CN109321650B - DNA probe and method for detecting single base mutation of DNA - Google Patents
DNA probe and method for detecting single base mutation of DNA Download PDFInfo
- Publication number
- CN109321650B CN109321650B CN201811211147.XA CN201811211147A CN109321650B CN 109321650 B CN109321650 B CN 109321650B CN 201811211147 A CN201811211147 A CN 201811211147A CN 109321650 B CN109321650 B CN 109321650B
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- dna
- mutation
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 230000035772 mutation Effects 0.000 title claims abstract description 45
- 239000003298 DNA probe Substances 0.000 title claims abstract description 38
- 108020003215 DNA Probes Proteins 0.000 title claims abstract description 29
- 238000000034 method Methods 0.000 title claims abstract description 28
- 108020004414 DNA Proteins 0.000 title abstract description 56
- 239000000243 solution Substances 0.000 claims abstract description 22
- 238000006243 chemical reaction Methods 0.000 claims abstract description 13
- 239000000523 sample Substances 0.000 claims abstract description 13
- 239000000203 mixture Substances 0.000 claims abstract description 10
- 239000011259 mixed solution Substances 0.000 claims abstract description 8
- 238000000556 factor analysis Methods 0.000 claims abstract description 6
- 238000009835 boiling Methods 0.000 claims abstract description 4
- 238000001816 cooling Methods 0.000 claims abstract description 4
- 238000002189 fluorescence spectrum Methods 0.000 claims abstract description 4
- 238000000137 annealing Methods 0.000 claims abstract description 3
- 238000007865 diluting Methods 0.000 claims abstract description 3
- 239000007853 buffer solution Substances 0.000 claims description 11
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 claims description 6
- 238000010521 absorption reaction Methods 0.000 claims description 5
- 238000004458 analytical method Methods 0.000 claims description 3
- 239000011780 sodium chloride Substances 0.000 claims description 3
- 239000013076 target substance Substances 0.000 claims description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 3
- 238000002835 absorbance Methods 0.000 claims description 2
- 230000035484 reaction time Effects 0.000 claims description 2
- 229910044991 metal oxide Inorganic materials 0.000 claims 1
- 150000004706 metal oxides Chemical class 0.000 claims 1
- 239000000126 substance Substances 0.000 claims 1
- 238000001514 detection method Methods 0.000 abstract description 12
- 230000007613 environmental effect Effects 0.000 abstract 1
- 230000035945 sensitivity Effects 0.000 abstract 1
- 239000007850 fluorescent dye Substances 0.000 description 8
- 101150110946 gatC gene Proteins 0.000 description 4
- 238000002156 mixing Methods 0.000 description 4
- 102000007327 Protamines Human genes 0.000 description 3
- 108010007568 Protamines Proteins 0.000 description 3
- 238000003491 array Methods 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 229940048914 protamine Drugs 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 230000003595 spectral effect Effects 0.000 description 3
- 208000002903 Thalassemia Diseases 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000012217 deletion Methods 0.000 description 2
- 230000037430 deletion Effects 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 206010052804 Drug tolerance Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 230000037429 base substitution Effects 0.000 description 1
- 239000000090 biomarker Substances 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000007901 in situ hybridization Methods 0.000 description 1
- 238000002493 microarray Methods 0.000 description 1
- 230000003278 mimic effect Effects 0.000 description 1
- 238000007481 next generation sequencing Methods 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 239000011541 reaction mixture Substances 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular detection, and provides a DNA probe and a method for detecting single base mutation of DNA, wherein the sequence of the DNA probe is shown as SEQ ID NO: 1-9, diluting the probe solution, boiling, annealing, cooling to room temperature, adding a mutation target for constant-temperature reaction, adding a mixed solution of 7Ff-3A and E-Q, measuring the fluorescence spectrum intensity of the mixture, performing factor analysis, and finally obtaining a distinguishing result. The invention has the advantages of accurate and convenient detection of environmental samples, good specificity of the detection method and high sensitivity.
Description
Technical Field
The invention belongs to the technical field of molecular detection, and particularly relates to a DNA probe and a method for detecting single base mutation of DNA.
Background
DNA single base mutations including single base substitutions, insertions, deletions and the like are important biomarkers for human diseases and drug tolerance. For example, the molecular basis of thalassemia is that single base mutation occurs in the gene sequence on the short arm of chromosome 11, which results in abnormal synthesis of related proteins and thus induces thalassemia.
The existing single base mismatch detection methods comprise polymerase chain amplification, next generation sequencing, microarray, in situ hybridization and the like. These methods have been commercially used, but they require expensive equipment, are complicated to operate, require highly specialized operators, and are difficult to apply in ordinary laboratories and enterprises. Meanwhile, these methods require designing a recognition DNA probe of a specific structure, which requires a professional to optimize conditions for a long time to obtain a desired result. Therefore, the development of a novel single base mutation detection method is beneficial to obtaining a new method and technology which are cheaper, universal and easy to design, popularizing the application of the method in small laboratories and enterprises, reducing the design difficulty of the method and widening the application range of the method.
Disclosure of Invention
Aiming at the technical problems, the invention provides a DNA probe and a method for detecting DNA single base mutation, and solves the problems of complex design, expensive instrument, complex professional operation, high professional requirement of operators and the like of the detection method in the prior art.
The technical scheme adopted by the invention is as follows: the DNA probes for detecting DNA single base mutation comprise 9 DNA probes, wherein the DNA probes are MB-7C1 respectively, and the sequences are shown as SEQ ID NO: 1. 2, MB-7A1, the sequence of which is shown in SEQ ID NO: 3. 4, MB-7T1, the sequence of which is shown in SEQ ID NO: 5. 6, MB-7G1, the sequence of which is shown in SEQ ID NO: 7. 8, MB-7DC, the sequence of which is shown in SEQ ID NO: 9. 10, MB-7IT, the sequence of which is shown in SEQ ID NO: 11. 12, MB-7IA, having a sequence shown in SEQ ID NO: 13. 14, MB-7IG, the sequence of which is shown in SEQ ID NO: 15. 16, MB-7IC, sequence shown in SEQ ID NO: 17. 18, respectively.
The invention also discloses a method for detecting the DNA single base mutation, which comprises the following steps:
s1 preparing a buffer solution, a DNA probe solution and a mixed solution of 7Ff-3A and E-Q; the 7Ff-3A sequence is shown as SEQ ID NO: 19, and the E-Q sequence is shown as SEQ ID NO: 20 is shown in the figure; dissolving the DNA probes according to claim 1 to prepare DNA probe solutions; measuring the concentrations of the DNA probe solution and the mixed solution of 7Ff-3A and E-Q;
the concentrations of the DNA probe solution and the mixture of 7Ff-3A and E-Q were measured for the purpose of accurate concentration in the subsequent dilution and mixing reactions of the DNA probe solution.
S2 for the test of the subsequent step, the DNA probe solutions of step S1 were diluted to 0.1-10uM with buffer solutions, respectively; boiling and annealing at 90-95 deg.C for 1-10 min, and cooling to room temperature;
s3 recognizes different DNA base mutations: respectively adding mutation target substances into the DNA probe solution prepared in the step S2, and reacting at constant temperature;
s4 adding a mixed solution of 7Ff-3A and E-Q into the reaction solution obtained in the step S3 for reaction;
analysis of S5 results:
(1) measuring the fluorescence spectrum intensity of the mixture obtained in the step S4 at 520 nm;
(2) making corresponding tables of different probes and mutation targets to obtain array data, introducing the array data into software for factor analysis by adopting a factor analysis function in SPSS9.0 software, and comparing factor scores of fluorescence probe response data of different mutation targets to obtain a final distinguishing result: based on the 95% confidence interval, if different samples belong to a confidence ellipse, the same mutation type is identified. For example, in FIG. 2, six samples within the same confidence ellipse are of the same mismatch type; there are a total of 9 different confidence ellipses, corresponding to 9 different mismatch classes.
Further, in step S1, the reaction mixture is mixed in a molar ratio of 1: 7Ff-3A and E-Q were mixed in a ratio of 1 to 10.
Further, in step S4, the molar ratio of the reaction solution obtained in step S3 to the mixture of 7Ff-3A and E-Q is 10-200:10-500, the reaction time is 30-200 minutes, and the reaction temperature is 10-40 ℃.
Further, in step S1, the buffer solution Tris-Mg, NaCl: pH 7-8, Na+The concentration is 10-500mM, Mg2+The concentration is 1-20 mM.
Further, in step S1, the ultraviolet absorbance a of the solution at 260nm is measured using an ultraviolet absorptiometer, and the concentration is calculated: concentration c ═ a/absorption coefficient.
Further, in step S3, the molar ratio of the DNA probe to the mutation target is 10 to 500: 10-500.
Further, in step S3, the DNA probe solutions are added with the mutation targets, respectively, and reacted for 30-200 minutes in a 10-40 ℃ water bath.
Further, the mutation target includes: T-7G, the sequence is shown as SEQ ID NO: 21 is shown in the figure; T-7T, the sequence is shown as SEQ ID NO: 22; T-7A, the sequence is shown as SEQ ID NO: 23 is shown; T-7C, the sequence is shown as SEQ ID NO: shown at 24; t-7IA, having the sequence shown in SEQ ID NO: 25 is shown; t-7IT, with the sequence shown in SEQ ID NO: 26 is shown; t-7IC, the sequence of SEQ ID NO: 27 is shown; t-7IG, with the sequence as shown in SEQ ID NO: 28 is shown; T-7D, the sequence is shown as SEQ ID NO: as shown at 29.
Compared with the prior art, the invention has the beneficial effects that:
1. the detection method is a DNA single base mutation detection method with high universality and good effect, and can identify all types of single base site mutations, including four substitutions (A, T, C, G for the seventh base, respectively), four insertions (A, T, C, G for the seventh base site, respectively) and one base deletion.
2. The detection method can be completed only by a common spectrophotometer, and has the advantages of simple operation and low cost.
3. Compared with polymerase chain amplification, second-generation sequencing and the like, the detection method provided by the invention is simple, easy to operate, low in requirement on the professional degree of operators, and convenient for enterprises and common laboratories to use.
Drawings
FIG. 1 is an array of fluorescence spectrum intensity data, with sensors 1-9 corresponding to probe sequences MB-7C1, MB-7A1, MB-7G1, MB-7T1, MB-7DC, MB-7IC, MB-7IG, MB-7IA, and MB-7IT, respectively; the data in the array are the response values of the mutated target DNA with different mismatches (left column) in different fluorescent probes (upper row);
FIG. 2 is a graph of the factor scores of fluorescent probe arrays for different mismatched mutant target DNAs;
FIG. 3 is an array of fluorescence spectral intensity data, with sensors 1-9 corresponding to probe sequences MB-7C1, MB-7A1, MB-7G1, MB-7T1, MB-7DC, MB-7IC, MB-7IG, MB-7IA, and MB-7IT, respectively; the data in the array are response values of mutant target DNA with different proportions on different fluorescent probes, the specific proportion of T-7G and T-7C is shown in figure 4, and the total concentration is 100 nM;
FIG. 4 is a graph of the factor scores of fluorescent probe arrays for different ratios of mutated target DNA;
FIG. 5 is an array of fluorescence spectral intensity data, with sensors 1-9 corresponding to probe sequences MB-7C1, MB-7A1, MB-7G1, MB-7T1, MB-7DC, MB-7IC, MB-7IG, MB-7IA, and MB-7IT, respectively; the data in the array are response values of different concentrations of mutant target DNA (T-7G) on different fluorescent probes;
FIG. 6 is a graph of the factor scores of fluorescent probe arrays for different concentrations of mutant target DNA (T-7G);
FIG. 7 is an array of fluorescence spectral intensity data, with sensors 1-9 corresponding to probe sequences MB-7C1, MB-7A1, MB-7G1, MB-7T1, MB-7DC, MB-7IC, MB-7IG, MB-7IA, and MB-7IT, respectively; the data in the array are response values of different mismatched mutant target DNA (left column) in different fluorescent probes (upper row), and the buffer solution contains 1uM of protamine DNA as a complex environment;
FIG. 8 is a factor score chart of fluorescent probe array for different mismatched mutant target DNA, with 1uM protamine DNA in buffer solution as a complex environment;
FIG. 9 is a schematic view of the reaction process of the present invention.
Detailed Description
The technical solution of the present invention will be further described with reference to the accompanying drawings and examples.
In the embodiment, the names of the DNA sequences of the mutation targets represent different base classes of mismatch sites, and are not specific to specific functions, so that the universality of the method is emphasized; the mixed solution of different mutation target DNA is obtained by artificial mixing, and the method has the capability of identifying and distinguishing different mismatch ratios. Complex samples, obtained by adding high concentrations of protamine DNA to buffer solutions, to mimic the complex sample environment in practical analytical tests, emphasizing the interference rejection of the method. The mutant target substance used in the present invention is chemically synthesized and is provided by Shanghai Biotech Ltd. The reaction process of the detection method is schematically shown in FIG. 9, and a universal signal is output.
1. Preparing a buffer solution A (Tris-Mg, NaCl: pH 7-8, Na)+The concentration is 10-500mM, Mg2+Concentration of 1-20 mM);
2. the DNA probe was dissolved to a final concentration of 1-100 uM. The DNA probe sequence is as follows:
MB-7C1：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGG CGT TTT A CCTTA
MB-7A1：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGG AGT TTT A CCTTA
MB-7T1：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGGTGT TTT A CCTTA
MB-7G1：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGGGGT TTT A CCTTA
MB-7DC：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGG GT TTT A CCTTA
MB-7IT：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGG CTGT TTT A CCTTA
MB-7IA：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGG CAGT TTT A CCTTA
MB-7IG：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGG CGGT TTT A CCTTA
MB-7IC：
TTAGATGTTAGTTTCACGAAGACAATGATAAGT
TAAGG GAT CGG CCGT TTT A CCTTA
E-Q:BHQ1-GTTAGATGTTAGTTTCACGAAGACAATGAT
7Ff-3A：ACTTATCATTGTCTTCGTGAAACTAACATCTAAC-FAM
the mutation target DNA was as follows:
T-7G TAAAACGCCGATC
T-7T TAAAACTCCGATC
T-7A TAAAACACCGATC
T-7C TAAAACCCCGATC
T-7IA TAAAACAGCCGATC
T-7IT TAAAACTGCCGATC
T-7IC TAAAACCGCCGATC
T-7IG TAAAACGGCCGATC
T-7D TAAAACCCGATC
3. an ultraviolet absorptiometer (Shimadzu UV-2450) is used to measure the ultraviolet absorption value A of the DNA probe at 260nm, and the exact concentration of the DNA probe, i.e., the concentration c is A/absorption coefficient, is calculated according to the absorption coefficient by the Lamborber's law.
4. Diluting the DNA probes MB-7C1, MB-7A1, MB-7G1, MB-7T1, MB-7DC, MB-7IC, MB-7IG, MB-7IA and MB-7IT to 0.1-10uM with the buffer solution A respectively; boiling at 90-95 deg.C for 1-10 min, and slowly cooling for 1-5 hr to room temperature.
5. Mixing 7Ff-3A and E-Q in a ratio of 1: mixing at a ratio of 1-1:10, and processing according to the operation of the step 3.
6. Recognition of different DNA base mutations: adding 10-500nM of different mutation targets T-7G, T-7A, T-7T, T-7C, T-7IT, T-7IA, T-7IG, T-7IC and T-7D into the DNA probe in step 4 of 10-500nM, and reacting for 30-200 minutes in a water bath at 10-40 ℃.
7. Transferring 10-200uL of the mixture in the step 6, adding the mixture into 10-500nM of the mixture in the step 5, and reacting at 10-40 ℃ for 30-200 min, wherein the total volume is 50-500 uL.
8. The mixture in step 7 of 100-.
9. Filling the fluorescence intensity values obtained in the step 8 into an excel table, and making a corresponding table of different probes and different mutation targets to obtain array data, which are shown in tables 1-4 in the attached drawings: sensor1-9 corresponds to probe sequences MB-7C1, MB-7A1, MB-7G1, MB-7T1, MB-7DC, MB-7IC, MB-7IG, MB-7IA, MB-7IT), respectively.
10. And (3) introducing the data in the step (9) into software by adopting a factor analysis function in SPSS9.0 software to obtain a final distinguishing result (see factor scoring figures 2, 4, 6 and 8 in the attached drawings).
Based on the 95% confidence interval, if different samples belong to a confidence ellipse, the same mutation type is identified. For example, in FIG. 2, six samples within the same confidence ellipse are of the same mismatch type; there are a total of 9 different confidence ellipses, corresponding to 9 different mismatch classes.
And (4) conclusion:
1. as shown in FIGS. 1 and 2, the method realizes the complete discrimination of 9 different single-base mutation types, and the DNA of different mismatch mutation target objects has no cross overlap, and the discrimination reaches 100%.
2. As shown in FIGS. 3 and 4, the method realizes the discrimination of different proportions of two different single base mutations, the different single base mutation proportions are not overlapped in a crossing way, and the discrimination reaches 100%.
3. As shown in FIGS. 5 and 6, the method realizes the discrimination of single base mutation at different concentrations, and the discrimination reaches 100% without cross overlapping between different concentrations.
4. As shown in 7 and 8, the method realizes the discrimination of different single base mutations in the complex gene sample, and the DNA of different mismatching mutation target objects has no cross overlapping, and the discrimination reaches 100 percent.
The foregoing is a further detailed description of the invention in connection with specific preferred embodiments and it is not intended to limit the invention to the specific embodiments described. For those skilled in the art to which the invention pertains, several simple deductions or substitutions can be made without departing from the spirit of the invention, and all shall be considered as belonging to the protection scope of the invention.
Sequence listing
<110> Huntan university
<120> DNA probe and method for detecting single base mutation of DNA
<130> 2018
<160> 29
<170> SIPOSequenceListing 1.0
<210> 1
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 1
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 2
<211> 23
<212> DNA
<213> Ordo artificialis
<400> 2
taagggatcg gcgttttacc tta 23
<210> 3
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 3
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 4
<211> 23
<212> DNA
<213> Ordo artificialis
<400> 4
taagggatcg gagttttacc tta 23
<210> 5
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 5
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 6
<211> 23
<212> DNA
<213> Ordo artificialis
<400> 6
taagggatcg gtgttttacc tta 23
<210> 7
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 7
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 8
<211> 23
<212> DNA
<213> Ordo artificialis
<400> 8
taagggatcg gggttttacc tta 23
<210> 9
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 9
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 10
<211> 22
<212> DNA
<213> Ordo artificialis
<400> 10
taagggatcg ggttttacct ta 22
<210> 11
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 11
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 12
<211> 24
<212> DNA
<213> Ordo artificialis
<400> 12
taagggatcg gctgttttac ctta 24
<210> 13
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 13
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 14
<211> 24
<212> DNA
<213> Ordo artificialis
<400> 14
taagggatcg gcagttttac ctta 24
<210> 15
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 15
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 16
<211> 24
<212> DNA
<213> Ordo artificialis
<400> 16
taagggatcg gcggttttac ctta 24
<210> 17
<211> 33
<212> DNA
<213> Ordo artificialis
<400> 17
ttagatgtta gtttcacgaa gacaatgata agt 33
<210> 18
<211> 24
<212> DNA
<213> Ordo artificialis
<400> 18
taagggatcg gccgttttac ctta 24
<210> 19
<211> 34
<212> DNA
<213> Ordo artificialis
<400> 19
acttatcatt gtcttcgtga aactaacatc taac 34
<210> 20
<211> 30
<212> DNA
<213> Ordo artificialis
<400> 20
gttagatgtt agtttcacga agacaatgat 30
<210> 21
<211> 13
<212> DNA
<213> Ordo artificialis
<400> 21
taaaacgccg atc 13
<210> 22
<211> 13
<212> DNA
<213> Ordo artificialis
<400> 22
taaaactccg atc 13
<210> 23
<211> 13
<212> DNA
<213> Ordo artificialis
<400> 23
taaaacaccg atc 13
<210> 24
<211> 13
<212> DNA
<213> Ordo artificialis
<400> 24
taaaaccccg atc 13
<210> 25
<211> 14
<212> DNA
<213> Ordo artificialis
<400> 25
taaaacagcc gatc 14
<210> 26
<211> 14
<212> DNA
<213> Ordo artificialis
<400> 26
taaaactgcc gatc 14
<210> 27
<211> 14
<212> DNA
<213> Ordo artificialis
<400> 27
taaaaccgcc gatc 14
<210> 28
<211> 14
<212> DNA
<213> Ordo artificialis
<400> 28
taaaacggcc gatc 14
<210> 29
<211> 12
<212> DNA
<213> Ordo artificialis
<400> 29
taaaacccga tc 12
Claims (7)
1. The method for detecting the single base mutation of the DNA is characterized in that the DNA probes for detecting the single base mutation of the DNA comprise 9 DNA probes, wherein the DNA probes are MB-7C1, and the sequences are shown as SEQ ID NO: 1. 2 is shown in the specification; MB-7A1, the sequence of which is shown in SEQ ID NO: 3. 4 is shown in the specification; MB-7T1, the sequence of which is shown in SEQ ID NO: 5. 6 is shown in the specification; MB-7G1, the sequence of which is shown in SEQ ID NO: 7. 8 is shown in the specification; MB-7DC, the sequence of which is shown in SEQ ID NO: 9. 10 is shown in the figure; MB-7IT, with the sequence shown in SEQ ID NO: 11. 12 is shown in the specification; MB-7IA, having the sequence shown in SEQ ID NO: 13. 14 is shown in the figure; MB-7IG, the sequence of which is shown as SEQ ID NO: 15. 16 is shown in the figure; MB-7IC, the sequence of which is shown in SEQ ID NO: 17. 18 is shown in the figure; the method comprises the following steps:
s1 preparing a buffer solution, a DNA probe solution and a mixed solution of 7Ff-3A and E-Q; the 7Ff-3A sequence is shown as SEQ ID NO: 19, and the E-Q sequence is shown as SEQ ID NO: 20 is shown in the figure; dissolving the 9 DNA probes respectively to prepare the DNA probe solution; measuring the concentrations of the DNA probe solution and the mixed solution of 7Ff-3A and E-Q;
s2, respectively diluting the DNA probe solutions obtained in the step S1 to 0.1-10uM with buffer solutions; boiling and annealing at 90-95 deg.C for 1-10 min, and cooling to room temperature;
s3 recognizes different DNA base mutations: respectively adding mutation target substances into the DNA probe solution prepared in the step S2, and reacting at constant temperature;
s4 adding a mixed solution of 7Ff-3A and E-Q into the reaction solution obtained in the step S3 for reaction;
analysis of results at S5:
(1) measuring the fluorescence spectrum intensity of the mixture obtained in the step S4 at 520 nm;
(2) making corresponding tables of different probes and mutation targets to obtain array data, introducing the array data into software for factor analysis by adopting a factor analysis function in SPSS9.0 software, and comparing factor scores of fluorescence probe response data of different mutation targets to obtain a final distinguishing result: based on the 95% confidence interval, if different samples belong to a confidence ellipse, the samples are identified as the same mutation type; the mutation target includes: T-7G, the sequence is shown as SEQ ID NO: 21 is shown in the figure; T-7T, the sequence is shown as SEQ ID NO: 22; T-7A, the sequence is shown in SEQ ID NO: 23 is shown; T-7C, the sequence is shown as SEQ ID NO: shown at 24; t-7IA, having the sequence shown in SEQ ID NO: 25; t-7IT, with the sequence as shown in SEQ ID NO: 26 is shown; t-7IC, the sequence of SEQ ID NO: 27 is shown; t-7IG, with the sequence as shown in SEQ ID NO: 28 is shown; T-7D, the sequence is shown as SEQ ID NO: as shown at 29.
2. The method according to claim 1, wherein in step S1, the molar ratio of 1: 7Ff-3A and E-Q were mixed in a ratio of 1 to 10.
3. The method according to claim 1, wherein in step S4, the molar ratio of the reaction solution obtained in step S3 to the mixture of 7Ff-3A and E-Q is 10-200:10-500, the reaction time is 30-200 minutes, and the reaction temperature is 10-40 ℃.
4. The method of claim 1, wherein the step of removing the metal oxide is performed in a batch processIn step S1, the buffer solution is: Tris-Mg, NaCl: pH 7-8, Na+The concentration is 10-500mM, Mg2+The concentration is 1-20 mM.
5. The method according to claim 1, wherein in step S1, the uv absorbance a of the solution at 260nm is measured using a uv absorptiometer, and the concentration is calculated as: concentration c ═ a/absorption coefficient.
6. The method according to claim 1, wherein in step S3, the molar ratio of the DNA probe to the mutation target is 10-500: 10-500.
7. The method according to claim 1, wherein the mutation-targeted substances are added to the DNA probe solutions in step S3, and the reaction is carried out in a water bath at 10-40 ℃ for 30-200 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811211147.XA CN109321650B (en) | 2018-10-17 | 2018-10-17 | DNA probe and method for detecting single base mutation of DNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811211147.XA CN109321650B (en) | 2018-10-17 | 2018-10-17 | DNA probe and method for detecting single base mutation of DNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109321650A CN109321650A (en) | 2019-02-12 |
| CN109321650B true CN109321650B (en) | 2022-05-06 |
Family
ID=65262771
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811211147.XA Expired - Fee Related CN109321650B (en) | 2018-10-17 | 2018-10-17 | DNA probe and method for detecting single base mutation of DNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109321650B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7745594B2 (en) * | 2005-07-21 | 2010-06-29 | California Institute Of Technology | Nucleic acid-based logic circuits |
-
2018
- 2018-10-17 CN CN201811211147.XA patent/CN109321650B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes;Sherry Xi Chen等;《Journal of The American Chemical Society》;20160324;第138卷(第15期);第5078左栏倒数第2段-第5085段左栏第3段 * |
| Triggered amplification by hybridization chain reaction;Robert M. Dirks等;《Proceedings of The National Academy of Sciences of The United States of America》;20041026;第101卷(第43期);摘要、第15275页左栏倒数第2段-第15277页右栏最后1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109321650A (en) | 2019-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114507749B (en) | Primer group, kit and method for accurately detecting transgenic components of corn | |
| CN114736958A (en) | Kit for detecting copy number of human motor neuron survival gene SMN1 and analysis method | |
| Wang et al. | Establishment and evaluation of a novel method based on loop-mediated isothermal amplification for the rapid diagnosis of thalassemia genes | |
| CN111118141A (en) | Primer sequence and kit for detecting glucose-6-phosphate dehydrogenase (G6PD) gene mutation | |
| CN109321650B (en) | DNA probe and method for detecting single base mutation of DNA | |
| CN104818340B (en) | Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms | |
| CN111394434B (en) | CHO host cell DNA residue detection kit adopting TaqMan probe method and application thereof | |
| CN113265479B (en) | Primer composition for detecting rickettsia morganii and application thereof | |
| CN113088566B (en) | Quantitative detection kit for 1 copy number of human motor neuron survival gene and analysis method | |
| CN112592965B (en) | E.coli host DNA residue detection kit adopting TaqMan probe method | |
| Mehta et al. | Performance characteristics of host-cell DNA quantification methods | |
| CN113151428A (en) | Method and device for detecting sample confusion in library construction process | |
| CN111363792B (en) | Kit and method for detecting gene polymorphism based on shared primer probe and application | |
| CN114369678B (en) | Primer combination, kit, detection method and application for detecting transgenic components and transgenic lines of beet | |
| CN111424074B (en) | Nucleic acid detection kit for quantifying trace residue of mouse source tissue | |
| CN110195128B (en) | Nucleotide sequence of skin type HPV typing detection primer based on constant temperature nucleic acid amplification technology and application | |
| CN114807407B (en) | Primer pair combination, kit and detection method for detecting soybean transgenic strain | |
| Stopińska et al. | Optimization of the Y831C mutation detection in human DNA polymerase gamma by allelic discrimination assay | |
| CN110343746B (en) | Fixed value method for correcting EGFR gene mutation frequency | |
| CN114277178B (en) | Primer pair combination for detecting transgenic components of rape, kit, detection method and application | |
| CN105548129A (en) | Method for molecule/ion detection based on single fluorescent molecule bleaching and imaging | |
| CN117821568A (en) | Whole blood sample processing reagent, whole blood sample processing method and detection method free of nucleic acid extraction | |
| CN116769885A (en) | Detection method and detection kit for Vero residual DNA | |
| CN105695604A (en) | Fluorescent PCR (polymerase chain reaction) kit for XPC cancer susceptible genes and application thereof | |
| CN116445618A (en) | Primer group and method for detecting T1799A point mutation of BRAF gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20220506 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |