CELL》 * |
| PAUL A. GINNO等: "R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters", 《MOLECULAR CELL》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112501249A (en) * | 2019-09-16 | 2021-03-16 | 深圳市真迈生物科技有限公司 | Preparation method, sequencing method and kit of RNA library |
| CN112501249B (en) * | 2019-09-16 | 2024-01-26 | 深圳市真迈生物科技有限公司 | Preparation method, sequencing method and kit of RNA library |
| CN113061648A (en) * | 2021-03-24 | 2021-07-02 | 中山大学 | Method for constructing micro sample m6A modification detection library by aid of Tn5 transposase and application of method |
| CN116287124A (en) * | 2023-05-24 | 2023-06-23 | 中国农业科学院农业基因组研究所 | Single-stranded joint pre-connection method, library construction method of high-throughput sequencing library and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2704286C2 (en) | Suppressing errors in sequenced dna fragments by using excessive reading with unique molecular indices (umi) | |
| CN107190329B (en) | Fusion based on DNA is quantitatively sequenced and builds library, detection method and its application | |
| KR20190117529A (en) | Method and system for generation and error correction of unique molecular index sets with heterogeneous molecular length | |
| CN107075513A (en) | The oligonucleotides of separation and its purposes in nucleic acid sequencing | |
| CN108998508B (en) | Construction method of amplicon sequencing library, primer group and kit | |
| US20170121765A1 (en) | Primer set for preparation of ngs library and method and kit for making ngs library using the same | |
| EP3885445B1 (en) | Methods of attaching adapters to sample nucleic acids | |
| CN108588200A (en) | A kind of R-Loop high-throughput sequencing libraries construction method | |
| EP3320111B1 (en) | Sample preparation for nucleic acid amplification | |
| CN113463202B (en) | Novel RNA high-throughput sequencing method, primer group and kit and application thereof | |
| WO2018186930A1 (en) | Method and kit for constructing nucleic acid library | |
| CN107699957A (en) | Fusion based on DNA, which is quantitatively sequenced, builds storehouse, detection method and its application | |
| CN102839168A (en) | Nucleic acid probe, and preparation method and application thereof | |
| CN104480214A (en) | Process for sequencing hydroxymethylation and methylation long-sequence tags | |
| CN110603327A (en) | PCR primer pair and application thereof | |
| CN108251503A (en) | A kind of method of rapid build chain specific RNA high-throughput sequencing library | |
| WO2015196752A1 (en) | A method and a kit for quickly constructing a plasma dna sequencing library | |
| JP2020529833A (en) | Modular nucleic acid adapter | |
| WO2018089944A1 (en) | Method and system for fragment assembly and sequence identification | |
| JP2022514010A (en) | Methods, compositions, and systems for improving the recovery of nucleic acid molecules | |
| US11718873B2 (en) | Correcting for deamination-induced sequence errors | |
| CN114736951A (en) | High-throughput sequencing library construction method for small-molecule RNA | |
| CN114746560A (en) | Methods, compositions, and systems for improved binding of methylated polynucleotides | |
| CN113227393A (en) | Methods, compositions, and systems for calibrating epigenetic zoning assays | |
| JPWO2019088069A1 (en) | DNA methylation analysis method using next-generation sequencer and concentration method of specific DNA fragment group |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180928 |