CN109328232A - For generating the method and application thereof of the synthesis chromosome of expression biosynthesis pathway - Google Patents

Abstract

The present invention, which covers, allows people via the synthesis chromosome composition of expressing the more than one gene delivery from biosynthesis pathway into recipient cell and in recipient cell and method.

Description

For generating the method and application thereof of the synthesis chromosome of expression biosynthesis pathway

Cross reference to related applications

This international pct application was required on April 12nd, 2016 U.S. Provisional Patent Application submitted the 62/321,716th Priority.

Statement about governmental support

The present invention is carried out according to the contract D15PC00008 authorized by DARPA in the case where U.S. government supports.U.S. government exists There is certain right in the present invention.

Invention field

The field of the invention, which covers, allows people's engineering to be combined to chromosome will be more than one from biosynthesis pathway A (multiple) gene delivery to recipient cell method.

Background of invention

In the following discussion, certain articles and method will be described for the purpose of background and introduction.What is be contained herein appoints What content is not interpreted as " recognizing " of the prior art.Applicant clearly retain in appropriate circumstances prove it is herein cited Article and method the right of the prior art can not be constituted according to applicable statutory provisions.

Cell generation cell metabolite such as amino acid, core are for example assigned currently used for engineering cell to mix and express The method of the more than one gene of the ability of acid, glycoprotein etc. is depended on based on virus or based on the nucleic acid delivery techniques of plasmid. However, the ability that cell generates such metabolin usually requires to constitute being more than for the biochemical pathway for metabolin synthesis The expression and function layout of one gene product.For example, must needed for many mammalian cells shortage manufacture essential amino acids Need enzyme.In order to allow cell to manufacture these amino acid, it is necessary to be engineered to cell, be found in fungi or bacterium with expression Heterologous gene；However, due to limited payload (payload) ability of virus and plasmid nucleic acid vehicle delivery system, In order to generate complete biochemistry or biosynthesis pathway in recipient cell, need to transfect or Transduction Events it is more than one Iteration.

Generate global function mammal synthesis chromosome ability represent for based on cell genetic disorder correction and The powerful system of the generation of biological pathway.It is more than based on bacterium and based on disease that global function mammal synthesis chromosome, which provides, The fact that maintain outside several advantages of the delivery system of poison, including increased payload size, chromosome avoids potential Host cell destroy, introduce gene Transcriptional Silencing and possible immunology complication avoid and mammal synthesis dye Colour solid can be originated from synthesis chromosome and wait being inserted into species therein and be customized for the species.In the art for Allow people by the more than one gene delivery from biosynthesis pathway into cell and in the composition of cell expression and side There are demands for method.The present invention provides the method and compositions for solving the demand.

Summary of the invention

There is provided the general introduction is the selection in order to introduce concept in simplified form, into one in the detailed description of the concept below Step description.The general introduction had both been not intended to determine the key or essential characteristic of theme claimed, was also not intended for limitation institute The range of claimed theme.Other features, details, effectiveness and the advantage of theme claimed from it is following write it is detailed Stating will be apparent including those of restriction aspect in illustrate in attached drawing and the attached claims.

The present invention covers for will be more than one from one or more biosynthesis pathways via synthesis chromosome The composition and method that gene delivery is expressed into recipient cell and in recipient cell.Access may include that 1) known generation is special Determine those of final product access；2) by mixing existing gene with new combination and/or being expressed in new cell type existing There is gene to generate to the cell type for wherein generating final product can be new specific final product and generate new Access；Or 3) by by new gene individually or with the existing assortment of genes mix to generate new final product and generate New access.

Therefore, in one embodiment, The inventive process provides one kind for constructing biology in recipient cell The method for synthesizing access, which comprises generate component transfection recipients cell line, the synthesis chromosome with synthesis chromosome Generating component includes allowing the nucleic acid sequence of target nucleic acid sequence site-specific integration；Generating has more than one locus specificity The platform chromosome of the synthesis of recombination site；With the delivery vector of the more than one gene comprising can be realized biosynthesis pathway Transfection recipients cell line, wherein the delivery vector includes at least one locus specificity recombination site；Activate the platform of synthesis Locus specificity recombination between chromosome and delivery vector, wherein can be realized the more than one gene quilt of biosynthesis pathway It is loaded into the synthesis chromosome that expression biosynthesis pathway is generated on the platform chromosome of synthesis；And separation includes expression life Object synthesizes the recipient cell of the synthesis chromosome of access.

In some aspects of this embodiment, the more than one gene that can be realized biosynthesis pathway includes that tryptophan is raw Gene necessary to object synthesizes, and in some respects, gene necessary to tryptophan biosynthesis includes saccharomyces cerevisiae Five genes necessary to tryptophan in (Saccharomyces cerevisiae) synthesizes.

In some aspects of this embodiment, in addition to deliver can be realized biosynthesis pathway more than one gene it Outside, delivery vector also includes one or more following genes: a) interfere or block the inhibiting tumour cells immunocyte period into One or more genes of the ability of exhibition, b) encode one or more bases for enhancing the factor of activated immune cell and growth Cause c) increases immunocyte to one or more genes of the specificity of tumour in development.

Again in terms of other of the embodiment, this method is further comprising the steps of: separation expression biosynthesis pathway Synthesize chromosome；And chromosome transfer will be synthesized to Co receptor cell.In some respects, Co receptor cell is selected from general confession Body T cell or autologous patient T cell.Other aspects of the present invention provide synthesis chromosome, and the synthesis chromosomal expression is raw Object synthesizes access, and other aspects provide Co receptor cell again.

In some aspects of the invention, allow site-specific integration nucleic acid sequence include attP, attB, attL and AttP, attB, attL and attR of attR or mutant form.

Other embodiments of the invention are further comprising the steps of: with comprising can be realized the more of the second biosynthesis pathway In the second delivery vector transfection recipients cell line of a gene, wherein second delivery vector includes that at least one site is special Specific recombination sites；The locus specificity recombination between the platform chromosome and the second delivery vector of synthesis is activated, wherein can It is raw to generate expression second to realize that the more than one gene of the second biosynthesis pathway is loaded on the platform chromosome of synthesis The synthesis chromosome of object synthesis access；And the recipient cell of synthesis chromosome of the separation comprising the second biosynthesis pathway of expression Born of the same parents.In some aspects of this embodiment, further comprising the steps of: the synthesis dyeing of separation the second biosynthesis pathway of expression Body；And the synthesis chromosome transfer of the second biosynthesis pathway will be expressed to Co receptor cell.

These and other aspects of the invention and purposes will describe in detailed description.

Brief description

Fig. 1 is the rough schematic view of an embodiment of method of the invention, and wherein stechiology passes through by synthesizing Chromosome generates biosynthesis pathway metabolin to reinforce.

Detailed description of the invention

Unless otherwise instructed, method described herein can be using molecular biology (including recombinant technique), cell biological It learns, routine techniques and the description of biochemistry and cell engineered technology, these are all in the technology of those skilled in the art. Such routine techniques includes the work of oligonucleotide synthesis, oligonucleotide hybridization and connection, cell transformation and transduction, recombination system Cheng Hua, the generation of transgenic animals and plants and human gene therapy.The specific description of suitable technology can pass through ginseng The example for examining this paper obtains.However, equivalent conventional program can also be used certainly.Such routine techniques and description can mark It is found in the handbook of quasi-experiment room, such as Genome Analysis:A Laboratory Manual Series (I-IV volume) (Green et al. writes, 1999)；Genetic Variation:A Laboratory Manual (Weiner et al. writes, 2007)；Sambrook and Russell, Condensed Protocols from Molecular Cloning:A Laboratory Manual(2006)；And Sambrook and Russell, Molecular Cloning:A Laboratory Manual (2002) (all is from Cold Spring Harbor Laboratory Press)；Protein Methods (Bollag et al., John Wiley&Sons 1996)；Nonviral Vectors for Gene Therapy (Wagner etc. People writes, Academic Press 1999)；(Kaplift&Loewy writes Viral Vectors, Academic Press 1995)；Immunology Methods Manual (Lefkovits writes, Academic Press 1997)；Gene Therapy Techniques,Applications and Regulations From Laboratory to Clinic (Meager writes, John Wiley&Sons 1999)；M.Giacca,Gene Therapy(Springer 2010)；Gene (LeDoux writes Therapy Protocols；Springer 2008)；Cell and Tissue Culture: (Doyle&Griffiths writes Laboratory Procedures in Biotechnology；John Wiley&Sons 1998)；Mammalian Chromosome Engineering-Methods and Protocols (G.Hadlaczky writes, Humana Press 2011)；Essential Stem Cell Methods, (Lanza and Klimanskaya write, Academic Press 2011)；Stem Cell Therapies:Opportunities for Ensuring the Quality and Safety of Clinical Offerings:Summary of a Joint Workshop(Board on Health Sciences Policy,National Academies Press 2014)；Essentials of Stem Cell Biology, the third edition, (Lanza and Atala write, Academic Press 2013)；And Handbook of Stem It is whole with its by quoting to be completely used for all purposes for Cells, (Atala and Lanza write, Academic Press 2012) Body is incorporated herein.Before describing composition of the invention, research tool and method, it should be understood that the present invention is not limited to describe Specific method, composition, target and purposes because these can of course change.It is also understood that terms used herein It merely for the purpose of description particular aspects, and is not intended to limit the scope of the invention, the scope of the present invention will be only by appended power Benefit requires limitation.

It should be noted that unless the context clearly indicates otherwise, as used in this specification and appended claims, odd number Form " one (a) ", " one (an) " and " being somebody's turn to do (the) " include plural object.Thus, for example, referring to that " composition " refers to a kind of group The mixture of object or more composition is closed, and refers to that " measurement " includes referring to equivalent steps well known by persons skilled in the art With method, etc..

Unless otherwise defined, all technical and scientific terms used herein have with it is common in fields of the present invention The normally understood identical meaning of technical staff.All publications being mentioned above are incorporated herein by reference, for describe and The open purpose described in the publication and the device used, preparation and method can be associated with invention described herein.

In the case where the range of offer value, it should be understood that between the upper limit and lower limit of the range each between two parties Value as defined in value and any other in the defined range or value is covered in the present invention between two parties.These lesser models The upper and lower bound enclosed can be individually included in lesser range, any specificity row being limited by defined range The limitation removed.In the case where defined range includes upper and lower bound the two, the only one for the limit value that those include is excluded Range is also included in the present invention.

In the following description, many details are illustrated, in order to provide to more thorough understanding of the invention.However, Those of ordinary skill in the art will be apparent that after reading this specification, the present invention can be in none or more It is practiced in the case where these details.In other cases, in order to avoid making ambiguous of the present invention, ability is not described Feature known to field technique personnel and well known program.

Definition

Unless specifically stated, terms used herein are intended to have as will be recognized by those possessing ordinary skill general And common meaning.Intention defined below helps reader to understand the present invention, but is not intended to change or otherwise limits this The meaning of class term, unless specifically indicated.

" in conjunction with " (for example, the nucleic-acid binding domains for referring to polypeptide) refer to non-between polypeptide and nucleic acid as used herein Covalent interaction.When in the state in noncovalent interaction, polypeptide and nucleic acid are considered as " association ", " mutually Effect " or " in conjunction with ".Binding interactions are usually by less than 10^-6M to less than 10^-15The dissociation constant (Kd) of M characterizes." parent And power " referring to bond strength, increased binding affinity is related to lower Kd.

" binding structural domain " means the polypeptide or protein structure domain of being capable of another molecule of Non-covalent binding.Binding structural domain can To combine, for example, DNA molecular (DNA binding protein), RNA molecule (rna binding protein) and/or protein molecular (protein binding egg It is white).

" centromere " is to assign chromosome to separate by cell division to any nucleic acid sequence of the ability of daughter cell.Silk Grain can assign the stabilization point of nucleic acid sequence (including the synthesis chromosome comprising centromere) by mitosis and meiosis From.Centromere not necessarily needs to be originated from species identical with the cell that it is introduced into, but preferably, centromere has in the species Cell in promote DNA separation ability." double centromeres (dicentric) " chromosome is the dyeing comprising two centromeres Body." preceding dicentric chromosome (formerly dicentric chromosome) " is when dicentric chromosome fragmentation When the chromosome that generates." chromosome " be can be replicated in cell in cell division and isolated nucleic acid molecules and association Albumen.In general, chromosome is comprising between centromere region, replication orgin, Telomere regions and centromere region and Telomere regions Nucleic acid region." telocentric chromosome (acrocentric chromosome) " refers to the dyeing of the arm with unequal length Body.

The sequence of " coded sequence " or " coding " peptide is vivo transcription when under the control for being placed in control sequence appropriate (in the case of dna) and the nucleic acid molecules (in the case where mRNA) for polypeptide are translated.The boundary of coded sequence usually by Initiation codon at 5 ' (amino) ends and the translation termination codon at 3 ' (carboxyl) ends determine.

Term DNA " control sequence " collectively refers to promoter sequence, polyadenylation signal, transcription terminator, upstream Control domain, replication orgin, internal ribosome entry site, enhancer etc., they jointly provide the volume in recipient cell The duplication of code sequence, transcription and translation.As long as selection coded sequence can be replicated in host cell appropriate, transcribe and Translation, then the control sequence of not all these types requires to exist.

Term " realizes (effectuating) " that biosynthesis pathway refers to the known biosynthesis pathway of reproduction and generation The new biosynthesis pathway with execution.

" endogenous chromosome " refers to the chromosome found in cell before generating or being introduced into synthesis chromosome.

As used herein, " euchromatin " with referring to disperse (diffusely) dyes and generally comprises the chromatin of gene, And " heterochromatin " refers to that holding is abnormal and agglomerates and be considered as transcribing sluggish chromatin.Highly duplicate DNA sequence dna (satellite DNA) it is usually located at the heterochromatin region around centromere.

Term " allogeneic dna sequence DNA " or " external (foreign) DNA " (or " heterologous RNA " or " foreign rna ") are used interchangeably, And refer to a part of the genome being contained therein not as it natively existing DNA or RNA, or be different from it One position of position present in nature or more position (a location or locations) and/or with difference In its existing amount measured is found in genome or cell in nature DNA or RNA.The example of allogeneic dna sequence DNA includes, but It is not limited to, encodes a kind of interested gene product or more gene product (a gene product or gene Product (s)) DNA.Other examples of allogeneic dna sequence DNA include, but are not limited to encode traceable marker protein DNA and Regulating DNA sequence.

As used herein, term " metabolin " refers to natural metabolites (such as cholesterol), heterologous metabolin (such as Such as the tryptophan in the mankind), (i.e. new artificial metabolin, such as chimeric protein or engineering RNA are dry for engineering metabolin Disturb molecule) or the function for example, by enhancing or inhibiting biosynthesis pathway and assign cell change any other metabolin.

" being operably connected " refers to that the component wherein so described is configured to carry out the element of their usual function Arrangement.Therefore, the control sequence for being operably coupled to coded sequence can influence the expression of the coded sequence.Control sequence is not Must be adjacent with coded sequence, as long as they work to instruct the expression of coded sequence.Thus, for example, between two parties non-turns over It translates but the sequence transcribed can reside between promoter sequence and coded sequence, and promoter sequence is still considered " being operably connected " is to coded sequence.In fact, such sequence does not need to be located at same continuous DNA molecular (i.e. chromosome) On, and still can have the interaction for leading to the regulation changed.

" promoter " or " promoter sequence " is that RNA polymerase in combination cell and can start polynucleotides or polypeptide Coded sequence (such as mRNA, rRNA, kernel small nuclear rna (small nuclear of nucleolar RNA) or By any classification any rna plymerase i, II or III transcribe any kind of RNA) transcription DNA regulatory region.

Recipient cell is to synthesize chromosome, the platform chromosome of synthesis or by Bioengineered comprising given for generating DNA element synthesis platform chromosome the cell that is entered of component.The type of recipient cell can include but is not limited to: Stem cell, mescenchymal stem cell, the stem cell of adult origin, T cell, immunocyte, induced multi-potent (pluripotent) are dry thin Born of the same parents, fibroblast, endothelial cell, the cell of mesoderm, ectoderm and entoderm.It will also include tumor cell culture System, primary cell and reproduction cell.Then cell can for example be cultivated, prepare to be used to transplant, be used to generate and completely turn base Because of animal etc..

" identification sequence " be albumen, DNA or RNA molecule or combinations thereof (such as, but be not limited to, restriction endonuclease, Modification methylase or recombinase) it identifies and the specific nucleotide sequence that combines.For example, the identification sequence of Cre recombinase is packet 34 containing the two 13 base-pair inverted repeats (as recombination enzyme binding site) for being located at 8 base pair core flanks Base-pair sequence and be designated as loxP (see, e.g., Sauer, Current Opinion in Biotechnology, 5: 521-527(1994)).What other examples of identification sequence included, but are not limited to be identified by recombinase bacteriophage X integrase AttB and attP, attR and attL etc..The recombination site for being appointed as attB is to tie comprising two 9 base pair core type Int About 33 base-pair sequences of coincidence point and 7 base-pair overlapping regions；AttP is to include core type Int binding site and arm type Int binding site and site for auxilin IHF, FIS and Xis about 240 base-pair sequences (see, e.g., Landy,Current Opinion in Biotechnology,3:699-7071(1993))。

" recombinase " is the enzyme that catalytic dna section exchanges at specific recombination site.Integrase refer to generally originate from virus or The recombinase of transposons and possible ancient virus." recombinant protein " includes participating in weight using one or more recombination sites The excision albumen (excisive protein) of group reaction, integral protein, enzyme, co-factor and GAP-associated protein GAP (referring to, Landy, Current Opinion in Biotechnology,3:699-707(1993)).Recombinant protein used in context of methods can To be delivered to cell via the expression cassette on carrier plasmid appropriate etc..In other embodiments, recombinant protein can To be delivered to cell with the protein form in the same reaction mixture for delivering expectation nucleic acid.Again in other embodiments In, recombinase can also be encoded in cell and be expressed as needed using the inducible promoter of strict control.

" rRNA " (rRNA) is the special RNA for forming the part of Ribosome Structure and participating in albumen synthesis.Ribosomes RNA is generated by the transcription of gene, and the gene is in eukaryocyte with the presence of more than one copy.In human cell, about 250 RRNA gene (that is, gene of coding rRNA)/haploid genome of a copy is dispersed at least five differences in the form of cluster On chromosome (chromosome 13,14,15,21 and 22).In human cell, the highly conserved rRNA gene of more than one copy In the rDNA cell-in-series of arranged in series, the rDNA cell-in-series normal length of the arranged in series is about 40-45kb, and And include the nontranslated region of transcript regions and referred to as spacer region (that is, intergenic spacer region) DNA, the spacer region is (that is, base Because between spacer region) DNA length and sequence can change.

As used herein, term " may be selected marker (selectable marker) ", which refers to, is introduced into cell, particularly In the context of the present invention, it is introduced into the gene that in the cell in culture, imparting is suitable for the character of artificial selection.Generally The optional marker used is well known within the skill of those ordinarily skilled.In preferred embodiments, for being closed in the mankind It should be non-immunogenic in the mankind at marker may be selected used in chromosome system, and include, but are not limited to: Human nerve growth factor's receptor (is detected, such as U.S. Patent No. 6, described in 365, No. 373) with MAb；The truncated mankind Growth factor receptors (are detected) with MAb；Mutant mankind's dihyrofolate reductase (DHFR；Fluorescence MTX substrate is available)；Secreting type Alkaline phosphatase (SEAP；Fluorogenic substrate is available)；Mankind's thymidylate synthase (TS；Assign the tolerance to anticancer agent fluorodeoxyuridine Property)；Mankind glutathione S-transferase α (GSTA1；By glutathione with stem cell selective alkylating agent (alkylator) is white disappears Peace conjugation；CD34⁺Marker may be selected in chemical protective in cell)；CD24 cell surface antigen in candidate stem cell；It assigns It gives to N- phosphonoacetyl-L-Aspartic acid (N-phosphonacetyl-L-aspartate；PALA the people of tolerance) Class CAD gene；1 (MDR-1 of mankind's multidrug resistance；The P- that may be selected by increased drug tolerance or be enriched with by FACS Glycoprotein surface protein)；Mankind CD25 (IL-2 α；It is detectable by Mab-FITC)；Methyl guanine-dnmt rna (MGMT；It may be selected by Carmustine)；With cytidine deaminase (CD；It may be selected by Ara-C).It can also be optional using drug Select marker such as puromycin, hygromycin, blasticidin, G418, tetracycline.In addition, being sorted using FAC, such as chemiluminescence Marker (such as Halo label) etc. can be used for positive selection equally, and any fluorescent marker gene can be used for positive selection.

" locus specificity recombination " refers between two specific sites on single nucleic acid molecules or in two different moleculars Between the locus specificity recombination for needing foreign protein such as integrase or recombinase to exist and realizing.Certain locus specificities Recombination system can be used for specific deficiency, inversion or insertion DNA, wherein Precise Event by specific position orientation, special Property system and auxilin or the factor presence control.In addition, DNA section can exchange between chromosome, (chromosome arm is handed over It changes).

" synthesis chromosome " (also referred to as " artificial chromosome ") be with adapt to and the ability of expression heterologous gene and In cell together with endogenous chromosome stable duplication and isolated nucleic acid molecules, usually DNA molecular." mammal synthesis dye Colour solid " refers to the chromosome in active mammal centromere." mankind synthesize chromosome " refers to be acted as included in human cell Centromere and the chromosome preferably generated in human cell.For Exemplary artificial's chromosome, see, e.g., U.S. Patent No. 8,389,802；No. 7,521,240；No. 6,025,155；No. 6,077,697；5,891,691st Number；No. 5,869,294；No. 5,721,118；No. 5,712,134；No. 5,695,967；With No. 5,288,625 with And international pct application WO No. 97/40183 and No. WO98/08964 announced.

Term " subject ", " individual " or " patient " can be used interchangeably herein, and refer to mammal, and Refer to the mankind in some embodiments.

" carrier " is the replicon that can be attached another DNA section, and such as plasmid, virus constructs, glues at bacteriophage Grain, bacterial artificial chromosome, the artificial chromosome in the source P-1 or yeast artificial chromosome.In some cases, carrier can be Chromosome, such as from be engineered to include recombination site an endogenous chromosome arm exchange to synthesis chromosome the case where Under.Carrier is used to that DNA section to be transduceed and expressed in cell.

The present invention

The present invention, which covers, allows people by the more than one gene delivery from biosynthesis pathway into cell and thin It is expressed in born of the same parents to generate the composition and method of metabolin.It is more since its big carrying capacity can be carried and be expressed to synthesize chromosome Evade in a gene product-especially from the more than one gene-of one or more biosynthesis pathways The limitation of delivery of nucleic acids based on virus and based on plasmid.The present invention provides allow to generate metabolin (or more than one metabolism Object) to the method and composition of increase and the stechiology of enhancing recipient cell, the synthesis of the metabolin needs biology The expression and function of the coordination of more than one gene in chemical pathway.Access may include 1) known generating specific final product Those accesses；2) by mixing existing gene with new combination and/or expressing existing gene in new cell type to generate To in the new access that the cell type for wherein generating final product can be new specific final product and generate；Or 3) lead to It crosses and new gene individually or with the existing assortment of genes is mixed into the new access generated to generate new final product.Therefore, Method and composition of the invention allows the engineering of cell to synthesize the generation for being not present in cell or synthesizing with sub-optimum level It thanks to object, and is suitable for synthesizing all methods of chromosome generation, including " from top to bottom " method (" top down " Approach), " from bottom to top " method (" bottom up " approach), the engineering of naturally occurring minichromosome with And it is generated (all these all in further detail below by the from the beginning chromosome of the induction of the targeting amplification of specific chromosome segment Ground discussion).

Fig. 1 is that the simplification of method of the invention for an embodiment of functional enhancing cell biological synthesis capability is shown It is intended to.Fig. 1 shows the platform chromosome of the synthesis in cell.Carry the delivery vector quilt of the gene of biosynthesis pathway It is delivered to cell, and on the platform chromosome of the synthesis of the gene " being loaded into " from biosynthesis pathway (hereinafter more in detail It carefully describes).Then, the gene having been loaded on synthesis chromosome is expressed in cell.Then, chromosome is synthesized by coming from Gene transcription and translation expression albumen synergistic effect, with pass through biosynthesis compound (i.e. a series of enzymatic reaction objects) Generate one or more of metabolites.

An example using the platform chromosome of synthesis for the effectiveness of cell function enhancing is by immune system cell Engineering is with synth essential amino acid tryptophan.During tumour growth, tumour cell inputs largely from local tumor environment Tryptophan causes the immunocyte for inhibiting growth of tumour cell hungry and then stagnates, prevent hungry immunocyte is from pressing down Make the tumour cell of growth.Tryptophan is essential amino acid --- that is, amino acid that the mankind are unable to de novo formation --- and is drunk Food intake tryptophan cannot mitigate the tryptophan starvation by tumor cell induction.It is closed however, generating tryptophan biology comprising expression At heterologous gene synthesis chromosome immunocyte have selective advantage, and during interacting with tumour cell or " no tryptophan (tryptophan-less) " death is avoided in tumour cell environment.For example, yeast S. cerevisiae expression synthesis Five genes (TRP1-5) necessary to tryptophan.Each of these genes can be separated and be started by mammal Son (constitutive expression or by regulated promoter expression) control, and it is placed in the bacteria carrier that can carry a large amount of DNA, It is such as engineered to more than one gene delivery or is " loaded " into (as described below) on the platform chromosome of synthesis On bacterial artificial chromosome (Bacterial Artificial Chromosome) (BAC).It then include tryptophan biosynthesis The synthesis chromosome of gene can be subsequently introduced immunocyte (for example, universal donor T cell or autologous patient T cell) In, for the therapy based on immune oncology cell.

Other than assigning to the tolerance of " no tryptophan " death, the big carrying capacity for synthesizing chromosome additionally allows for work Journeyization blocks the gene of the other biological synthesis access of inhibiting tumour cells, and including but not limited to 1) tumour is interfered or blocked in expression Cell inhibits the gene of the ability of immunocyte cycle progression, such as anti-PD-1 (apoptosis albumen 1) or anti-CTLA- 4 (central T cell activation and inhibition 4) molecules；2) enhance the factor of activated immune cell and growth (for example, interleukin 2 Or other such cell factors)；And/or 3) increase engineering immunocyte to the factor of the specificity of tumour in development, example Such as, increase immunocyte to tumor-homing (homing to tumors) or immunocyte in conjunction with specific tumors marker because The increase of son.Therefore, the engineering of tryptophan biochemical pathway and other access and/or the factor is defined for being based on The platform chromosome of the synthesis of the anti-cancer therapies of immunocyte (i.e. " exempt from by immune/oncology (immuno/onc) synthesis chromosome Epidemic disease/oncology SynC ").

Chromosome is synthesized to generate

Synthesis chromosome is generated in the cell of culture.In some embodiments, wait be engineered and/or generate synthesis The cell of chromosome can be naturally present in the cell in subject (human patients, animal or plant), wherein from synthesis The gene or regulating and controlling sequence of chromosome will be finally expressed.Such cell can be for the synthesis dyeing to individual specificity Purpose that body generates and the primary culture cell line established.In other embodiments, wait be engineered and/or generate synthesis The cell of chromosome comes from established cell line.Various kinds of cell system for tissue cultures is as known in the art.Cell The example of system includes but is not limited to Human cell line such as 293-T (embryo kidney), 721 (melanoma), A2780 (ovary), A172 (spongioblastoma), A253 (cancer), A431 (epithelial cell), A549 (cancer), BCP-1 (lymthoma), BEAS-2B (lung), BR 293 (mammary gland), BxPC3 (cancer of pancreas), Cal-27 (tongue), COR-L23 (lung), COV-434 (ovary), CML T1 (leukaemia), DUI45 (prostate), DuCaP (prostate), FM3 (lymph node), H1299 (lung), H69 (lung), HCA2 (fibroblast), HEK0293 (embryo kidney), HeLa (cervix), HL-60 (myeloblast), HMEC (epithelial cell), HT-29 (colon), HUVEC (umbilical vein epithelial cell), Jurkat (T cell leukaemia), JY (lymphoblastoid), K562 (lymphoblastoid), KBM- 7 (lymphoblastoids), Ku812 (lymphoblastoid), KCL22 (lymphoblastoid), KGI (lymphoblastoid), KYO1 (lymphoblastoid), LNCap (prostate), Ma-Mel (melanoma), MCF-7 (mammary gland), MDF-10A (mammary gland), MDA-MB-231, MDA-MB-468 and MDA-MB-435 (mammary gland), MG63 (osteosarcoma), MOR/0.2R (lung), MONO-MAC6 (white blood corpuscle), MRC5 (lung), NCI-H69 (lung), NALM-1 (peripheral blood), NW-145 (melanoma), (forefront OPCN/OPCT Gland), Peer (leukaemia), Raji (B lymthoma), Saos-2 (osteosarcoma), Sf21 (ovary), Sf9 (ovary), (uterus SiHa Neck cancer), SKBR3 (breast cancer), SKOV-2 (oophoroma), T-47D (mammary gland), T84 (lung), U373 (spongioblastoma), U87 (spongioblastoma), U937 (lymthoma), VCaP (prostate), WM39 (skin), WT-49 (lymphoblastoid), YAR (B Cell), embryo cell line, pluripotent cell system, the stem cell of adult origin, reprogrammed cell system, any species or extensive embryo The general animal cell line of tire or reprogrammed cell, autologous patient cell line, also, in some preferred embodiments, it utilizes HT1080 Human cell line.These cell lines and other cell lines can be obtained from a variety of sources well known by persons skilled in the art (see, e.g., American type culture collection (ATCC) (Manassas, Va.)).

The engineering that the synthesis chromosome of more than one gene is expressed in biochemistry or biosynthesis pathway is suitable for The from the beginning chromosome of all " from top to bottom " used in the art, " from bottom to top ", minichromosome engineering and induction is raw At method." from bottom to top " method for synthesizing chromosome formation is depended on after the α cloned-satellite sequence transfection permission cell line Cell-mediated from the beginning chromosome is formed, α-satellite sequence of the clone include the suitable centromere of typical host cell and Marker gene may be selected, with or without telomere and genomic DNA.(about the scheme and detailed description of these methods, ginseng See, for example, Harrington et al., Nat.Genet., 15:345-55 (1997)；Ikeno et al., Nat.Biotechnol., 16:431-39(1998)；Masumoto et al., Chromosoma, 107:406-16 (1998)；Ebersole et al., Hum.Mol.Gene.,9:1623-31(2000)；Henning et al., PNAS USA, 96:592-97 (1999)；Grimes etc. People, EMBO Rep.2:910-14 (2001)；Mejia et al., Genomics, 79:297-304 (2002)；And Grimes etc. People, Mol.Ther., 5:798-805 (2002)).It is cloned into yeast artificial chromosome, bacterial artificial chromosome or the source P1 Artificial chromosome vector in synthesis and both naturally occurring α-array of satellites have been used for de novo formation in the art Chromosome is formed.The product assembled from bottom to top can be it is linear or circular, including have based on α-satellite DNA silk The simplification of grain and/or the input DNA of concatermer, and general size range is between 1Mb and 10Mb.Source from bottom to top Synthesis chromosome is also engineered to mix the nucleic acid sequence allowed on target DNA sequence site-specific integration to synthesis chromosome Column.

" from top to bottom " method of generation synthesis chromosome includes the random of the pre-existing chromosome arm of sequence round And/or targeting truncation, to generate the synthesis dyeing of terse (pared down) including centromere, telomere and DNA replication dna starting point Body.(about the scheme and detailed description of these methods, see, e.g., Heller et al., PNAS USA, 93:7125-30 (1996)；Saffery et al., PNAS USA, 98:5705-10 (2001)；Choo,Trends Mol.Med.,7:235-37 (2001)；Barnett et al., Nuc.Ac.Res., 21:27-36 (1993)；Farr et al., PNAS USA, 88:7006-10 (1991)；And Katoh et al., Biochem.Biophys.Res.Commun., 321:280-90 (2004))." from upper and Under " synthesis chromosome is most preferably configured to the gene without naturally occurring expression, and is engineered to comprising such DNA sequence Column, the DNA sequence dna allow by such as locus specificity DNA integrase mediated target DNA sequence site-specific integration to section On short chromosome.

The third method known in the art for generating synthesis chromosome is the engineering of naturally occurring minichromosome. The production method generally includes the chromosome segment of radiation-induced, the chromosome include it is functional, such as the mankind it is new silk Grain has the function of centromere but lacks α-satellite DNA sequence and be engineered to without nonessential DNA.(about these methods Scheme and detailed description, see, e.g., Auriche et al., EMBO Rep.2:102-07 (2001)；Moralli et al., Cytogenet.Cell Genet.,94:113-20(2001)；And Carine et al., Somat.Cell Mol.Genet., 15:445-460(1989).).As the other methods for generating synthesis chromosome, engineering minichromosome can be by engineering Turn to the DNA sequence dna comprising allowing the site-specific integration of target DNA sequence.

For generating synthesis the 4th kind of chromosome and preferred method includes the targeting by specific chromosome segment The from the beginning chromosome of the induction of amplification generates.This method includes the nearly centric region on telocentric chromosome (pericentromeric) the extensive amplification in/ribosomal DNA region.Pass through region (such as ribosomes the arm between chromosome RNA) specific excessive DNA and allow target DNA sequence site-specific integration DNA sequence dna (such as attP, attB, AttL, attR etc.) and optionally it is integrated into the cotransfection triggerings of all optional markers in region between the arm of chromosome Amplification.(about the scheme and detailed description of these methods, see, e.g., Csonka et al., J.Cell Sci 113:3207- 16(2002)；Hadlaczky et al., Curr.Opini.Mol.Ther., 3:125-32 (2001)；And Lindenbaum and Perkins et al., Nuc.Ac.Res., 32 (21): el72 (2004)).In this process, by the DNA target of cotransfection to close Region induces extensive chromosome DNA amplification, duplication/activation of centromeric sequence, Yi Jisui between the arm of telocentric chromosome Dicentric chromosome afterwards splits and separates, generate comprising more than one site-specific integration site based on " fracture (break-off) " the synthesis chromosome of satellite DNA.

One component part of the platform chromosome technique of synthesis is site-specific recombination system, allows to select Gene " loading " is placed on synthesis chromosome.In a preferred embodiment of the invention, the platform chromosome of synthesis includes More than one locus specificity recombination site can be inserted in each of the more than one locus specificity recombination site One or several interested genes.Any of recombination system can be used, including use from Escherichia coli (E.coli) the Cre/lox recombination system of the CRE recombinase of bacteriophage P1 is (see, e.g., Sauer, Methods in Enzymology, 225:890-900 (1993) and U.S. Patent No. 5,658,772)；It is additional using 2 μ from saccharomyces cerevisiae The FLP recombinase of body yeast FLP/FRT system (see, e.g., Cox, PNAS U.S.A., 80:4223 (1983) and the U.S. Patent the 5,744,336th)；Resolvase, including bacteriophage Mu Gin recombinase (Maeser et al., Mol Gen Genet., 230:170-176(1991)),Cin,Hin,αδ,Tn3；The Pin recombinase of Escherichia coli is (see, e.g., Enomoto et al., J Bacterid.,6:663-668(1983))；The R/RS of the pSRl plasmid of Lu Shi yeast (Zygosaccharomyces rouxii) System (see, e.g., Araki et al., J.Mol.Biol., 225:25-37 (1992))；From Kluyveromyces Drosophilarium (see, e.g., Chen et al., Nucleic Acids Res., 314:4471-4481 (1986)) and Crewe hero saccharomycete (Kluyveromyces waltii) (see, e.g., Chen et al., J.Gen.Microbiol., 138: 337-345 (1992)) locus specificity recombinase；And other systems well known by persons skilled in the art；However, it is not necessary to In addition the factor-or by mutation without in addition because the recombination system-of sub-operation is preferred.In an exemplary reality It applies in scheme, provides a kind of for using the recombination enzymatic activity of bacteriophage lambda integrase will via sequence-specific recombination The method that nucleic acid is inserted into the platform chromosome of synthesis.

The integrase (being named as " Int ") of λ bacteriophage coding is the prototypical member for integrating enzyme family.Via being named as Recombination between the pairs of attachment site of attB/attP and attL/attR, Int realize that bacteriophage enters and leaves Escherichia coli The integration and excision of genome.Each site att includes two reversed 9 base pair core Int binding sites and 7 bases To overlapping region, this be identical in wild-type att sites.As Cre recombinase and Flp-FRT recombination enzyme system, Int executes the chain exchange of orderly sequence pair during integration recombination and excision recombination.Int, attB and attP or attL and The native target sequence of attR leads to intramolecular or intermolecular recombination to being located on identical or different DNA molecular respectively.For example, Intramolecular recombination is respectively occurring between the attB of inverted orientation and attP, or between attL and attR sequence, causes to occupy Between DNA section inversion.Although wild type Int need other protein factor for integrate recombination and excision recombination and negative surpass Spiralization is for integrating recombination, but mutant Int albumen does not need auxilin in the cotransfection measurement in human cell To carry out intramolecular integration recombination and excision recombination (referring to Lorbach et al., J Mol.Biol., 25 296:1175-1181 It (2000)) is and for method of the invention preferred.

The delivery vector of more than one gene is delivered in biosynthesis pathway

Wait be used for the more than one gene delivery in biosynthesis pathway or be " loaded " into the platform chromosome of synthesis On delivery vector selection will depend on many factors, such as it is expected the cell wherein bred type.Delivering appropriate Within the technical scope of those skilled in the art, and many carriers are obtained commercially for the selection of carrier.In order to prepare delivery vector, More than one gene is inserted into load and usually at the restriction enzyme site for the cracking that gene order is connected in carrier In body.It is alternatively possible to be inserted into desired nucleotide sequence by homologous recombination or locus specificity recombination.In general, passing through It is realized in the flank attachment of desired nucleotide sequence with the homologous region of carrier (such as site cre-lox, att etc.) same Source recombination.Nucleic acid comprising such sequence can be for example, by the connection of oligonucleotides, or by using including homology region The polymerase chain reaction of the primer of both a part of domain and desired nucleotide sequence is added.The example that can be used Property delivery vector includes but is not limited to be originated from those of recombinant phage dna, Plasmid DNA or cosmid DNA.It is, for example, possible to use Plasmid vector such as pBR322, pUC 19/18, pUC 118,119 and M13mp serial carrier.Phage vector may include λ Gt10, λ gt11, λ gtl8-23, λ Z Α Ρ/R and EMBL series phage vector.Utilizable cosmid vector includes but not Be limited to, pJB8, pCV 103, pCV 107, pCV 108, pTM, pMCS, pNNL, pHSG274, COS202, COS203, pWE15, PWE16 and Charomid 9 (charomid 9) serial carrier.Other carrier includes based on functional fertility plasmid (fertility Plasmid) bacterial artificial chromosome (BAC) of (F- plasmid), yeast artificial chromosome (YAC) and the source P1 is artificially colored The DNA construct (PACS) of body, DNA from P1 bacteriophage.Optionally and preferably, recombinant viral vector can be by engineering Change, including but not limited to be originated from virus such as herpesviral, retrovirus, vaccinia virus, poxvirus, adenovirus, slow virus, Those of adeno-associated virus or bovine papilloma virus recombinant viral vector.BAC carrier is since they carry a large amount of nucleic acid, i.e., more It is preferred delivery vector of the invention in the ability of a gene.It is alternatively possible to using more than one delivery vector via Sequence loads and more than one gene is loaded on the platform chromosome of synthesis；I.e., it is possible to via the first delivery vector by first Gene is loaded on the platform chromosome of synthesis, can be contaminated the platform that the second gene is loaded into synthesis via the second delivery vector On colour solid, so analogize.Perkins and Greene is described in the USSN 62/321,711 that on April 12nd, 2016 submits Sequence loads more than one delivery vector when marker individually may be selected in recycling.

Each of gene from biosynthesis pathway can be separated and be controlled by mammalian promoter, should Mammalian promoter constitutive expression is expressed by regulated promoter.It can be optionally present and work in expressive host Optional marker, in order to select the cell comprising delivery vector.In addition, delivery vector may include other element； For example, delivery vector can have one or two kinds of dubbing systems；Therefore allow it in organism, such as expression It is maintained in mammalian cell and in the prokaryotic hosts for cloning and expanding.

Use lambda integrase mediated locus specificity recombination-or the locus specificity weight of any other recombinase-mediated Target gene is introduced from delivery vector or is " loaded " on the platform chromosome of synthesis by group-.Because of the platform chromosome packet of synthesis Containing more than one locus specificity recombination site, so more than one gene is loaded on the platform chromosome individually synthesized. Cell can be delivered to by encoding the gene of recombinase on delivery vector by mediating the recombinase of locus specificity recombination, or Person's purifying or encapsulating recombination zymoprotein can be used standard technique and be delivered to recipient cell.More than one target gene it is every One is all likely to be under the control of its own promoter；Optionally, the expression of more than one target gene can be via based on disease Malicious or human internal's ribosome entry site (IRES) element carrys out coordinated regulation (see, e.g., Jackson et al., Trends Biochem Sci.15:477-83(1990)；And Oumard et al., Mol.Cell.Biol.20:2755-2759 (2000)). In addition, using the fluorescent marker-with target gene downstream such as green, red or blue fluorescent protein (GFP, RFP, BFP)- The IRES type element of connection allows to identify the platform chromosome of the synthesis of the target gene of expression integration.Alternatively or additionally, Locus specificity recombination event on synthesis chromosome can quickly be screened by design primer with detecting integration by PCR.

Component is delivered to synthesis chromosome and generates cell

Component and delivery vector suitable for synthesizing chromosome generation can be delivered by any method known in the art To recipient cell.Term transfection and conversion refer to that exogenous nucleic acid such as expression vector is received by host cell, and no matter it is in fact It is no to express any coded sequence.Many transfection methods be it is known to persons of ordinary skill in the art, for example, passing through Agrobacterium (Agrobacterium) conversion, protoplast transformation (conversion, electroporation, original including polyethylene glycol (PEG) mediation mediated Raw plast fusion and microcell fusion)), lipid mediate delivering, liposome, electroporation, sonoporation, microinjection, particle Conversion that bombardment and silicon carbide whisker mediate and combinations thereof is (see, e.g., Paszkowski et al., EMBO J., 3:2717- 2722(1984)；Potrykus et al., Mol.Gen.Genet., 199:169-177 (1985)；Reich et al., Biotechnology,4:1001-1004(1986)；Klein et al., Nature, 327:70-73 (1987)；U.S. Patent No. 6, No. 143,949；Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants In, volume 6, Molecular Biology of Plant Nuclear Genes, (Schell and Vasil, write, Academic Publishers 1989)；And Frame et al., Plant J., 6:941-948 (1994))；Use calcium phosphate Direct intake (Wigler et al., Proc.Natl.Acad.Sci.U.S.A., 76:1373-1376 (1979))；Polyethylene glycol (PEG) the DNA intake mediated；Liposome transfection is (see, e.g., Strauss, Meth.Mol.Biol., 54:307-327 (1996))；Microcell fusion (Lambert, Proc.Natl.Acad.Sci.U.S.A., 88:5907-5911 (1991)；The U.S. Patent the 5,396,767th；Sawford et al., Somatic Cell Mol.Genet., 13:279-284 (1987)；Dhar etc. People, Somatic Cell Mol.Genet., 10:547-559 (1984)；And McNeill-Killary et al., Meth.EnzymoL.,254:133-152(1995))；Lipid mediate carrier (carrier) system (see, e.g., Teifel et al., Biotechniques, 19:79-80 (1995)；Albrecht et al., Ann.Hematol., 72:73-79 (1996)；Holmen et al., In Vitro Cell Dev.Biol.Anim., 31:347-351 (1995)；Remy et al., Bioconjug.Chem.,5:647-654(1994)；Le Bolch et al., Tetrahedron Lett., 36:6681-6684 (1995)；And Loeffler et al., Meth.Enzymol., 217:599-618 (1993))；Or other suitable methods.With It is also described in US application serial the 09/815,979th in the method for delivering synthesis chromosome.Successful transfection usually passes through The presence of the intracellular heterologous nucleic acids of transfection is detected, any visualization of heterologous nucleic acids such as in host cell may be selected Any sign of the operation of the platform chromosome or delivery vector of expression or the synthesis of marker confirms.It can be used for practicing this hair The description of bright delivering method is referring to U.S. Patent No. 5,011,776；U.S. Patent No. 5,747,308；U.S. Patent No. No. 4,966,843；U.S. Patent No. 5,627,059；U.S. Patent No. 5,681,713；Kim and Eberwine, Anal.Bioanal.Chem.397(8):3173-3178(2010)。

Visualize, separate and be transferred to immune cell of the reviever

The generation of the platform chromosome of synthesis of the invention and loading can be monitored by a variety of methods.Lindenbaum With Perkins et al., Nucleic Acid Research, 32 (21): el72 (2004), which is described, uses skill in the prior art Art generates the artificial chromosome based on mammal satellite DNA and expresses (ACE) system.In the system of the prior art, use The probe of probe or nick translation that PCR is generated carries out conventional monochrome and double-colored fish analysis and high-resolution FISH.In order to Telomeric sequence is detected, hybridizes mitosis coating material (spreads) with commercially available peptide nucleic acid probe.Use fluorescence microscopy Art carries out microscopy.Optionally, Perkins and Greene was described on 2 9th, 2016 PCT/US16/17179 submitted Allow people using two kinds label labels via standardized fluorescent technology real-time monitoring synthesize chromosome formed composition and Method: a kind of label of label is specificity to the endogenous chromosome in the cell line of the platform chromosome for generating synthesis , and another label differently marked is specific to the sequence on synthesis chromosome to be generated.

The separation and transfer for synthesizing chromosome generally include cell transfer (MMCT) technology or dye using Microcell-mediated Expect dependence chromosome dyeing and the subsequent sorting based on flow cytometry.In MMCT technology, donorcells are lured by chemistry It leads so that its chromosome multinucleation, is subsequently packaged into microcell, and be finally fused in recipient cell.Synthesize chromosome Be transferred to the foundation of recipient cell by medicament selection and by the delivered intact of the chromosome of the transfer of FISH confirmation come It carries out.It is alternatively possible to use the transfer based on flow cytometry.For the transfer based on flow cytometry, by mitosis The chromosome separation of stagnation is simultaneously dyed with DNA specific dye, and carries out airflow classification based on size and difference dyeing. Then the chromosome of airflow classification is delivered in recipient cell via standard DNA rotaring dyeing technology, and complete chromosome is passed It send through FISH and determines.Again in another selection, in addition to what is submitted in Perkins and Greene on 2 9th, 2016 Except synthesis chromosome generates described in PCT/US16/17179 visualization and monitoring, synthesis chromosome label can also be used Chromosome is synthesized in generating separation in cell from synthesis chromosome via flow cytometry, and monitors synthesis chromosome to receptor The transfer of cell (i.e. immunocyte).

Embodiment

Embodiment 1: the from the beginning generation of the artificial chromosome based on satellite DNA

For synthesizing the from the beginning generation of chromosome, exogenous DNA array is introduced into HT1080 synthesis chromosome and generates cell In system, and after being integrated into the pericentric heterochromatin region of telocentric chromosome, telocentric chromosome is triggered The extensive amplification of galianconism (centromere rDNA/ region).During amplification event, centromere is replicated, and generating tool, there are two living The dicentric chromosome in property centromere.Subsequent mitosis event leads to the cracking and separation of dicentric chromosome, produces The fracture material of raw size about 20-120Mb, mainly includes satellite repetitive sequence, and the satellite repetitive sequence has coamplification The subdomain of the transgenosis of transfection, the subdomain also may include the rDNA copy of amplification.Newly-generated synthesis chromosome is logical It crosses via the endogenous chromosome label and synthesis chromosome label being engineered in HT1080 synthesis chromosome generation cell line Observation Fluorescent stained chromosomes apply dye (or FISH) and are verified.

In the previous day of transfection, HT1080 synthesis chromosome is generated into the cell of cell line with about 2.0 to 8.0 × 10⁴It is a The density of attached cell is assigned in 24 hole tissue culture dishes, and by the vector purification comprising exogenous DNA (for example, using Qiagen EndoFree Plasmid Maxi kit), linearisation, and determine for transfection carrier concentration.It feeds and is cultivated It HT1080 cell 3-5 hours, then transfects.By 225ng pSTV28HurDNA carrier and 12.5ng P15A72481acEF1attPPuro carrier/24 holes partly converge tissue culture dishes for using Standard transfection reagent (for example, The calcium phosphate transfection reagent of ThermoFisher Lipofectamine LTX, the Viafect of Promega or Invitrogen Box) transfect HT1080 cell.PSTV28HurDNA carrier includes ribosomal dna sequence.p15A7248lacEF1attPPuro Carrier includes component, LacO repetitive sequence and the ampicillin and puromycin tolerance for site-specific recombination system Gene.Cell is maintained 1-3 days after transfection, is laid in 10cm culture dish by their trypsinizeds and again at the time point On.In tiling or 1-3 days after tiling, Selective agar medium is added to 10cm culture dish.Alternative condition is maintained 10-21 It, every 2-3 days replacement culture mediums.When colony diameter reaches 2-3mm, picking anti-biotic resistance is cloned.The colony of good separation is Preferably.By using clone column (cloning cylinder) and trypsase taking-up cell, and be transferred in 24 orifice plates with For expanding.

Embodiment 2: saccharomyces cerevisiae tryptophan access delivery carrier is generated

Use BLoVeL-TTS carrier as skeleton delivery vector, with five bases of home-brewed yeast tryptophan access in future Because (Trp1-Trp5) is inserted on synthesis chromosome.Five tryptophan genes are encoded the DNA sequence dna of 2A peptide or IRES element It separates, to form the single transcript for including five genes, to generate the tryptophan synthesis of almost equal expression Required albumen.The 2A autothermic cracking peptide that can be used includes but is not limited to: porcine teschovirus (porcine teschovirus) -12A (P2A), bright arteries and veins thosea siensis virus (thosea asigna virus) 2A (T2A), horse rhinitis A virus 2A (E2A), hoof-and-mouth disease Poison (foot-and-mouth disease virus) 2A (F2A), cytoplasmic polyhedrosis virus 2A (BmCPV 2A) and softening illness disease Malicious (flacherie Virus2A) (BmIFV2A) (see below).Statistics indicate that the N-terminal addition in autothermic cracking peptide is one short 3 amino acid peptides (glycine-serine-glycine) autothermic cracking can be improved.Therefore, which, which also covers, improves 2A certainly The slight modification of the active efficiency of cleavage of peptide.

Table 1

(referring to Kim et al., PLoS ONE, 6 (4), e18556.http: //doi.org/10.1371/ Journal.pone.0018556 internal ribosome entry site (IRES) element that) can be used include but is not limited to virus and Cell IRES element.Vims IRES sequences are divided into four seed types.Type I includes enterovirus (EV, PV, HRV), Type II, the heart Popular name for poison (EMCV) and foot and mouth disease poison (aphthovirus) (foot and mouth disease virus (foot-and-mouth disease virus), FMDV), type-iii is used for hepatitis A virus (HAV), and the IRES of Hepatitis C Virus (HCV) sample meets IV group.(ginseng See Pacheco and Martinez-Salas, J Biomed Biotechnol.Feb2；2010:458927.doi:10.1155/ 2010/458927.PMID:20150968；And Hellen and Sarnow, Genes Dev., 15 (13): 1593-612 (2001))。

BLoVeL-TTS is digested with Eco53KI, so that delivery vector skeleton linearizes.By five Trp gene chemical synthesis Or such primer PCR amplification from saccharomyces cerevisiae s288c genomic DNA is used, the primer is designed to 5 bases Cause and the promoter IN-Fusion of selection clone (Takara) are into the BLoVeL-TTS carrier of linearisation.

Table 2

Promoter those of can find the promoter of promoter or man-made assembly in nature.Desired expression control System determines whether constitutive promoter or inducible promoter are preferred for specific passageways and application.For example, people can be with Using such promoter, the promoter will provide feedback mechanism according to the horizontal induction or suppression of specific metabolite in cell System transcription.

Five Trp genes in saccharomyces cerevisiae biosynthesis pathway are synthesized by following modification: 1) synthesis, which does not have, terminates Trp1, Trp2, Trp3, Trp4 gene of codon；2) P2A spacer region is encoded in the upstream of Trp2 gene, and glycine- Serine-Glycine spacer region is encoded plus the T2A spacer region of 15bp in the downstream of the last one Trp2 amino acid codes； 3) T2A spacer region is encoded in the upstream of Trp3 gene, and glycine-serine-glycine spacer area adds the E2A of 15bp Spacer region is encoded in the downstream of the last one Trp3 amino acid codes；4) E2A spacer region is compiled in the upstream of Trp4 gene Code, and glycine-serine-glycine spacer area adds the F2A spacer region of 15bp in the last one Trp4 amino acid code The downstream of son is encoded；And 5) F2A spacer region is encoded in the upstream of Trp5 gene, and polyadenylation signal exists The downstream of Trp5 gene is encoded.

The DNA element and mankind's EF1 α promoter that PCR primer is designed to PCR amplification five synthesis are (from pEF1hrGFP Amplification), it is cloned into the BLoVeL-TTS carrier framework of linearisation for N-Fusion.Gained construct BLoVeL-TTS_ TrpPath is shown in Figure 2.(in BLoVeL-TTS_TrpPath, there are following elements: sopA, sopB and sopC=plasmid point With albumen (plasmid partitioning protein)；The poly- A of SV40pAn=SV40；TTS=transcription stop signals；attB =locus specificity recombination site；Lox=locus specificity recombination site；EGFP=fluorescin；The tolerance of Bsr=blasticidin Property gene；RepE=replication origin；Ori2=replication orgin；CmR=chloramphenicol genes conferring resistance；The poly- A of poly An=； EF1alphaPr=promoter；TRP1, TRP2, TRP3, TRP4 and TRP5=tryptophan gene 1-5；P2A, T2A, E2A and F2A =autothermic cracking peptide.).After constructing BLoVeL-TTS_TrpPath delivery vector, it is transfected into comprising synthesis chromosome In cell.

Embodiment 3: saccharomyces cerevisiae tryptophan pathway gene is loaded on synthesis chromosome

Use BLoVeL-TTS carrier as delivery vector, with five genes of home-brewed yeast tryptophan access in future (Trp1-Trp5) it is inserted on synthesis chromosome.At the 0th day, the recipient cell system (example of synthesis chromosome (hSynC) will be included Such as HT1080) with~4E4 cell/24 hole culture dishes hole inoculation, so that hole is converged on day 1~70%.By cell 37 DEG C, 5%CO₂It is incubated overnight in culture medium appropriate (for example, for HT1080, DMEM+10%FC3).On day 1, according to manufacture Quotient explanation (Fisher Scientific, with Plus reagent Lipofectamine LTX), by delivery vector (such as BLoVeL-TTS_TrpPath) and both plasmids (such as pCXLamIntR) of coding recombinant protein are transfected into HT1080 cell In.Transfection to carry out in duplicate, so as to carry out the comparison of medicament selection and direct cell sorting.It is cultivated in Opti-MEM Lipofectamine LTX (Gibco is diluted in base；1.5ul LTX/50ul Opti-MEM is used for 24 hole culture dishes to be transfected Each hole) and by 250ng DNA be added to 50ul in Opti-MEM diluted LTX (for example, 125ng BLoVeL- TTS_TrpPath plasmid and the hole 125ng pCXLamIntR/).0.25ul PLUS reagent is added to each~50ul DNA- In LTX-Opti_MEM sample, and by each sample in incubation at room temperature 5 minutes.Then by culture medium from the thin of the 0th day bed board It is removed in born of the same parents, and replaces culture medium using fresh culture in 5 minutes incubation periods.DNA- lipid complex is added to carefully Born of the same parents, and in 37 DEG C, 5%CO₂It is incubated in culture medium appropriate.

At the 2-24 days, medicament selection is carried out.By the cell trypsase in the Kong Zhongyi hole from duplicate 24 hole In the culture dish for changing and being transferred to 10cm, the culture dish have comprising medicament selection (for example, 5ug/ml puromycin or The blasticidin of 3ug/ml) fresh culture.Then by cell in 37 DEG C, 5%CO₂It is incubated in culture medium appropriate, and And monitoring Colony forming.About every 72 hours one subcultures of replacement.When forming apparent colony (about 10 days), by each colony Pass through glass post separation, trypsinized and is transferred in the hole of 24 hole culture dishes.Then in culture by these " clones " Amplification, until have enough cells can be used for clone be placed in refrigerate in and separate genomic DNA (about 2 weeks；Promega Wizard SV Genomic DNA Purification), it is analyzed for PCR.

It is alternatively possible to by the cell trypsinized in duplicate hole, and be placed in the selection that suffers for want of medical supplies In the 6cm culture dish of fresh culture, and in 37 DEG C, 5%CO₂It is incubated in culture medium appropriate.On day 3 or the 4th day, By the cell trypsinized in 6cm culture dish and it is applied to cell sorter, with to having incorporated carrier and delivered Carrier (such as GFP；BLoVeL-TTS_TrpPath the fluorecyte that fluorescin is expressed on) carries out unicellular sorting.Pay attention to point The in-frame GFP positive recombinants after instrument identification integration are selected, this is one of unique aspect of the method for the present invention.Include sense The integration of gene/DNA element delivery vector of interest is produced by using PCR primer appropriate crosses over synthesis chromosome and passs Unique PCR product of recombination site between carrier (BLoVeL-TTS_TrpPath) is sent to identify.Water and host genome DNA The negative control PCR reaction of (such as HT1080) carries out together with test cdna group DNA sample.For from BLoVeL-TTS_ The PCR primer that contact (junction) PCR product is expanded in TrpPath vector integration is: the expected Product size 392bp of contact 1- (ACCGAGCTGCAAGAACTCTTCCTC [SEQ ID No.5] and ctcgccgcagccgtgtaa [SEQ ID No.6])；Contact 2- is expected Product size 401bp (gcgctaatgctctgttacaggt [SEQ ID No.7] and GGAAAGCTGCCAGTGCCTTG [SEQ ID No.8])。

After identifying the candidate clone with correct contact PCR product size, further PCR reaction is carried out to confirm original Begin be loaded into delivery vector and be now currently located in synthesis chromosome on interested DNA element (for example, TRP1, TRP2, TRP3, TRP4 and TRP5) presence.In addition, having carried out the test of the generation of tryptophan, and this can in many ways really It is fixed.Firstly, with the growth of these cells, can be surveyed compared with the cell grown in the cell culture medium comprising tryptophan The ability that examination cell is grown in the cell culture medium of lack amino acid tryptophan.Optional test for tryptophan synthesis can To be the cell precipitate with Bridge-it L-Trp fluorimetric reagent box (Mediomics, LLC) measurement cracking (pellet) tryptophan levels in.Tryptophan levels are in the independent training for carrying TRP1, TRP2, TRP3, TRP4 and TRP5 gene Support object on to measure in triplicate, and with do not have comprising BLoVeL-TTS_TrpPath synthesis chromosome cell culture Object is compared.

Embodiment 4: aromatic amino acid access is added to tryptophan access

Tryptophan access from yeast may be also required to ARO access with logical for tryptophan biosynthesis in human cell Road provides precursor.Precursor molecule into tryptophan biosynthesis access is chorismic acid (chorsimate), by aromatic amine Base acid access (also referred to as shikamate access) generates.In saccharomyces cerevisiae (S.cerevisiae), four genes are responsible for phosphorus Sour enolpyruvate (PEP) and erythrose-4-phosphate (E4P) are converted into chorismic acid:

Table 3

Gene	NCBI reference sequences	Size (bp)
			ARO1	NC_001136.10/ gene I/D: 851705	4767
ARO2	NC_001139.9/ gene I/D: 852729	1131
			ARO3	NC_001136.10/ gene I/D: 851605	1113
ARO4	NC_001134.8/ gene I/D: 852551	1113

(referring to Braus, Microbiological Reviews, 55 (3), 349-370 (1991))

It, will be optional using CRE-Lox recombination after identifying the cell comprising TRP1, TRP2, TRP3, TRP4 and TRP5 gene Select marker box (eGFP-BSR) removal.

With cell line of the CRE expression plasmid transfection comprising synthesis chromosome.At the 0th day, by cell with 2E5 cell/6cm Tissue Culture Dish inoculation, and at 37 DEG C with 5%CO₂It is incubated overnight.On day 1, according to the scheme of manufacturer, CRE is expressed Plasmid (such as PSF-CMV-CRE-CRE recombinase expression vector；Sigma Aldrich) it is transfected with Lipofectamine LTX Into cell line (including TRP1, TRP2, TRP3, Trp4 and TRP5 gene).Lipofectamine LTX is trained in Opti-MEM It supports and dilutes (Gibco in base；7.25ul LTX/500ul Opti-MEM is used for each 6cm culture dish to be transfected), and will 1.25ug DNA is added to 500ul and (carries for example, PSF-CMV-CRE-CRE recombinates expression of enzymes in diluted LTX in Opti-MEM Body/6cm culture dish).Then 1.25ul PLUS reagent is added in each~500ul DNA-LTX-Opti_MEM sample, And in incubation at room temperature 5 minutes.Then culture medium is removed from the cell in tiling in the 0th day, and in 5 minutes incubation periods It is replaced with fresh culture.DNA- lipid complex is added to cell, and in 37 DEG C, 5%CO₂In culture medium appropriate It is incubated for.On day 2, the cell transfected from the CRE of 6cm culture dish is harvested by trypsinized, and gated to receive Collect non-fluorescence cell.Non-fluorescence cell has been subjected to CRE-lox recombination, leads to the removal of eGFP-BSR box.Non-fluorescence cell is Through experience CRE-lox recombination, lead to the removal of eGFP-BSR box.96 hole culture dishes can be sorted by non-fluorescence cell is unicellular In and/or batch (bulk) be sorted into pipe, then tile into Tissue Culture Dish (such as 6cm culture dish).Then work as cell When expanding with culture, the fluorescence of cell is monitored.It will not show that those of fluorescence single cell clone is expanded with culture, for cold Hiding is separated with genomic DNA.CRE-lox recombination event appropriate is determined using the primer below based on BLoVeL-TTS carrier PCR confirmation: Lox box is positive:

(AGCCGTGTAACCGAGCATAGtgaagcctgcttttttatactaacttgagcgaa[SEQ ID No.9])

Lox box is reversed:

(CTGTTTCCTTCAGCCTGCATGGCCTTGACTAGAGGGTCGACGG[SEQ ID No.10])

Show the appropriate excision of those of 462bp product candidate instruction eGFP-BSR box, and the instruction of 1,819bp product is not It cuts off.It will further be tested with the candidate of correct PCR product by PCR, to confirm depositing for interested DNA element ?.

Four ARO genes in saccharomyces cerevisiae biosynthesis pathway are synthesized by following modification: 1) synthesis, which does not have, terminates ARO1, ARO2, ARO3 gene of codon；2) P2A spacer region is encoded in the upstream of ARO2 gene, and glycine-silk ammonia Acid-glycine spacer area is encoded plus the T2A spacer region of 15bp in the downstream of the last one ARO2 amino acid codes；3) T2A spacer region is encoded in the upstream of ARO3 gene, and glycine-serine-glycine spacer area is plus between the E2A of 15bp Septal area is encoded in the downstream of the last one ARO3 amino acid codes；And 4) upstream quilt of the E2A spacer region in ARO4 gene Coding, and polyadenylation signal is encoded in the downstream of ARO4 gene.New synthesis site of polyadenylation from Copy in pGLuc-Basic_2 (NEB).PCR primer is designed to the DNA element of this four synthesis of PCR amplification and EF1 α is opened Mover (expands) from pEF1hrGFP, is cloned into the BLoVeL-TTS delivery vector skeleton of linearisation for N-Fusion.Gained Construct BLoVeL-TTS_AroPath is shown in Figure 3.(in BLoVeL-TTS_AroPath, there are following elements: sopA, SopB and sopC=plasmid distributes albumen；The poly- A of SV40pAn=SV40；TTS=transcription stop signals；AttB=locus specificity Recombination site；Lox=locus specificity recombination site；EGFP=fluorescin；Bsr=blasticidin genes conferring resistance；repE =replication origin；Ori2=replication orgin；CmR=chloramphenicol genes conferring resistance；The poly- A of poly An=；EF1alphaPr= Promoter；ARO1, ARO2, ARO3 and ARO4=aromatic amino acid gene 1-4；P2A, T2A and E2A=autothermic cracking peptide.).It will BLoVeL-TTS_AroPath carrier is transfected into the synthesis comprising having had been loaded into TRP1, TRP2, TRP3, Trp4 and TRP5 gene In the cell of chromosome.

At the 0th day, will the recipient cell system (such as HT1080) comprising synthesis chromosome (hSynC) with~4E4 cell/ The hole of 24 hole culture dishes is inoculated with, so that hole is converged on day 1~70%, and in 37 DEG C, 5%CO₂In culture medium (example appropriate Such as, for HT1080, DMEM+10%FC3) in be incubated overnight.On day 1, according to the explanation (Fisher of manufacturer Scientific, the Lipofectamine LTX with Plus reagent), by delivery vector (such as BLoVeL-TTS_ AroPath it) is transfected into HT1080 cell with both plasmids (such as pCXLamIntR) of coding recombinant protein.Transfection usually with It is duplicate to carry out, so as to carry out the comparison of medicament selection and direct cell sorting.Lipofectamine LTX is existed (Gibco is diluted in Opti-MEM culture medium；1.5ul LTX/50ul Opti-MEM is every for 24 hole culture dishes to be transfected A hole), and by 250ng DNA be added to 50ul in Opti-MEM in diluted LTX (for example, 125ng BLoVeL-TTS Plasmid and the hole 125ng pCXLamIntR/).0.25ul PLUS reagent is added to each~50ul DNA-LTX-Opti_MEM In sample, and by each sample in incubation at room temperature 5 minutes.Then culture medium is removed from the cell of the 0th day bed board, and It is replaced in 5 minutes incubation periods using fresh culture.DNA- lipid complex is added to cell, and in 37 DEG C, 5% CO₂It is incubated in culture medium appropriate.

At the 2-24 days, medicament selection is carried out.By the cell trypsase in a hole in the hole from duplicate 24 hole In the culture dish for changing and being transferred to 10cm, in the culture dish have comprising medicament selection (for example, 5ug/ml puromycin or In the blasticidin of 3ug/ml) fresh culture.Then by cell in 37 DEG C, 5%CO₂It is incubated in culture medium appropriate, And monitor Colony forming.About every 72 hours one subcultures of replacement.When forming apparent colony (about 10 days), by each collection It falls and passes through glass post separation, trypsinized and be transferred in the hole of 24 hole culture dishes.Then by these " clones " in culture Middle amplification, until have enough cells can be used for clone be placed in refrigeration in and separate genomic DNA (about 2 weeks；Promega Wizard SV Genomic DNA Purification), it is analyzed for PCR.

It is alternatively possible to by the cell trypsinized in duplicate hole, and be placed in the selection that suffers for want of medical supplies In the 6cm culture dish of fresh culture, and in 37 DEG C, 5%CO₂It is incubated in culture medium appropriate.On day 3 or the 4th day, By the cell trypsinized in 6cm culture dish and it is applied to cell sorter, with to having incorporated carrier and targeted Carrier (GFP；BLoVeL-TTS_AroPath the fluorecyte that fluorescin is expressed on) carries out unicellular sorting.Comprising interested Gene/DNA element delivery vector integration by using PCR primer appropriate generate across synthesis chromosome and delivering carry Unique PCR product of recombination site is identified between body (BLoVeL-TTS_AroPath).Water and host genome DNA (such as HT1080 negative control PCR reaction) carries out together with test cdna group DNA sample.For from BLoVeL-TTS_AroPath The PCR primer that unique contact PCR product is expanded in delivery vector integration is: expected 40 1bp of Product size of contact 1- (gcgctaatgctctgttacaggt [SEQ ID No.7] and GGAAAGCTGCCAGTGCCTTG [SEQ ID No.8]).It is reflecting Surely after the candidate clone with correct contact PCR product size, further PCR reaction is carried out to confirm and is originally loaded into delivering Carrier (TRP1, TRP2, TRP3, Trp4 and TRP5 gene) and the interested DNA element being now currently located on synthesis chromosome The presence of (for example, ARO1, ARO2, ARO3 and ARO4).Note that being loaded along with to second on synthesis chromosome, second Contact PCR is no longer unique: by both BLoVeL-TTS_AroPath and BLoVeL-TTS_TrpPath targeted integration events Shared contact-expection Product size 392bp (accgagctgcaagaactcttcctc [SEQ ID No.5] and ctcgccgcagccgtgtaa[SEQ ID No.6]).In addition, having carried out the test of the generation of chorismic acid.This can be with a variety of sides Formula determines.For example, can with ability that test cell is grown in the cell culture medium of lack amino acid tryptophan and with comprising The growth that the cell grown in the cell culture medium of tryptophan is compared.These cells have tryptophan and aromatic amino acid now Both biosynthesis pathways.Latter access should generate chorismic acid substrate, for generating tryptophan by former access.Color The optional test of propylhomoserin synthesis can be is surveyed with Bridge-it L-Trp fluorimetric reagent box (Mediomics, LLC) Surely the tryptophan levels in cell precipitate cracked.Tryptophan levels are on the independent cultures for carrying tryptophan with a formula three Part measurement, and with do not have comprising synthesize chromosome BLoVeL-TTS_AroPath cell culture and shortage The culture of both BLoVeL-TTS-AroPath and BLoVeL-TTS-TrpPath integration events is compared.

It is aforementioned to merely illustrate the principle of the present invention.It will be appreciated that those skilled in the art will design it is a variety of Arrangement form, although not explicitly described herein or display, these arrangement forms embody the principle of the present invention and are included in this In the spirit and scope of invention.In addition, all examples enumerated herein and conditional statement are directed primarily to that reader is helped to understand this hair Bright principle and inventor promotes this field to develop and the concept contributed, and should be to be construed as being without limitation of and such specifically enumerate Example and condition.In addition, enumerating all statements of the principle of the present invention, aspect and embodiment and its specific example herein It is expected that including both its structure and function equivalents.Additionally, it is contemplated that such equivalent not only included currently known equivalent but also Equivalent including future exploitation, i.e. exploitation execute identical function but regardless of structure any element how.Therefore, of the invention Range be not intended the exemplary implementation scheme for being restricted to be illustrated and described herein.But scope and spirit of the present invention It is embodied by appended claims.In claims below, unless otherwise being arranged herein using term " method (means) " The feature or element of act shall not be interpreted that the method according to 35U.S.C. § 112,16 adds the restriction of function.

Sequence table

<110>Edward's Perkins

<120>for generating the method and application thereof of the synthesis chromosome of expression biosynthesis pathway

<130> SYN004PCT

<140>with herein submit together

<141> 2017-04-12

<150> 62/321,711

<151> 2016-04-12

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 57

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>autoclasis solution sequence

<400> 1

gctactaact tcagcctgct gaagcaggct ggagacgtgg aggagaaccc tggacct 57

<210> 2

<211> 54

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>autoclasis solution sequence

<400> 2

gagggcagag gaagtctgct aacatgcggt gacgtcgagg agaatcctgg acct 54

<210> 3

<211> 60

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>autoclasis solution sequence

<400> 3

cagtgtacta attatgctct cttgaaattg gctggagatg ttgagagcaa ccctggacct 60

<210> 4

<211> 66

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>autoclasis solution sequence

<400> 4

gtgaaacaga ctttgaattt tgaccttctc aagttggcgg gagacgtgga gtccaaccct 60

ggacct 66

<210> 5

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>junction

<400> 5

accgagctgc aagaactctt cctc 24

<210> 6

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>junction

<400> 6

ctcgccgcag ccgtgtaa 18

<210> 7

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>junction

<400> 7

gcgctaatgc tctgttacag gt 22

<210> 8

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>junction

<400> 8

ggaaagctgc cagtgccttg 20

<210> 9

<211> 53

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>lox box

<400> 9

agccgtgtaa ccgagcatag tgaagcctgc ttttttatac taacttgagc gaa 53

<210> 10

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>lox box

<400> 10

ctgtttcctt cagcctgcat ggccttgact agagggtcga cgg 43

Claims (21)

1. a kind of method for constructing biosynthesis pathway in recipient cell, which comprises

Component transfection recipients cell line is generated with synthesis chromosome, it includes allowing target nucleic acid sequence that the synthesis chromosome, which generates component, The nucleic acid sequence of column site-specific integration；

Generate the platform chromosome with the synthesis of more than one locus specificity recombination site；With comprising can be realized biological conjunction The recipient cell system is transfected at the delivery vector of the more than one gene of access, wherein the delivery vector includes at least one Locus specificity recombination site；

The locus specificity between the platform chromosome of the synthesis and the delivery vector is activated to recombinate, wherein can be realized life The more than one gene of object synthesis access is loaded on the platform chromosome of the synthesis to generate and express the biology Synthesize the synthesis chromosome of access；And

The recipient cell of the synthesis chromosome of the separation comprising expressing the biosynthesis pathway.

2. the method as described in claim 1, wherein the more than one gene that can be realized biosynthesis pathway includes color Gene necessary to propylhomoserin biosynthesis.

3. method according to claim 2, wherein gene necessary to tryptophan biosynthesis includes saccharomyces cerevisiae Five genes necessary to tryptophan in (Saccharomyces cerevisiae) synthesizes.

4. method according to claim 2, wherein the delivery vector also includes a) to interfere or inhibiting tumour cells is blocked to exempt from One or more genes of the ability of epidemic disease cell cycle progress, b) encode the one of the factor for enhancing activated immune cell and growth A or more gene c) increases immunocyte to one or more genes of the specificity of tumour in development.

5. method as claimed in claim 4, wherein the delivery vector include a), b) or c) at least two.

6. method as claimed in claim 5, wherein the delivery vector include a), b) and c) in all three.

7. the method also includes following steps such as method of any of claims 1-6:

The synthesis chromosome of the biosynthesis pathway is expressed in separation；And

By the synthesis chromosome transfer to Co receptor cell.

8. Co receptor cell as claimed in claim 7.

9. the method for claim 7, wherein the Co receptor cell is selected from universal donor T cell or autologous patient T Cell.

10. Co receptor cell as claimed in claim 9.

11. the method as described in claim 1, wherein allow the nucleic acid sequence of site-specific integration include attP, AttP, attB, attL and attR of attB, attL and attR or mutant form.

12. the method as described in claim 1, wherein the delivery vector is BAC.

13. synthesizing chromosome, synthesis chromosomal expression biosynthesis pathway described in claim 1.

14. recipient cell, the recipient cell includes the synthesis chromosome for expressing biosynthesis pathway described in claim 1.

15. the method as described in claim 1, the method also includes following steps:

The recipient cell is transfected with the second delivery vector of the more than one gene comprising can be realized the second biosynthesis pathway Born of the same parents system, wherein second delivery vector includes at least one locus specificity recombination site；

The locus specificity between the platform chromosome of the synthesis and second delivery vector is activated to recombinate, wherein can be real The more than one gene of existing second biosynthesis pathway is loaded on the platform chromosome of the synthesis to generate expression The synthesis chromosome of second biosynthesis pathway；And

The recipient cell of the synthesis chromosome of the separation comprising expressing second biosynthesis pathway.

16. synthesizing chromosome, the second biosynthesis pathway described in the synthesis chromosomal expression claim 15.

17. method as claimed in claim 15, the method also includes following steps:

The synthesis chromosome of second biosynthesis pathway is expressed in separation；With

The synthesis chromosome transfer of second biosynthesis pathway will be expressed to Co receptor cell.

18. Co receptor cell as claimed in claim 15.

19. method as claimed in claim 15, wherein the Co receptor cell is selected from universal donor T cell or autologous patient T cell.

20. Co receptor cell as claimed in claim 19.

21. a kind of method for constructing biosynthesis pathway in immune cell of the reviever, which comprises

Component transfection recipients cell line is generated with synthesis chromosome, it includes allowing target nucleic acid sequence that the synthesis chromosome, which generates component, The nucleic acid sequence of column site-specific integration；

Generate the platform chromosome with the synthesis of more than one locus specificity recombination site；With comprising can be realized biological conjunction The recipient cell system is transfected at the delivery vector of the more than one gene of access, wherein the delivery vector includes at least one Locus specificity recombination site；

The locus specificity between the platform chromosome of the synthesis and the delivery vector is activated to recombinate, wherein can be realized life The more than one gene of object synthesis access is loaded on the platform chromosome of the synthesis to generate and express the biosynthesis The synthesis chromosome of access；

The recipient cell of the synthesis chromosome of the separation comprising expressing the biosynthesis pathway；

The synthesis chromosome of the biosynthesis pathway is expressed in separation；And

By the synthesis chromosome transfer to Co receptor cell.