CN109321592A - The method for generating HPV18 L1 albumen with expressed by Hansenula yeast system - Google Patents

Abstract

The present invention relates to the methods for generating HPV18 L1 albumen with expressed by Hansenula yeast system.Specifically, the invention discloses the method for the recombination Hansenula yeast cell for generating expression HPV18 L1 albumen and the recombination Hansenula yeast cells generated by the method.The invention also discloses preparing the purposes in preventative vaccine using the method and generated HPV18 L1 albumen of the recombination Hansenula yeast cell generation HPV18 L1 albumen.

Description

The method for generating HPV18 L1 albumen with expressed by Hansenula yeast system

The application be the applying date be on January 21st, 2012, application No. is 201210021524.X, entitled " use the Chinese The divisional application of the application for a patent for invention of the method that inferior yeast expression system generates HPV18 L1 albumen ".

Invention field

The invention belongs to medical bioengineering technical field, the method for being related to generating HPV18 L1 albumen, more particularly to use The method of expressed by Hansenula yeast system generation HPV18 L1 albumen.

Background technique

Human papilloma virus (human papillomavirus, HPV) is a kind of nonencapsulated closed loop double-stranded DNA virus, Belong to papovaviridae polyomavirus subfamily, the main epithelium mucous membrane tissue for invading human body, and then induces various benign and pernicious Preneoplastic lesions.

Having identified the different subtype HPV come at present is more than 200 kinds, and HPV infection has apparent tissue specificity, different The HPV of type is different for the thermophilic tropism of skin with mucous membrane, can induce different papillary lesions, about more than 30 kinds of HPV types It is not related with reproductive tract infection, wherein have more than 20 kinds it is related to tumour.The good pernicious difference of lesion is induced according to HPV, HPV can be big Cause is divided into two classes: 1) high-risk-type (such as HPV16, HPV18, HPV45, HPV31, HPV33, HPV52, HPV58, HPV35, HPV59, HPV56, HPV39, HPV51 etc.): it is closely related with mankind's Various Tissues malignant tumour, mainly cause severe atypical hyperplasia and Infiltrating carcinoma, especially the closest with the generation of cervical carcinoma with the infection of HPV16 and HPV18 type, the infection of the two types accounts for cervical carcinoma 70% or more of infection, wherein HPV16 accounts for 50% or more；2) low risk (such as HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV72, HPV 81 etc.): epidermal cell benign proliferative venereal disease can be caused, such as condyloma acuminatum and condyloma Deng wherein accounting for 90% or more by the condyloma acuminatum that HPV6 and HPV11 induces.

HPV is mainly made of virus coat and genomic DNA.Genome is about 7900bp, there is 8 encoding hiv protease bases Cause.Wherein the albumen of 6 ORF coding is in the early expression of virus replication, referred to as early protein；The albumen of 2 ORF coding is in disease The advanced stage expression of poison duplication, referred to as late protein.Late protein includes major cat protein L1 and secondary coat protein L2, and is joined With the formation of virus coat.

HPV viruse coat protein is able to carry out self assembly, the L1 albumen of single expression or by L1 in a variety of expression systems Albumen and L2 albumen can be self-assembled into virus-like particle (virus-like particle, VLP) when co-expressing, wherein with The VLP of the generations such as Yeast system, Baculovirus insect expression system and mammalian cell expression system is closer to natural viral Structure.Generation neutralizing antibody can be induced in vivo after being immunized using the VLP of heterogenous expression system production, obtain good exempts from Epidemic disease protecting effect.

Multiple-shaped nuohan inferior yeast (Hansenula Polymorpha), also referred to as Pichia augusta are currently generally acknowledged One of ideal heterologous gene expression system.It is raw both to have protokaryon as single celled eukaryotic microorganism for multiple-shaped nuohan inferior yeast Object fast growing is easy to the features such as genetic manipulation, and has the functions such as eukaryocyte post translational processing and modification.In addition, the inferior ferment of the Chinese Mother is also equipped with that safety is good, be easy to cultivate, low in cost, expression quantity is high and the advantages such as inheritance stability, and can overcome such as Saccharomyces cerevisiae (Saccharomyces cerevisiae) bacterial strain is unstable, low output and glycosylation side chain are too long and finish red ferment The lower problem of female (Pichia Pastoris) exogenous origin gene integrator copy number.Currently, using expressed by Hansenula yeast system production Drug (such as insulin, trade name Wosulin) and HBV vaccine (trade name Hepavax-Gene) list marketing.

Summary of the invention

In the first aspect, the present invention provides a kind of recombination Hansenula yeast cells for generating expression HPV18 L1 albumen Method, it includes following steps:

A) by will include to encode the exogenous polynucleotide of the nucleotide sequence of HPV18 L1 albumen to be inserted into carrier and construct Expression construct；

B) Hansenula yeast cell is converted with the expression construct obtained in step a)；

C) the Hansenula yeast cell obtained in step b) is screened, obtains the recombination for containing the exogenous polynucleotide Hansenula yeast cell.

In the second aspect, the present invention also provides the recombination Hansenula yeast cells generated according to the above method.

In the third aspect, the present invention also provides a kind of methods for generating HPV18 L1 albumen, comprising the following steps:

I) recombination Hansenula yeast cell of the invention is cultivated under conditions of being suitable for HPV18 L1 protein expression；

Ii it) is recycled from culture and purifies HPV18 L1 albumen.

In terms of the last one, the present invention also provides the HPV18 L1 albumen generated according to the method for the present invention to prepare The purposes in vaccine for preventing HPV18 infection.

Detailed description of the invention

Fig. 1 in Hansenula yeast for expressing the carrier pRMHP2.1 structural schematic diagram of foreign protein.

Fig. 2A is using MOX promoter fragment as the Southern trace testing result of probe.With ATCC26012 genomic DNA For control.1: control (applied sample amount are as follows: 1000ng)；2: control (applied sample amount are as follows: 500ng)；3: control (applied sample amount are as follows: 250ng)； 4: control (applied sample amount are as follows: 125ng)；5:HP/pRMHP2.1-18wt genomic DNA (applied sample amount are as follows: 7.8125ng, brightness are situated between Between 500ng and 1000ng control)；6:HP/pRMHP2.1-18sc genomic DNA (applied sample amount are as follows: 7.8125ng, brightness Between 500ng and 1000ng control)；7:HP/pRMHP2.1-18pp genomic DNA (applied sample amount are as follows: 7.8125ng, it is bright Degree is between 250ng and 500ng control)；8:HP/pRMHP2.1-18hp genomic DNA (applied sample amount are as follows: 7.8125ng, Brightness is between 250ng and 500ng control)；9:HP/pRMHP2.1-18hp-1 genomic DNA (applied sample amount are as follows: 62.5ng, Its brightness is between 500ng and 1000ng control).

Fig. 2 B is using the genetic fragment of HPV18 L1 as the Southern trace testing result of probe.1:HP/pRMHP2.1- 18hp genomic DNA (applied sample amount are as follows: 16ng)；2:HP/pRMHP2.1-18hp genomic DNA (applied sample amount are as follows: 8ng)；3:HP/ PRMHP2.1-18hp genomic DNA (applied sample amount are as follows: 4ng)；4:HP/pRMHP2.1-18hp genomic DNA (applied sample amount are as follows: 2ng)；5:HP/pRMHP2.1-FMD18hp genomic DNA (applied sample amount are as follows: 8ng, HP/pRMHP2.1- of the brightness with 8ng 18hp genomic DNA)；6:HP/pRMHP2.1-FMD18hp genomic DNA (applied sample amount are as follows: 4ng, HP/ of the brightness with 4ng PRMHP2.1-18hp genomic DNA).

The SDS-PAGE result of Fig. 3 A HPV18 L1 albumen inducing expression in Escherichia coli.1: the control sample not induced Product；2 and 3:IPTG inducing expression sample；4: protein marker.

The purification result of the HPV18 L1 albumen of Fig. 3 B prokaryotic expression.1: protein marker；2: upper prop sample；3: flowing through Liquid；4: elution HPV18 L1 albumen.

Fig. 3 C rabbit polyclonal antibody prepares and purifies result.1: antiserum；2: flowing through liquid；3: antibody elution；4: albumen mark Will object.

The western blot detection of Fig. 4 different recombination Hansenula yeast cellular expression levels.1:HP/pRMHP2.1- 18wt；2:HP/pRMHP2.1-18sc；3:HP/pRMHP2.1-18hp-1 (optimizes, exogenous origin gene integrator is copied for Hansenula yeast Shellfish number is less than 15)；4:HP/pRMHP2.1-18pp；5:HP/pRMHP2.1-18hp (optimizes for Hansenula yeast, integrates copy number Greater than 31)；6:HP/pRMHP2.1-FMD18hp (optimizes, integrate copy number greater than 31, FMD promoter) for Hansenula yeast；7: Standard items (30 μ g/L)；8: pre-dyed protein marker.

The detection of expression of HPV18 L1 albumen in Fig. 5 fermentation process.1: standard items (30 μ g/L)；2: pre-dyed protein markers Object；3: first 2 hours of induction；4: induction 0 hour；5: induction 2 hours；6: induction 4 hours；7: induction 8 hours；8: induction 10 is small When.

The POROS 50HS of Fig. 6 A HPV18 L1 albumen purifies electrophoretogram.1: protein marker；2: upper prop sample；3: stream Wear liquid；4~7: different NaCl concentration elutions.

The CHT of Fig. 6 B HPV18 L1 albumen purifies electrophoretogram.1: protein marker；2: upper prop sample；3: flowing through liquid；4~ 8: different phosphate concn elutions.

The transmission electron microscope observing result of the HPV18 L1 albumen of Fig. 7 purifying.

Detailed description of the invention

U.S. Patent application US5,840,306 disclose expression of the HPV18 L1 albumen in saccharomyces cerevisiae, Chinese patent Application CN101487010 discloses expression of the HPV18 L1 albumen in Pichia pastoris, but utilizes expressed by Hansenula yeast HPV18 L1 albumen is there is not yet open report.The present inventor has been successfully set up the method for generating HPV18 L1 albumen using Hansenula yeast, Generated HPV18 L1 albumen can be self-assembled into virus-like particle, can be used for preparing the vaccine of prevention HPV infection.

Present invention firstly provides a kind of method of recombination Hansenula yeast cell for generating expression HPV18 L1 albumen, packets Containing following steps:

A) by will include to encode the exogenous polynucleotide of the nucleotide sequence of HPV18 L1 albumen to be inserted into carrier and construct Expression construct；

B) Hansenula yeast cell is converted with the expression construct obtained in step a)；

C) the Hansenula yeast cell obtained in step b) is screened, obtains the recombination for containing the exogenous polynucleotide Hansenula yeast cell.

The invention also includes the recombination Hansenula yeast cells generated according to the method.

Amino acid sequence from the HPV18 L1 albumen of different HPV18 Strain can have differences.The present inventor is logical It crosses and HPV18 L1 protein sequence all in database is compared, chosen on each amino acid position of HPV18 L1 albumen The highest amino acid residue of the frequency of occurrences, obtains the amino acid sequence for being shown in SEQ ID NO:1, which is HPV18 L1 egg White most representative consensus sequence.Therefore, the HPV18 L1 albumen in the present invention preferably has ammonia shown in SEQ ID NO:1 Base acid sequence.

In order to efficiently express HPV18 L1 albumen, inventor's ammonia according to shown in SEQ ID NO:1 using Hansenula yeast Base acid sequence carries out the codon optimization of nucleotide sequence for Hansenula yeast.Optimization principles include: a) to lose according to Hansenula yeast Do you pass password frequency of use table (http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi? species =4905) frequency of use highest or higher codon are selected；B) avoid having potential impact to genetic transcription or protein translation Negative regulatory element, such as the area PolyAT, the area PolyGC, the silencer area (Sliencer) and internal splice site；C) to including 5 ' It holds the mRNA secondary structure including the code area UTR, HPV18L1 and 3 ' end UTR to carry out comprehensive analysis, avoids complicated RNA second level knot The formation of structure reduces the free energy of mRNA secondary structure；D) it is used as far as possible and Hansenula yeast promoter in upstream of coding region The completely the same area 5'UTR of downstream native sequences；E) common restriction enzyme enzyme recognition site is eliminated.By the nucleosides of optimization Acid sequence is shown in SEQ ID NO:5.It is preferably SEQ that the nucleotide sequence of HPV18 L1 albumen is encoded used in the present invention Sequence shown in ID NO:5.

The present invention also provides a kind of new carriers in order to design and construct in expressed by Hansenula yeast foreign protein PRMHP2.1, structure is as shown in Figure 1, sequence is shown in SEQ ID NO:6.By that will include the nucleosides for encoding HPV18 L1 albumen The exogenous polynucleotide of acid sequence is cloned into pRMHP2.1 carrier, and expression construct of the invention can be obtained.Art technology Personnel are it is to be appreciated that expression construct of the invention can also use other vector constructions, such as the Chinese patent authorized Carrier described in CN100400665C.

In order to be expressed in Hansenula yeast, exogenous polynucleotide in the expression construct operably with promoter It is connected with terminator.

As used herein, the function connects for referring at least two polynucleotides " are operably connected ".For example, operably connecting It connects including the connection between promoter and another polynucleotides, wherein the promoter sequence originates and mediates this another is more The transcription of nucleotide.Operably connection includes the connection between terminator and another polynucleotides, wherein the terminator Terminate the transcription of another polynucleotides.

Being suitable for the invention promoter includes but is not limited to MOX, FMD, AOX1 and DHAS promoter.In some embodiment party In case, promoter used in the present invention is the MOX promoter from Hansenula yeast.In other embodiments, of the invention Used in promoter be the FMD promoter from Hansenula yeast.Being suitable for the invention terminator includes but is not limited to come from The MOX terminator of Hansenula yeast.

Expression construct is converted to Hansenula yeast cell can be carried out with a variety of methods known in the art, including but not It is limited to the conversion that electroporation and PEG are mediated.

In addition, developed in this field it is a variety of for expressing foreign protein Hansenula yeast bacterial strain, including but not limited to CGMCC2.2498 Hansenula yeast, ATCC34438 Hansenula yeast and ATCC26012 Hansenula yeast cell.These Hansenula yeast bacterial strains Also it can be applied to the present invention.In some embodiments, for converting the Hansenula yeast cell of expression construct of the invention It is ATCC26012 Hansenula yeast cell.

In post-conversion, recombination Hansenula yeast cell can be selected according to the resistant gene carried on carrier.It is suitable anti- Property gene includes but is not limited to Kan resistant gene and Zeocin resistant gene.According to used carrier, it is also possible to use nutrition Defect culture medium recombinates Hansenula yeast cell to screen.

Expression and its copy number in Hansenula yeast of the exogenous polynucleotide in Hansenula yeast are positively correlated.Cause This, further screening can also be carried out by the methods of Southern trace or quantitative PCR and contains multicopy external source multicore glycosides The recombination Hansenula yeast cell of acid.It is preferred that exogenous polynucleotide copy number is greater than 5 recombination Hansenula yeast cell, more preferable external source Polynucleotide copies number is greater than 30 recombination Hansenula yeast cell.

On the other hand, the present invention also provides a kind of methods for generating HPV18 L1 albumen, comprising the following steps:

I) recombination Hansenula yeast cell of the invention is cultivated under conditions of being suitable for HPV18 L1 protein expression；

Ii it) is recycled from culture and purifies HPV18 L1 albumen.

The various culture mediums and basic condition of culture known in the art that can be used for cultivating Hansenula yeast, those skilled in the art It can be selected or be modified as needed.The culture of recombination expressed by Hansenula yeast bacterial strain of the invention can according to required protein content To carry out in flask or be carried out in the bioreactor (fermentor of such as 30L) of different scales.It, can according to selected promoter With the expression for suitable inducer being added in culture to induce the HPV18 L1 albumen.Using MOX or FMD promoter In the case of, methanol is added as inducer.

Various protein purification modes known in the art, such as salt can be used in the purifying of generated HPV18 L1 albumen The combination of analysis, ultrafiltration, precipitating, chromatography etc. or these modes.In one embodiment, chromatography media POROS 50HS is used first (Applied Biosystems) carries out preliminary purification, followed by chromatography media Macro-Prep ceramic hydroxyapatite (Type II, 40 μm) is further purified.

The HPV18 L1 albumen of the purifying prepared using method of the invention can be self-assembled into virus-like particle (embodiment 10, Fig. 7) good immunogenicity (embodiment 11), and in mouse is shown, therefore present invention provides the HPV18 L1 albumen is in preparation for preventing the purposes in the vaccine that HPV18 infects.

Embodiment

The present invention will be further illustrated by way of embodiment below, but is not therefore limited the present invention to described Scope of embodiments in.

The analysis of embodiment 1:HPV18 L1 albumen consensus amino acid sequences

The HPV18 L1 albumen of overall length is made of 568 amino acid, and N-terminal lacks the truncated-type HPV18 of 61 amino acid L1 albumen (containing 507 amino acid) is applied in preventative vaccine.It is retrieved by GenBank, obtains contain 507 altogether HPV18L1 protein sequence 34 of 568 amino acid of a amino acid or overall length.Using Vector NTI software AlignX function into The analysis of row amino acid alignment, obtains most representative HPV18 L1 consensus amino acid sequences (consensus amino Acid sequence is all made of the sequence of the highest amino acid residue of probability of occurrence in each amino acid position of HPV18 L1 Column), sequence is as shown in SEQ ID NO:1.

Embodiment 2:HPV18 L1 encoding gene it is artificial synthesized

The present invention has synthesized 4 kinds of different HPV18 L1 nucleotide sequences altogether, be referred to as 18wt, 18sc, 18pp and 18hp:

1) 18wt- nucleosides identical with natural HPV18 L1 gene order shown in GenBank accession number ACU01871.1 Acid sequence is shown in SEQ ID NO:2；

2) 18sc- derives from U.S. Patent application US5, and the nucleotide sequence of 840,306 HPV18 L1 gene is shown in SEQ ID NO:3；

3) 18pp- is shown in from the nucleotide sequence of the HPV18 L1 gene of Chinese patent application CN101487010 SEQ ID NO:4；

4) 18hp- the present inventor amino acid sequence according to shown in SEQ ID NO:1, it is inclined for Hansenula yeast genetic code The nucleotide sequence of love property brand-new design, sequence are shown in SEQ ID NO:5.

According to the above nucleotide sequence, entrust Sinogenomax Co., Ltd. carry out respectively 18wt, The complete sequence of 18sc, 18pp and 18hp are artificial synthesized, are cloned in carrier T and (are respectively designated as T-18wt, T-18sc, T-18pp And T-18hp), and sequence verification is carried out to it.

The building of embodiment 3:pRMHP2.1 carrier

The present inventor designs and constructs the Hansenula yeast plasmid vector for being suitable for expressing foreign protein in Hansenula yeast PRMHP2.1, structure are as shown in Figure 1.

The plasmid construction process is as follows:

(1) building carries the skeleton carrier pKO of Kan tolerant gene expression box and ColE1 duplication sub-district

With pPIC3.5K plasmid (Invitrogen company) for template, expanding acquisition size with primer 2 with primer 1 is The ColE1 of 888bp replicates sub-district, while introducing BglIII restriction enzyme site in upstream, and downstream introduces KpnI restriction enzyme site；

Primer 1:5 '-GAagatctTACGGTTATCCACAGAATCAGG-3 ' (SEQ ID NO:7)

Primer 2: 5'-GGGGTACCTAAGCATTGGTAACTGTCAGAC-3 ' (SEQ ID NO:8)

With plasmid pPIC3.5K (Invitrogen company) for template, expanding acquisition size with primer 4 with primer 3 is The Kan tolerant gene expression box of 1217bp, the Kan resistant gene derive from transposons Tn903, anti-card are showed in Escherichia coli That chloramphenicol resistance shows anti-G418 resistance in yeast, introduces while expanding the Kan tolerant gene expression box in upstream BglII restriction enzyme site, downstream introduce KpnI restriction enzyme site；

Primer 3:5'-GAagatctGAAAGCCACGTTGTGTCTCAAAATC-3 ' (SEQ ID NO:9)

Primer 4:5 '-GGGGTACCcctcgtgaagaaggtgttgctg-3 ' (SEQ ID NO:10)

Kan tolerant gene expression box and ColE1 are replicated sub-district by BglII+KpnI double digestion to be attached, construct bone Frame carrier pKO.

(2) building of the PCR amplification of Zeocin resistance expression box and recombinant vector pKO-Zeo

Using the mixed genomic DNA of Hansenula yeast strains A TCC26012 and ATCC34438 as template, with primer 5 and primer 6 amplifications obtain the GADPH promoter region that size is 609bp, while introducing BglII and NotI restriction enzyme site in upstream；

Primer 5:5 '-GAagatctAAGGAAAAAAGCGGCCGCGTTGGTCTAGACTACATCCGTGCAC-3 ' (SEQ ID NO:11)

Primer 6:5'-ATTGTTTCTATATTATCTTTGTAC-3 ' (SEQ ID NO:12)

Using the mixed genomic DNA of Hansenula yeast strains A TCC26012 and ATCC34438 as template, with primer 7 and primer 8 amplifications obtain the GADPH terminator district that size is 234bp, while introducing BamHI, EcoRV, PstI and EcoRI digestion in downstream Site；

Primer 7:5'-GCACGGCCTCATCTACATATTTACG-3 ' (SEQ ID NO:13)

Primer 8:5 '-CGGGATCCGATATCctatcctgcagaaaagaattcGGACCACAATCCAAATAAAGA AAG- 3 ' (SEQ ID NO:14)

With pPICZ α plasmid (Invitrogen company) for template, obtaining size with primer 9 and the amplification of primer 10 is 424bp Zeocin resistant gene, while introducing the overlap that GADPH promoter region 3 ' is held in upstream, it is whole to introduce GADPH in downstream The only overlay region at 5 ' end of son；

Primer 9:5'-TAGTACAAAGATAATATAGAAACAATATGGCCAAGTTGACCAGTG-3 ' (SEQ ID NO: 15)

Primer 10:5'-TAAATATGTAGATGAGGCCGTGCTCAGTCCTGCTCCTCGGC-3 ' (SEQ ID NO:16)

It is with 3 segments (GAPDH promoter region, Zeocin resistant gene and GAPDH terminator district) of above-mentioned PCR amplification Template obtains size with primer 5 and the amplification of primer 8 as the Zeocin tolerant gene expression box of 1218bp, while carrying in upstream BglII and NotI restriction enzyme site carries BamHI, EcoRV, PstI and EcoRI restriction enzyme site in downstream.

By BglII+BamHI double digestion Zeocin tolerant gene expression box, and with BglII single endonuclease digestion and after dephosphorylation PKO carrier be attached, construction recombination plasmid pKO-Zeo.

(3) building of the PCR amplification of HARS1 segment and recombinant vector pRMHP1.1

Using the mixed genomic DNA of Hansenula yeast strains A TCC26012 and ATCC34438 as template, with primer 11 with draw The amplification of object 12 obtains the HARS1 segment that size is 544bp, while introducing PstI restriction enzyme site in upstream, introduces in downstream EcoRI, SacI and NdeI restriction enzyme site；

Primer 11:5'-aaaactgcagGtcgactcccgcgactcggcgttcactttc-3 ' (SEQ ID NO:17)

Primer 12:5'-GGaattcTAGGGAGCTCccaattccatatgtcgacAAACCCGCGTTTGAG AACTTGC TC-3 ' (SEQ ID NO:18)

HARS1 segment is cloned into pKO-Zeo carrier by EcoRI+PstI double digestion, constructs recombinant vector pRMHP1.1。

(4) building of the PCR amplification of 18S rDNA sequence and recombinant vector pRMHP2.1

Using the mixed genomic DNA of Hansenula yeast strains A TCC26012 and ATCC34438 as template, with primer 13 with draw The amplification of object 14 obtains the 18S rDNA sequence that size is 2.4Kb, while introducing NdeI restriction enzyme site in upstream, introduces in downstream EcoRI restriction enzyme site；

Primer 13:5'-ggaattccatatgGGGTTTAGACCGTCGTGAGACAGG-3 ' (SEQ ID NO:19)

Primer 14:5'-ggaattcTTGCCATAGGCTAGTAATCC-3 ' (SEQ ID NO:20)

18S rDNA segment is cloned into pRMHP1.1 carrier by EcoRI+NdeI double digestion, constructs recombinant vector pRMHP2.1。

Polymorpha expression vector pRMHP2.1 nucleotides sequence constructed by the present invention is shown in SEQ ID NO:6, Fig. 1 and is Its structural schematic diagram.

Embodiment 4: generating expression construct (1) the MOX promoter for carrying different HPV18 L1 nucleotide sequences and MOX is whole Only sub PCR amplification

Using the mixed genomic DNA of Hansenula yeast strains A TCC26012 and ATCC34438 as template, with primer 15 with draw The amplification of object 16 obtains the MOX promoter that size is 1518bp, while introducing NotI restriction enzyme site in upstream；

Primer 15:5'-AAGGAAAAAAGCGGCCGCAACGATCTCCTCGAGCTGCTCGC-3 ' (SEQ ID NO:21)

Primer 16:5'-TTTGTTTTTGTACTTTAGATTGATGTC-3 ' (SEQ ID NO:22)

Using the mixed genomic DNA of Hansenula yeast strains A TCC26012 and ATCC34438 as template, with primer 17 with draw The amplification of object 18 obtains the MOX terminator that size is 311bp, while introducing BglII restriction enzyme site in downstream；

Primer 17:5'-GGAGACGTGGAAGGACATACCGC-3 ' (SEQ ID NO:23)

Primer 18:5 '-GAagatctCAATCTCCGGAATGGTGATCTG-3 ' (SEQ ID NO:24)

(2) expression construct for carrying different HPV18 L1 nucleotide sequences is generated

To carry the recombinant plasmid T-18wt of 18wt as template, obtaining size with primer 19 and the amplification of primer 20 is 1572bp HPV18 L1 gene, while upstream introduce MOX promoter region 3 ' hold overlap, downstream introduce MOX terminator 5 ' The overlay region at end；

Primer 19:5'-CATCAATCTAAAGTACAAAAACAAAATGGCTTTGTGGCGGCCTAGTGACA -3 ' (SEQ ID NO:25)

Primer 2 0:5 '-GCGGTATGTCCTTCCACGTCTCCTTACTTCCTGGCACGTACACGCACA-3 ' (SEQ ID NO:26)

To carry the recombinant plasmid T-18sc of 18sc as template, obtaining size with primer 21 and the amplification of primer 22 is 1572bp HPV18 L1 gene, while upstream introduce MOX promoter region 3 ' hold overlap, downstream introduce MOX terminator 5 ' The overlay region at end；

3 ' (SEQ of primer 2 1:5'-CATCAATCTAAAGTACAAAAACAAAATGGCTTTGTGGCGGCCTAGTGACA- ID NO:27)

Primer 2 2:5'-GCGGTATGTCCTTCCACGTCTCCTTACTTCCTGGCACGTACACGCACA-3 ' (SEQ ID NO:28)

Using the recombinant plasmid T-18pp for carrying 18pp as template, it is primer with primer 23 and primer 24, expands and obtain size For the HPV18 L1 gene of 1572bp, while the overlap that MOX promoter region 3 ' is held is introduced in upstream, introduces MOX in downstream The overlay region that terminator 5 ' is held；

3 ' (SEQ of primer 2 3:5'-CATCAATCTAAAGTACAAAAACAAAATGGCTTTGTGGAGACCTTCTGACA- ID NO:29)

Primer 2 4:5'-GCGGTATGTCCTTCCACGTCTCCTTACTTTCTAGCTCTAACTCTAACT-3 ' (SEQ ID NO:30)

Using the recombinant plasmid T-18hp for carrying 18hp as template, it is primer with primer 25 and primer 26, expands and obtain size For the HPV18 L1 gene of 1572bp, while the overlap that MOX promoter region 3 ' is held is introduced in upstream, introduces MOX in downstream The overlay region that terminator 5 ' is held；

Primer 2 5:5 '-CATCAATCTAAAGTACAAAAACAAAATGGCTTTGTGGAGACCATCAGACA-3 ' (SEQ ID NO:31)

Primer 2 6:5'-GCGGTATGTCCTTCCACGTCTCCTTACTTGCGAGCTCTGACCCTCACT-3 ' (SEQ ID NO:32)

Respectively with above-mentioned PCR amplification obtain 3 segments (MOX promoter, 18wt gene/18sc gene/18pp gene/ 18hp gene, MOX terminator) be template, with primer 15 and primer 18 amplification obtain size for 3.4Kb 18wt expression cassette/ 18sc expression cassette/18pp expression cassette/18hp expression cassette, while NotI restriction enzyme site is carried in upstream, BglII enzyme is carried in downstream Enzyme site.

18wt expression cassette, 18sc expression cassette, 18pp expression cassette and 18hp are expressed respectively by NotI+BglII double digestion Box is cloned into pRMHP2.1 carrier, obtains expression construct pRMHP2.1-18wt, pRMHP2.1-18sc, pRMHP2.1- 18pp and pRMHP2.1-18hp.

(3) generation of the HPV18 L1 construct of FMD promoter is carried

Using the mixed genomic DNA of Hansenula yeast strains A TCC26012 and ATCC34438 as template, with primer 27 with draw The amplification of object 28 obtains the FMD promoter region that size is 1115bp, while introducing NotI restriction enzyme site in upstream, introduces in downstream Hp18 gene 5 ' end overlay region；

Primer 2 7:5 '-ATAAGAATGCGGCCGCGGATCCAGGAAGCGCAACGACG-3 ' (SEQ ID NO:33)

Primer 2 8:5 '-TGTCTGATGGTCTCCACAAAGCCATGATTTGATTGATGAAGGCAGAG-3 ' (SEQ ID NO:34)

Using recombinant plasmid pRMHP2.1-18hp as template, obtaining size with primer 29 and the amplification of primer 30 is 1835bp's 18hp gene and MOX terminator district, while BglII restriction enzyme site is introduced in downstream；

Primer 2 9:5'-ATGGCTTTGTGGAGACCATCAGACA-3 ' (SEQ ID NO:35)

Primer 30:5'-GAagatctCAATCTCCGGAATGGTGATCTG-3 ' (SEQ ID NO:36)

Using the FMD promoter region of above-mentioned PCR amplification acquisition, 18hp and MOX terminator district as template, with primer 27 and primer 30 amplifications obtain the 18hp expression cassette (FMD promoter) that size is 2.9Kb, while carrying NotI restriction enzyme site in upstream, under Trip carries BglII restriction enzyme site.

It is cloned into pRMHP2.1 carrier by the 18hp expression cassette that NotI+BglII double digestion carries FMD promoter, structure Build recombination expressed by Hansenula yeast plasmid pRMHP2.1-FMD18hp.

Embodiment 5: the generation of recombination Hansenula yeast cell

(1) extraction and digestion of recombinant expression construct constitution grain

Picking is transformed into the E. coli clones of the recombinant expression construct constitution grain obtained in embodiment 4, after expanding culture Plasmid is extracted using E.Z.N.A Plasmid Mini Kit kit (Omega Bio-Tek company), and is carried out with Bgl II Single endonuclease digestion is recycled using E.Z.N.A Gel Extraction Kit kit (OmegaBio-Tek company), with 50 μ L It is preheated to 55 DEG C of sterile water to be eluted, it is quantitative to carry out DNA by measurement OD260, and the segment of linearisation is diluted to 100ng/ μ l, is stored in -20 DEG C of refrigerators, spare.

(2) processing of Hansenula yeast cell

Picking Hansenula yeast strains A TCC26012 single colonie accesses in the small test tube of the YPD fluid nutrient medium containing 5ml, 37 DEG C culture 10-12 hours；Take bacterium solution 5ml to be forwarded in 200mlYPD culture medium, 37 DEG C culture 4-5 hours, until OD600 is about 1.2-1.5 being centrifuged 10min in 4000rpm；With 200ml 0.1mol/L phosphate buffer (DTT containing 25mmol/L, pH7.5) Thallus is resuspended, mixes well, is centrifuged 10min in 37 DEG C of incubations 30min, 4000rpm, abandons supernatant, stay thallus.With the STM of pre-cooling Solution 200ml washes thallus, and thallus pressure-vaccum is uniform, is centrifuged 3min in 4 DEG C of 4000rpm, abandons supernatant, stay precipitating.It is molten with ice-cold STM Thallus is resuspended in liquid 100ml, is centrifuged 3min in 4 DEG C of 4000rpm, abandons supernatant, stay precipitating.It is ice-cold with 80-200 μ l according to biomass Thallus is resuspended in STM solution, and bacterium solution is transferred in the centrifuge tube after high pressure, and ice bath prepares conversion.

(3) electrotransformation of Hansenula yeast cell

By plasmid: thallus=1: 2 amount, which is added, recombinates 15 μ l of expressed by Hansenula yeast plasmid, 30 μ l of bacterium solution, and abundant pressure-vaccum is equal It is even, it is placed in be transformed in ice bath；It will be impregnated in advance with alcohol, and after ultraviolet irradiation, take out, add in the electric revolving cup that -20 DEG C refrigerate Enter plasmid thallus mixed liquor；It shocks by electricity by the condition of voltage 2500V, 150 Ω of resistance, 50 μ F of capacitor；It is rapidly added after electric shock 1ml has been balanced to the YPD solution of room temperature, is transferred in EP pipe after mixing gently；Thallus after electricity is turned is put in 37 DEG C of water-baths 1h is set, is gently overturned 3 times at interval of 15min；It will be incubated for the bacterium solution of 1h, has been centrifuged 10min in 4000rpm, abandons supernatant；With 200 μ Thallus is resuspended in lYPD solution, is coated in the YPD plate of the Zeocin containing 0.25mg/ml with 100 μ l/ plates, cultivates in 37 DEG C of inversions 3-5 days.

(4) passage, the stabilization of expressed by Hansenula yeast bacterial strain are recombinated

The recombinant bacterial strain single colonie grown in picking Zeocin resistant panel, is inoculated in 5ml Zeocin containing 0.25mg/ml YPD fluid nutrient medium in, in 37 DEG C, 200rpm shaking table culture 24-36 hours, until OD value is up to after 50, with 1: 1000 ratio It transfers in the YPD fluid nutrient medium of 5ml Zeocin containing 0.25mg/ml, culture to OD value is up to after 50, then with 1: 1000 ratio Example is transferred in the YPD fluid nutrient medium of 5ml Zeocin containing 0.25mg/ml, and so on, it is continuous to pass 10 times and carry out strain Preservation.Preservation system is bacterium solution: 60% glycerol=1: 1, amount saves strain as needed, usually+400 μ of 400 μ l bacterium solution L60% glycerol；

The recombination expressed by Hansenula yeast bacterial strain access 5ml for reaching 10 times is free of to the YPD fluid nutrient medium of Zeocin resistance In, in 37 DEG C, 200rpm shaking table culture to OD value up to after 50, transferred in 5ml YPD fluid nutrient medium with 1: 1000 ratio, And so on, it is continuously passed 5 times in the YPD fluid nutrient medium without Zeocin resistance.

By the YPD plate of bacterium solution coating G418 containing 10mg/ml after stabilization, cultivates 2-3 days in 32 DEG C of inversions, put down from each The eugonic single colonie of picking carries out copy number detection in plate.

Embodiment 6: the exogenous polynucleotide copy number detection of recombination Hansenula yeast cell

(1) extraction of pastoris genomic dna and quantitative

The eugonic yeast strain single bacterium that inoculation embodiment 5 obtains, which is fallen in the YPD fluid nutrient medium of 5ml, cultivates Base, 37 DEG C of cultures 16~for 24 hours；2ml Yeast Cultivation liquid is taken, room temperature 4500g is centrifuged 3min and collects thallus；It is molten using 500 μ l SCED Bacterium is resuspended in liquid (1mol/L sorbierite, 10mmol/L sodium citrate, 10mmol/L EDTA, 10mmol/L DTT dithiothreitol (DTT)) Body, and 50mg bead is added, 5min fullys shake, 50 μ l 10mg/ml lywallzymes, 37 DEG C of warm bath 1h are added；It is added 60 μ l's 10%SDS, the Proteinase K of 30 μ l, the RNaseA enzyme of 10 μ l are placed at room temperature for and cultivate 2h in 55 DEG C of water-bath after ten minutes；Add Enter 350 μ l saturated phenols and 350 μ l chloroforms, in 13000rpm after being sufficiently mixed, is centrifuged 10 minutes, the upper liquid after collecting layering； Isometric (about 700 μ l) chloroform is added, in 13000rpm, is centrifuged 10 minutes, the upper liquid after collecting layering；Add into upper liquid The 3mol/L sodium acetate solution for entering 140 μ l adds 700 μ l isopropanols, is placed at room temperature for 5min after mixing after mixing gently, in 13000rpm is centrifuged 10 minutes.Supernatant is abandoned, 70% ethyl alcohol of 1ml is added and is cleaned, in 13000rpm, is centrifuged 10 minutes, Remove supernatant, DNA precipitating is placed in be placed at room temperature for 30min after, 100 μ l TE dissolution is added.Genomic DNA is carried out by measurement OD260 Quantify, and the segment of linearisation is diluted to 100ng/ μ l, is stored in -20 DEG C of refrigerators, it is spare.

(2) Southern immunoblot method carries out quantifying for exogenous polynucleotide copy number

A: probe preparation

I) PCR amplification of MOX promoter region segment

Using pRMHP2.1-18hp as template, size is obtained as the MOX promoter of 493bp with primer 31 and the amplification of primer 32 Area；

Primer 31:5'-CGTAGTACTTGTTCGCGTCGCTGTA-3 ' (SEQ ID NO:37)

Primer 32:5'-GCAGTGGACGACCTCATGGTAAACT-3 ' (SEQ ID NO:38)

Ii) the PCR amplification of HPV18L1 genetic fragment

Using pRMHP2.1-18hp as template, size is obtained as the HPV18L1 base of 481bp with primer 33 and the amplification of primer 34 Because of segment；

Primer 33:5 '-GCTGGTGGAGGTAACAAACAGGACA-3 ' (SEQ ID NO:39)

Primer 34:5 '-GCAACGTAGAGAAATCCATCGCACC-3 ' (SEQ ID NO:40)

Iii) prepared by probe

Using Roche company DIG DNA Labeling and Detection kit kit (Cat No: 11093657910) probe preparation is carried out.Specific steps are as follows: the 10 above-mentioned PCR products of μ l (200ng/ μ l) are added into EP tubule, And sealed up with sealed membrane, boiling water boils 10 minutes.It is immediately placed in the dehydrated alcohol capsule of pre-cooling (- 20 DEG C) and (cools down suddenly). Pipe outer wall ethyl alcohol is dried, is centrifuged (about 10s), sequentially adds 5 μ l tiny electrolytic cell water, 2 μ l 10x Hexanucleotide Mix, 2 μ l 10x dTP Labeling Mixture, 1 μ l 7Klenow Enzyme (1abeling grade) are mixed, sealing Film sealing.37 DEG C of water-baths are stayed overnight, -20 DEG C of preservations.

B:Southern trace

Using digoxin hybridization check kit I (the Cat No:DIGD- of Beijing Mei Laibo medical science and technology Co., Ltd 110) and the efficient hybridization solution of HyB (Cat No:Hyb-500) is according to product description progress Southern trace detection.

3) copy number of different recombination Hansenula yeast bacterial strains compares

Using the Southern trace testing result that MOX promoter region segment is probe as shown in Fig. 2A, as the result is shown: HP/pRMHP2.1-18wt bacterial strain is (through passage and stabilizing step after recombinant plasmid pRMHP2.1-18wt electrotransformation, in 10mg/ml G418 plate in screen obtain) copy number be greater than 63；HP/pRMHP2.1-18sc bacterial strain (recombinant plasmid pRMHP2.1-18sc After electrotransformation through passage and stabilizing step, in the g418 plate of 10mg/ml screen obtain) copy number be greater than 63；HP/ PRMHP2.1-18pp bacterial strain is (through passage and stabilizing step after recombinant plasmid pRMHP2.1-18pp electrotransformation, in 10mg/ml's In g418 plate screen obtain) copy number be greater than 31；HP/pRMHP2.1-18hp bacterial strain (recombinant plasmid pRMHP2.1-18hp electricity After conversion through passage and stabilizing step, in the g418 resistance of 10mg/ml screen obtain) copy number be greater than 31；HP/ PRMHP2.1-18hp-2 bacterial strain is (through passage and stabilizing step after recombinant plasmid pRMHP2.1-18hp electrotransformation, in 1mg/ml's Screening and obtain in g418 plate) copy number is greater than 7 but less than 15.

Using the Southern trace testing result that HPV18L1 genetic fragment is probe as shown in Fig. 2 B, as the result is shown: HP/pRMHP2.1-FMD18hp bacterial strain (after recombinant plasmid pRMHP2.1-FMD18hp Electroporation Transformation through passage and stabilizing step, Screen and obtain in the g418 plate of 10mg/ml) exogenous polynucleotide integrates copy number and HP/pRMHP2.1-18hp bacterial strain phase Closely.

The preparation of the prokaryotic expression and rabbit polyclonal antibody of embodiment 7:HPV18 L1 albumen

(1) PCR amplification of HPV18 L1 gene and expression plasmid clone's building

Using pRMHP2.1-18pp as template, size is obtained as the HPV18L1 base of 1540bp with primer 35 and the amplification of primer 36 NdeI restriction enzyme site is introduced because of segment (without terminator codon), while in upstream, introduces XhoI in downstream；

Primer 35:5 '-ggaattccatATGGCTTTGTGGAGACCTTCTGACA-3 ' (SEQ ID NO:41)

Primer 36:5 '-CCGCTCGAGCTTTCTAGCTCTAACTCTAACT-3 ' (SEQ ID NO:42)

18pp gene fragment clone is entered in pET43.1a carrier (Novagen company) by NdeI+XhoI double digestion, it will The correct recombinant plasmid of sequence verification is named as pET43.1a-18pp.

(2) inducing expression of the HPV18 L1 albumen in Escherichia coli

Recombinant plasmid pET43.1a-18pp converts E. coli expression strains BL21-CodonPlus (DE3)-RIPL, obtains Engineering bacteria BL21-CodonPlus (DE3)-RIPL/pET43.1a-18pp must be expressed.Picking single colonie accesses the liquid of LB containing 5ml In the test tube of culture medium (the 50 μ g/ml containing Amp), IPTG is added to final concentration in 37 DEG C of cultures to OD600 when being about 0.8 0.5mmol/L, induction time 4h, while the control tube that setting does not induce.Bacterium solution is collected, SDS-PAGE detects recombinant protein Expression (Fig. 3 A).

(3) purifying of HPV18 L1 albumen

Preparation of samples: picking expression engineering bacteria BL21-CodonPlus (DE3)-RIPL/pET43.1a-18pp single colonie connects In the test tube for entering LB liquid medium containing 5ml (the 50 μ g/ml containing Amp), 37 DEG C of overnight incubations, next day is connect by 1% inoculum concentration In the 1L triangular flask for entering LB liquid medium containing 400ml (the 50 μ g/ml containing Amp), until IPTG is added extremely when OD600 is about 0.8 Final concentration 0.5mmol/L collects bacterium solution after inducing 4h and is centrifuged, bacterial sediment is resuspended in PBS in the ratio of 1: 10 (g/ml) Precipitating is collected by centrifugation in solution, carrying out ultrasonic bacteria breaking (5s, 5s, 400W, the 60cycles) under ice bath, 8000r/min centrifugation 15min.

Purification process (Fig. 3 B): solution (50mM phosphate, 500mM is added in the ratio of 1: 10 (g/ml) in ultrasound precipitation NaCl, 20mM imidazoles, 8M urea, pH8.0) in be sufficiently stirred dissolution, 8000r/min is centrifuged 15min, collects 0.45 μm of film mistake of supernatant Filter.It is splined on Chelating Sepharose FF chromatography media, with solution (50mM phosphate, 150mM NaCl, 500mM miaow Azoles, 8M urea, pH8.0) elution, collect destination protein eluting peak.Dialysis removal imidazoles.

(4) prepared by rabbit polyclonal antibody

Rabbit is immunized and serum collection: with 2 new zealand rabbits of HPV18 L1 protein immunization of the prokaryotic expression of purifying, exempting from Epidemic disease method uses back multi-point injection method, and immune programme is the 0th, 3,6,8 week each immune primary, and immunizing dose is 250 μ g/ Secondary, antigen need to be injected again after Freund's complete adjuvant (FCA) or incomplete Freund's adjuvant (FIA) are fully emulsified, exempt from for the first time Epidemic disease application FCA, follow-up immunization application FIA were taken a blood sample by arteria carotis in the 9th week and separate serum, and every rabbit can separate serum 40-60ml。

Antibody purification (Fig. 3 C): antiserum is after 0.45 μm of filtering, and upper prop is in chromatography media rProtein A Sepharose FF carries out affinitive layer purification.Under pH neutrallty condition, antibody is incorporated on chromatography media, with citric acid-lemon Lemon acid sodium buffer (pH4.0) elution, collects antibody elution peak, and 1M Tris.Cl, pH9.0 is used to neutralize to pH neutrality immediately.

Embodiment 8: the expression study of difference recombination Hansenula yeast bacterial strain

(1) inducing expression of Hansenula yeast bacterial strain is recombinated

Picking recombinates Hansenula yeast single colonie from plate, accesses in the small test tube of the YPG fluid nutrient medium containing 5ml, 37 DEG C culture 18-24 hours；By bacterium solution switching in the 500ml triangular flask of the induced medium of YPM containing 100ml, initial density is OD600nm=1 induces 72 hours in 37 DEG C of shaking tables, final concentration of 0.5% methanol solution was added in bacterium solution every 12 hours (i.e. 0.5ml/ bottles).

Bacterium solution after taking 25ml to induce is transferred in the centrifuge tube of 50ml, is centrifuged 10min in 8000rpm, is abandoned supernatant；With Bacterial sediment is resuspended in the cell cracking of 50ml, after mixing well, presses in Ultrasound Instrument and " power 60%, time 20min, opens 5s, closes The ultrasonication program of 5s " carries out bacterial cell disruption, needs to keep ice bath in shattering process；By the bacterium solution of ultrasonication, in 8000rpm It is centrifuged 10min, collection supernatant freezes spare in -20 DEG C.

(2) detection of expression of Hansenula yeast bacterial strain HPV18 L1 albumen is recombinated

The detection of HPV18 L1 protein expression level is carried out using western blot semi-quantitative method

Glue and electrophoresis: preparing 12% polyacrylamide gel, measuring samples and standard items is added, upper layer glue is with 8V/ The voltage of cm, separation gel carry out electrophoresis with the voltage of 15V/cm, until stopping electrophoresis when bromophenol blue reaches separation gel bottom, cutting Separation gel；

Semidry method transferring film: pvdf membrane first uses methyl alcohol process 15 seconds, is soaked into positive liquid again extremely after being rinsed 3 times with deionized water Few 5min；Running gel is soaked in negative electrode solution, installs electrotransfer device in order, and the electric current of 150mA carries out electricity and turns 35-45min； After the completion of transferring film, check whether pre-dyed protein marker band is completely transferred.

Closing: film is added in the valve bag for having 5% milk of 20ml with tweezers, bubble is squeezed out, uses plastic film sealing Machine sealing.Shaking table shakes closing 1 hour slowly or (should be put into refrigerator cold-storage preservation overnight) overnight.

Primary antibody is incubated for: the rabbit-anti HPV18 L1 albumen prepared mostly anti-be added with 1/200 ratio is filled 5% milk Valve bag in, film is put into after mixing, squeeze out bubble, sealed with plastic film sealing machine.Shaking table shakes incubation 1.5 hours slowly.

It washes film: taking the film out and washed 5 times with TBST, about 100ml, time are 5 minutes every time.Last time is 10 minutes.

Secondary antibody is incubated for: the goat-anti rabbit secondary antibody of HRP label is added to the valve bag for filling 5% milk with 1/1000 ratio In, film is put into after mixing, bubble is squeezed out, is sealed with plastic film sealing machine.Shaking table shakes incubation 2 hours slowly.

It washes film: taking the film out and washed 5 times with TBST, about 100ml, time are 5 minutes every time.Last time is 10 minutes.

Colour developing: film is put into developing solution, and shaking table, which is shaken slowly to band, to be occurred, and is rinsed color development stopping with flowing water, is dried laggard Row is taken pictures.

(3) result

It compares and integrates the influence that copy number expresses HPV18 L1 albumen in Hansenula yeast bacterial strain, it can be in Fig. 4 Observe that the expression of the higher HP/pRMHP2.1-18hp bacterial strain of copy number (copy number is greater than 31) is apparently higher than HP/ PRMHP2.1-18hp-1 bacterial strain (copy number is greater than 7 but less than 15), display copy number has HPV18L1 protein expression level Direct to influence, the expression of height copy integron is higher than low-copy integron.

For the expression of different HPV18 L1 genes, HPV natural gene 18wt, the 18sc expressed for saccharomyces cerevisiae And the expression of the 18pp for Pichia anomala expression is well below the gene 18hp for being directed to Hansenula yeast optimization design (Fig. 4), display is for Hansenula yeast host genetic codon bias complex optimum for HPV18 L1 albumen in Hansenula yeast bacterium Realize that high level expression is vital in strain.

For FMD promoter, western blot as the result is shown its also can efficiently induce HPV18L1 protein expression, express water It is flat close with MOX promoter.

Embodiment 9:HPV18 L1 recombinates zymotechnique and the purifying process research of Hansenula yeast bacterial strain

Fermentation seed liquid: 1 is taken to freeze glycerol stock (HP/pRMHP2.1-18hp).100 μ l access 5ml is drawn after thawing In YPD culture medium, 200rpm (rev/min), 30 DEG C of culture 20hr, A600nm about 2-3 respectively draw 1ml access 2 after assay approval In bottle 500ml YPD culture medium, 200rpm, 30 DEG C of culture 20hr.A600nm about 10-15 is used as fermentation seed after assay approval Liquid is stand-by.

Ferment control: fermentation initial culture medium contains yeast powder 300g, peptone 150g, glycerol 100g, basic salt (K₂SO₄ 273g, MgSO₄100g, 85%H₃PO₄400ml, KOH 62g), 10L purified water sufficiently dissolves, and 30L fermentor (Shanghai is added Hundred logical sequences) in, purified water is settled to 14L, and 121 DEG C, 60ml PTM1 liquid microelement is added in 30min sterilizing after being cooled to 30 DEG C (CuSO₄·5H₂O 6.0, KI 0.088g, MnSO₄·H₂O 3.0g, Na₂MoO₄·2H₂O 0.2g, H₃BO₃0.02g, CoCl₂· 6H₂O 0.5g, ZnCl₂20.0g FeSO₄·7H₂O 65.0g, Biotin 0.2g, dense H₂SO₄5.0ml, purified water are settled to 1L, 0.22 μm of membrane filtration degerming), ammonium hydroxide adjusts pH5.5, is inoculated with 2 bottles of 500ml fermentation seed liquids, fermentation volume is at this time 15L.Starting speed of agitator is 200rpm, air mass flow 0.5Nm3/hr, tank press 0.5bar, and control oxygen dissolving value is 20- in fermentation 80%.After the initial growth phase maintains about 19hr, bacterium solution A_600nmReach 20 or so, dissolved oxygen starts rapid increase, starts with 100ml/ Hr flow velocity flow feeding culture medium (50% glycerol (W/V), 12ml PTM1) enters stream plus growth period at this time.After cultivating about 6hr, Bacterium solution A_600nmReach 80 or so, stop stream and add, ammonium hydroxide adjusts pH value to 6.0.Start stream after dissolved oxygen bottom out plus methanol (contains 12ml/L PTM1) enter the inducing expression phase, the initial flow rate of methanol is 50ml/hr, is sampled per hour, methanol electrode (East China Science and engineering) measurement methanol concentration, by adjusting methanol feeding rate control methanol concentration < 5g/L, and collect wet thallus ultrasonication Afterwards for western blot detection (5 times of sample dilutions), western blot testing result is as shown in Figure 5.

Lower tank centrifugation: after induction 10hr, lower tank, 6000rpm, 4 DEG C, 30min (centrifuge model Beckman J-26XP, Rotor model JLA 8.1000) wet thallus is collected by centrifugation.- 20 DEG C of wet thallus of harvest freeze.

Bacterial cell disruption: taking the HPV 18 of -20 DEG C of preservations to express wet thallus, is added according to the ratio of 10ml/g wet thallus The cleaning of 0.9% physiological saline.After cell washing, disruption buffer is added by 20ml buffer/g wet thallus and (contains 0.5mol/L NaCl, 0.02% Tween-80,0.05mol/L MOPS) sufficiently dissolution, use high-pressure homogenization (high pressure homogenizer model Niro NS1001L2K it) is crushed, cracking pressure 1500bar, circulation is 5 times broken, microscopy percentage of damage > 90%.Bacterial cell disruption liquid warp 8000rpm, 4 DEG C, supernatant is collected by centrifugation in 30min (centrifuge model Beckman J-26XP, rotor model JA-10), is added 45% ammonium sulfate precipitation 30min, 8000rpm, 4 DEG C, 30min (centrifuge model Beckman J-26XP, rotor model JA-10) Supernatant is collected by centrifugation.

Chromatographic purifying: the bacterial cell disruption supernatant filtered through 1 μm is splined on chromatography media POROS 50HS (Applied Biosystems), destination protein is adsorbed on chromatography media, and 0.5M~1.5M NaCl gradient elution, destination protein is obtained with impurity Initial gross separation is obtained, the HPV18 L1 albumen (Fig. 6 A) of elution is collected.The just pure HPV18 L1 VLPs albumen of this step is splined on layer Medium Macro-Prep ceramic hydroxyapatite (Type II, 40 μm) is analysed, destination protein is incorporated on chromatography media, 20~ 200mM phosphate concn gradient elution, destination protein are separated with impurity, collect the HPV18 L1 albumen (Fig. 6 B) of elution.

Embodiment 10: the HPV18 L1 recombinant protein of transmission electron microscope observing purifying

With the HPV18 L1 protein sample of 2 times of sterile water dilutions after purification, a droplet is dripped on cured disk.Copper mesh is taken to make have branch The surface for holding film is contacted with sample liquid surface, is stood 1min and is taken out, takes out copper mesh, extra drop is absorbed with filter paper item, is slightly dried in the air It is dry.2% acetic acid uranium solution is taken, drips a droplet on cured disk.The copper mesh for being adsorbed with sample is placed in dye liquor surface (sample and dye liquor Contact), stand 2min.Copper mesh is taken out, extra drop is absorbed with filter paper item, is dried under incandescent lamp.Using JEOL-1400 model Transmission electron microscope (Japan Electronics) observation VLP particle shape is simultaneously taken pictures (shown in result figure 7).

Embodiment 11: with the immunogenicity research for the HPV18 L1 VLP that Hansenula yeast is prepared by recombinant

Using measurement humoral immunity effect ED₅₀The immunogenicity of the method evaluation HPV18 L1 VLP of (median effective dose)

(1) mouse is immune: 85 6-8 week old Balb/c female mices (are ground purchased from Chinese Academy of Medical Sciences experimental animal Study carefully institute), cleaning grade raising.6 groups are divided into, it, will by required immunizing dose including 5 experimental groups and 1 control group HPV18 L1 protein sample is diluted (table 1).Immune programme are as follows: the 0th, 3,6 week each immune primary, 14 after last time is immune It kills mouse and separates serum.

Table 1

(2) serological conversion rate after mouse, specific steps are immunized in ELISA method measurement HPV18 L1 VLP are as follows: slow with coating Escherichia coli recombination HPV18 L1 albumen is diluted to 0.5 μ g/ml by fliud flushing, and every hole adds 0.1ml, and 4 DEG C overnight.Next day washing buffer Liquid washs 3 times, gets rid of most residual liquid.With antibody diluent closing 30 minutes, washing buffer was washed 3 times, was detected after drying, Or 4 DEG C of damp proof preservations after drying.Each mice serum sample is diluted with 1: 10000 with sample diluting liquid, takes 0.1ml in upper It states in the reacting hole being coated with, sets 37 DEG C and be incubated for 1 hour, wash 5 times.(while doing blank, negative hole control).In reacting hole The sheep anti-mouse igg secondary antibody 0.1ml of the HRP label of 1: 5000 diluted fresh of antibody diluent is added, 37 DEG C are incubated for 30 minutes, Washing 5 times, last time are washed with distilled water.It is added the tmb substrate solution 0.1ml of Extemporaneous in each reacting hole, 37 DEG C Colour developing 10 minutes.50 μ l 2M sulfuric acid 0.05ml are added in each reacting hole to terminate reaction.In microplate reader, at 450nm (630 be reference wavelength), surveys each hole OD value after returning to zero with blank control wells.Cutoff value calculates and positive findings determine: Cutoff value=negative control value × 2.1；Sample OD value > Cutoff value is then judged to the positive.

(3) humoral immunity effect ED₅₀Calculating

According to following table 2 calculated result, the humoral immunity effect ED of HPV18 L1 VLP₅₀Value is 0.222 μ g, it is shown that HPV18 L1 VLP has good immunogenicity.

Wherein: turning dilution higher than 50% sun is 4, and turning dilution lower than 50% sun is 8.Pass through calculate obtain: distance than Being higher than the dilution that 50% sun turns for 0.1736, log10 is 0.602, ED₅₀Logarithm be 0.6543,50% sun turns dilution and is 4.51.So ED₅₀Value is 0.222 μ g.

Sequence table

<110>Beijing Abzymo Biosciences Technology Co., Ltd.

<120>method for generating HPV18 L1 albumen with expressed by Hansenula yeast system

<130> 2736

<160> 42

<170> PatentIn version 3.3

<210> 1

<211> 507

<212> PRT

<213> Human Papillomavirus

<400> 1

Met Ala Leu Trp Arg Pro Ser Asp Asn Thr Val Tyr Leu Pro Pro Pro

1 5 10 15

Ser Val Ala Arg Val Val Asn Thr Asp Asp Tyr Val Thr Arg Thr Ser

20 25 30

Ile Phe Tyr His Ala Gly Ser Ser Arg Leu Leu Thr Val Gly Asn Pro

35 40 45

Tyr Phe Arg Val Pro Ala Gly Gly Gly Asn Lys Gln Asp Ile Pro Lys

50 55 60

Val Ser Ala Tyr Gln Tyr Arg Val Phe Arg Val Gln Leu Pro Asp Pro

65 70 75 80

Asn Lys Phe Gly Leu Pro Asp Asn Ser Ile Tyr Asn Pro Glu Thr Gln

85 90 95

Arg Leu Val Trp Ala Cys Ala Gly Val Glu Ile Gly Arg Gly Gln Pro

100 105 110

Leu Gly Val Gly Leu Ser Gly His Pro Phe Tyr Asn Lys Leu Asp Asp

115 120 125

Thr Glu Ser Ser His Ala Ala Thr Ser Asn Val Ser Glu Asp Val Arg

130 135 140

Asp Asn Val Ser Val Asp Tyr Lys Gln Thr Gln Leu Cys Ile Leu Gly

145 150 155 160

Cys Ala Pro Ala Ile Gly Glu His Trp Ala Lys Gly Thr Ala Cys Lys

165 170 175

Ser Arg Pro Leu Ser Gln Gly Asp Cys Pro Pro Leu Glu Leu Lys Asn

180 185 190

Thr Val Leu Glu Asp Gly Asp Met Val Asp Thr Gly Tyr Gly Ala Met

195 200 205

Asp Phe Ser Thr Leu Gln Asp Thr Lys Cys Glu Val Pro Leu Asp Ile

210 215 220

Cys Gln Ser Ile Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ser Ala Asp

225 230 235 240

Pro Tyr Gly Asp Ser Met Phe Phe Cys Leu Arg Arg Glu Gln Leu Phe

245 250 255

Ala Arg His Phe Trp Asn Arg Ala Gly Thr Met Gly Asp Thr Val Pro

260 265 270

Gln Ser Leu Tyr Ile Lys Gly Thr Gly Met Arg Ala Ser Pro Gly Ser

275 280 285

Cys Val Tyr Ser Pro Ser Pro Ser Gly Ser Ile Val Thr Ser Asp Ser

290 295 300

Gln Leu Phe Asn Lys Pro Tyr Trp Leu His Lys Ala Gln Gly His Asn

305 310 315 320

Asn Gly Val Cys Trp His Asn Gln Leu Phe Val Thr Val Val Asp Thr

325 330 335

Thr Arg Ser Thr Asn Leu Thr Ile Cys Ala Ser Thr Gln Ser Pro Val

340 345 350

Pro Gly Gln Tyr Asp Ala Thr Lys Phe Lys Gln Tyr Ser Arg His Val

355 360 365

Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Thr Ile Thr Leu

370 375 380

Thr Ala Asp Val Met Ser Tyr Ile His Ser Met Asn Ser Ser Ile Leu

385 390 395 400

Glu Asp Trp Asn Phe Gly Val Pro Pro Pro Pro Thr Thr Ser Leu Val

405 410 415

Asp Thr Tyr Arg Phe Val Gln Ser Val Ala Ile Thr Cys Gln Lys Asp

420 425 430

Ala Ala Pro Ala Glu Asn Lys Asp Pro Tyr Asp Lys Leu Lys Phe Trp

435 440 445

Asn Val Asp Leu Lys Glu Lys Phe Ser Leu Asp Leu Asp Gln Tyr Pro

450 455 460

Leu Gly Arg Lys Phe Leu Val Gln Ala Gly Leu Arg Arg Lys Pro Thr

465 470 475 480

Ile Gly Pro Arg Lys Arg Ser Ala Pro Ser Ala Thr Thr Ser Ser Lys

485 490 495

Pro Ala Lys Arg Val Arg Val Arg Ala Arg Lys

500 505

<210> 2

<211> 1524

<212> DNA

<213> Artificial

<220>

<223> 18wt

<400> 2

atggctttgt ggcggcctag tgacaatacc gtatatcttc cacctccttc tgtggcacga 60

gttgtaaata ccgatgatta tgtgactcgc acaagcatat tttatcatgc tggcagctct 120

agattattaa ctgttggtaa tccatatttt agggttcctg caggtggtgg taataagcag 180

gatattccta aggtttcggc ataccaatat agagtattta gggtgcagtt acctgaccca 240

aataaatttg gtttacctga taatagtatt tataatcctg aaacacaacg tttagtgtgg 300

gcctgtgctg gagtggaaat tggccgtggt cagcctttag gtgttggcct tagtgggcat 360

cccttttata ataaattaga tgacactgaa agttcccatg ccgccacgtc taatgtttct 420

gaggacgtta gggacaatgt gtctgtagat tataagcaga cacagttatg tattttgggc 480

tgtgcccctg ctattgggga acactgggct aaaggcactg cttgtaaatc gcgtccttta 540

tcacagggcg attgcccccc tttagaactt aaaaacacag ttttggaaga tggtgatatg 600

gtagatactg gatatggtgc catggacttt agtacattgc aagatactaa atgtgaggta 660

ccattggata tttgtcagtc tatttgtaaa tatcctgatt atttacaaat gtctgcagat 720

ccttatgggg attccatgtt tttttgctta cggcgtgagc agctttttgc taggcatttt 780

tggaataggg caggtactat gggtgacact gtgcctcaat ccttatatat taaaggcaca 840

ggtatgcgtg cttcacctgg cagctgtgtg tattctccct ctccaagtgg ctctattgtt 900

acctctgact cccagttgtt taataaacca tattggttac ataaggcaca gggtcataac 960

aatggtgttt gctggcataa tcaattattt gttactgtgg tagataccac tcgcagtacc 1020

aatttaacaa tatgtgcttc tacacagtct cctgtacctg ggcaatatga tgctaccaaa 1080

tttaagcagt atagcagaca tgttgaggaa tatgatttgc agtttatttt tcagttgtgt 1140

actattactt taactgcaga tgttatgtcc tatattcata gtatgaatag cagtatttta 1200

gaggattgga actttggtgt tccccccccg ccaactacta gtttggtgga tacatatcgt 1260

tttgtacaat ctgttgctat tacctgtcaa aaggatgctg caccggctga aaataaggat 1320

ccctatgata agttaaagtt ttggaatgtg gatttaaagg aaaagttttc tttagactta 1380

gatcaatatc cccttggacg taaatttttg gttcaggctg gattgcgtcg caagcccacc 1440

ataggccctc gcaaacgttc tgctccatct gccactacgt cttctaaacc tgccaagcgt 1500

gtgcgtgtac gtgccaggaa gtaa 1524

<210> 3

<211> 1524

<212> DNA

<213> Artificial

<220>

<223> 18sc

<400> 3

atggctttgt ggcggcctag tgacaatacc gtataccttc cacctccttc tgtggcaaga 60

gttgtaaata ctgatgatta tgtgactcgc acaagcatat tttatcatgc tggcagctct 120

agattattaa ctgttggtaa tccatatttt agggttcctg caggtggtgg caataagcag 180

gatattccta aggtttctgc ataccaatat agagtatttc gggtgcagtt acctgaccca 240

aataaatttg gtttacctga taatagtatt tataatcctg aaacacaacg tttagtgtgg 300

gcctgtgctg gagtggaaat tggccgtggt cagcctttag gtgttggcct tagtgggcat 360

ccattttata ataaattaga tgacactgaa agttcccatg ccgctacgtc taatgtttct 420

gaggacgtta gggacaatgt gtctgtagat tataagcaga cacagttatg tattttgggc 480

tgtgcccctg ctattgggga acactgggct aaaggcactg cttgtaaatc gcgtccttta 540

tcacagggcg attgcccccc tttagaactt aagaacacag ttttggaaga tggtgatatg 600

gtagatactg gatatggtgc catggacttt agtacattgc aagatactaa atgtgaggta 660

ccattggata tttgtcagtc tatttgtaaa tatcctgatt atttacaaat gtctgcagat 720

ccttatgggg attccatgtt tttttgctta cgacgtgagc agctttttgc taggcatttt 780

tggaataggg caggtactat gggtgacact gtgcctcaat ccttatatat taaaggcaca 840

ggtatgcgtg cttcacctgg cagctgtgtg tattctccct ctccaagtgg ctctattgtt 900

acctctgact cccagttgtt taataaacca tattggttac ataaggcaca gggtcataac 960

aatggtatct gctggcataa tcaattattt gttactgtgg tagataccac tcgtagtacc 1020

aatttaacaa tatgtgcttc tacacagtct cctgtacctg ggcaatatga tgctaccaaa 1080

tttaagcagt atagcagaca tgttgaagaa tatgatttgc agtttatttt tcagttatgt 1140

actattactt taactgcaga tgttatgtcc tatattcata gtatgaatag cagtatttta 1200

gaggattgga actttggtgt tccccccccg ccaactacta gtttggtgga tacatatcgt 1260

tttgtacaat ctgttgctat tacctgtcaa aaggatgctg caccagctga aaataaggat 1320

ccctatgata agttaaagtt ttggaatgtg gatttaaagg aaaagttttc tttggactta 1380

gatcaatatc cccttggacg taaatttttg gttcaggctg gattgcgtcg caagcccacc 1440

ataggccctc gtaaacgttc tgctccatct gccactacgt cttctaaacc tgccaagcgt 1500

gtgcgtgtac gtgccaggaa gtaa 1524

<210> 4

<211> 1524

<212> DNA

<213> Artificial

<220>

<223> 18pp

<400> 4

atggctttgt ggagaccttc tgacaacact gtttacttgc cacctccatc cgttgctaga 60

gttgttaaca ctgatgacta cgttactaga acttctattt tctaccacgc tggttcctct 120

agattgttga ctgttggtaa cccttacttt agagttccag ctggtggtgg taacaagcaa 180

gatattccta aggtttccgc ttaccaatac agagttttca gagttcaatt gccagaccct 240

aacaagtttg gtttgccaga tacttctatt tacaaccctg agactcaaag attggtttgg 300

gcttgtgctg gtgttgaaat tggtagaggt caaccattgg gtgttggttt gtccggtcat 360

cctttctaca acaagttgga cgatactgag tcttcccacg ctgctacttc taacgtttcc 420

gaagacgtta gagataacgt ttctgttgac tacaagcaaa ctcaattgtg tattttgggt 480

tgtgctccag ctattggtga gcattgggct aagggtactg cttgtaagtc cagacctttg 540

tctcaaggtg attgtccacc tttggaattg aagaacactg ttttggagga cggtgatatg 600

gttgacactg gttacggtgc tatggatttc tccactttgc aagacactaa gtgtgaagtt 660

ccattggata tttgtcaatc tatttgtaag taccctgact acttgcaaat gtccgctgat 720

ccatacggtg actctatgtt cttttgtttg agaagagagc aattgttcgc tagacacttt 780

tggaacagag ctggtactat gggtgatact gttcctcaat ccttgtacat taagggtact 840

ggtatgagag cttctccagg ttcctgtgtt tactctcctt ccccatctgg ttccattgtt 900

acttctgact cccaattgtt caacaagcct tactggttgc ataaggctca aggtcacaac 960

aacggtgttt gttggcataa ccaattgttt gttactgttg ttgatactac tagatccact 1020

aacttgacta tttgtgcttc cactcaatct ccagttcctg gtcaatacga cgctactaag 1080

ttcaagcaat actccagaca cgttgaagag tacgatttgc aattcatctt ccaattgtgt 1140

actattactt tgactgctga cgttatgtct tacattcatt ccatgaactc ttccattttg 1200

gaagattgga actttggtgt tccacctcca cctactactt ctttggttga cacttacaga 1260

ttcgttcaat ccgttgctat tacttgtcaa aaggatgctg ctccagctga gaacaaggac 1320

ccttacgata agttgaagtt ttggaacgtt gacttgaagg aaaagttctc tttggatttg 1380

gaccaatacc cattgggtag aaagtttttg gttcaagctg gtttgagaag aaagcctact 1440

attggtccaa gaaagagatc cgctccttct gctactactt cctctaagcc agctaagaga 1500

gttagagtta gagctagaaa gtaa 1524

<210> 5

<211> 1524

<212> DNA

<213> Artificial

<220>

<223> 18hp

<400> 5

atggctttgt ggagaccatc agacaacacc gtctaccttc cacctccgtc ggtggctcgc 60

gtcgttaata cagatgacta tgtgacgaga acttctatct tctaccacgc agggtcctcg 120

cgtctcctga cagttggcaa cccatacttc agagttcctg ctggtggagg taacaaacag 180

gacattccaa aggtgtctgc ctaccaatac agagtcttcc gtgtgcagtt gccagaccct 240

aacaagtttg gactgccaga taactcaatc tacaaccctg agacccagag actggtctgg 300

gcttgtgcag gtgtggagat tggcagaggt caaccactgg gagtgggtct ttcgggacac 360

cctttctaca acaagctgga tgacactgaa tcttcacatg ctgctacgtc caatgtctcg 420

gaggacgtta gagataacgt gtccgttgat tacaaacaga ctcaactgtg cattctggga 480

tgtgctcctg caataggtga acattgggct aagggtactg cctgcaaatc aagaccactc 540

tcgcagggag attgtccacc tcttgagctg aagaacacag tgctggagga cggtgacatg 600

gtggatactg gatacggtgc gatggatttc tctacgttgc aagacaccaa atgcgaagtc 660

ccactggata tctgtcagtc aatctgcaag tatcctgact acctgcaaat gtctgctgat 720

ccatatggtg actctatgtt cttctgtctt aggagagagc agctctttgc aagacacttc 780

tggaatcgtg ctggtacaat gggtgacaca gtgccacagt ctctttacat caaaggaacc 840

ggtatgagag cctcgccagg atcgtgcgtc tattcgcctt ctccatctgg gtccatcgtt 900

acgagcgatt cgcaattgtt caacaagcct tactggctgc acaaagcaca gggacataac 960

aatggtgtgt gctggcacaa ccagctgttt gtgactgtcg ttgacacaac cagatcgacg 1020

aacttgacta tctgtgctag cacgcaaagc cctgtgccag gtcagtacga cgccaccaag 1080

ttcaaacagt attcaagaca tgtcgaagag tacgatctcc agttcatctt ccaactgtgc 1140

acgatcactc tcaccgctga cgttatgtcc tacattcact cgatgaactc gagcattctg 1200

gaagattgga acttcggagt tcctccacct ccaacgacct ctttggtgga cacataccgg 1260

tttgttcagt cggttgccat cacttgtcaa aaggacgctg cacctgctga gaacaaggac 1320

ccatacgaca aactgaagtt ctggaacgtt gacctcaaag agaagttctc cctggatttg 1380

gaccagtatc cgttgggcag gaagttcctg gtccaggctg gtctccgtcg gaaacctaca 1440

attggacctc gcaagagatc ggcaccatct gctaccacgt cctcgaagcc agcaaagaga 1500

gtgagggtca gagctcgcaa gtaa 1524

<210> 6

<211> 6210

<212> DNA

<213> Artificial

<220>

<223> pRMHP2.1

<400> 6

cgcggccgct tttttcctta gatcttacgg ttatccacag aatcagggga taacgcagga 60

aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 120

gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 180

aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 240

gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 300

ggaagcgtgg cgctttctca atgctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 360

cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 420

ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 480

actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 540

tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca 600

gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 660

ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat 720

cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt 780

ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt 840

tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaggt 900

acccctcgtg aagaaggtgt tgctgactca taccaggcct gaatcgcccc atcatccagc 960

cagaaagtga gggagccacg gttgatgaga gctttgttgt aggtggacca gttggtgatt 1020

ttgaactttt gctttgccac ggaacggtct gcgttgtcgg gaagatgcgt gatctgatcc 1080

ttcaactcag caaaagttcg atttattcaa caaagccgcc gtcccgtcaa gtcagcgtaa 1140

tgctctgcca gtgttacaac caattaacca attctgatta gaaaaactca tcgagcatca 1200

aatgaaactg caatttattc atatcaggat tatcaatacc atatttttga aaaagccgtt 1260

tctgtaatga aggagaaaac tcaccgaggc agttccatag gatggcaaga tcctggtatc 1320

ggtctgcgat tccgactcgt ccaacatcaa tacaacctat taatttcccc tcgtcaaaaa 1380

taaggttatc aagtgagaaa tcaccatgag tgacgactga atccggtgag aatggcaaaa 1440

gcttatgcat ttctttccag acttgttcaa caggccagcc attacgctcg tcatcaaaat 1500

cactcgcatc aaccaaaccg ttattcattc gtgattgcgc ctgagcgaga cgaaatacgc 1560

gatcgctgtt aaaaggacaa ttacaaacag gaatcgaatg caaccggcgc aggaacactg 1620

ccagcgcatc aacaatattt tcacctgaat caggatattc ttctaatacc tggaatgctg 1680

ttttcccggg gatcgcagtg gtgagtaacc atgcatcatc aggagtacgg ataaaatgct 1740

tgatggtcgg aagaggcata aattccgtca gccagtttag tctgaccatc tcatctgtaa 1800

catcattggc aacgctacct ttgccatgtt tcagaaacaa ctctggcgca tcgggcttcc 1860

catacaatcg atagattgtc gcacctgatt gcccgacatt atcgcgagcc catttatacc 1920

catataaatc agcatccatg ttggaattta atcgcggcct cgagcaagac gtttcccgtt 1980

gaatatggct cataacaccc cttgtattac tgtttatgta agcagacagt tttattgttc 2040

atgatgatat atttttatct tgtgcaatgt aacatcagag attttgagac acaacgtggc 2100

tttcagatcc gatatcctat cctgcaggtc gactcccgcg actcggcgtt cactttcgag 2160

ctattatcaa cgccggaata cgtcagaaac agccgtgccc cagggaccag aaagcctact 2220

ggtgagtatg ttctttcgtg tgatttttcc gaggatgaga acgacgataa cgagcacaac 2280

tcggagtcgg aggacacgct tattgcgttg aacgcagcca catcagcagg ctgtcaagac 2340

tgagtatggc cacagagctg gattctcggc ctcatactca agacgttagt aaactccgtc 2400

tgccagaaat tgctgacgag gatgtataat aatagatgaa ttacgaacaa ttgtagttca 2460

aaaaaattta gtaacaatat tgtctagatg acagatgtgc tgaaaccagt gaactccaat 2520

aaaccactca ccgctaccca agagaaacag atcagagtgc tagggccttg tttcagagta 2580

ctacaacgtt taccagaagc ttgagcaagt tctcaaacgc gggtttgtcg acatatgcac 2640

ccactaatag ggaacgtgag ctgggtttag accgtcgtga gacaggttag ttttacccta 2700

ctgatgaatg ttatcgcaat agtaattgaa cttagtacga gaggaaccgt tcattcagat 2760

aattggtttt tgcggctgtc tgatcaggca ttgccgcgaa gctaccatct gctggataat 2820

ggctgaacgc ctctaagtca gaatccatgc tagaaagcga tgatttcttg ccctcgcaca 2880

ttttagttgg atacgaataa ggcactctgt gtcgctgaac catagcaggc tggcaatggt 2940

gcttttaacg gaaaggtttt aagtgcttgc cggtggatag caatgtcatt atgcgcgagg 3000

ataaatcctt tgcatacgac ttaaatgtac aacggggtat tgtaagcagt agagtagcct 3060

tgttgttacg atctgctgag attaagcctc agttgtccga tttgtttgtg tttacacaac 3120

acaatctccc ctaagagata ttacttggtg gtagccgggt gtcttttaga ggagattttt 3180

tatatttttt tgagtagagg tcgtgcgtgg aacaattttg gatggttgtg tataaaattt 3240

tgaatcgaag agaccaatat tattttttaa ttacttatta ttttgtgttt tttttgtttt 3300

ttgatttaag ttatttaatt cagggataag ttggcttttt aatttttttg tttttatttt 3360

tttggtagca agcctttaat taaattgaat tttcgatgtg tagtggtgta aggatcttta 3420

tccaaaacat ttcggttgat attggccaat agaagtgtgt tgagctctga caaatgacag 3480

atattctgta ccatagtaag attcaaggta aatgagagaa aatgtatggt aattgatggc 3540

tgtcgtatga aaagtgagta cgatacgggc aactaagcta acaagagtag gcagaataga 3600

cagatattct gtgatgcaaa gtgtgtggca cacgtcctgt ttgtcatctg gcgctgagaa 3660

ggaaatttaa gcatagagat ggtggcagag ttgaaagagg tgctacaagg tgcctggaag 3720

agccggcaaa aaaagtggta gtggtaaagg atgaatgaag actttttgcg ccataccact 3780

gttgctgctc ttcctaaagg caggattaca agaagaagtc ggagggatta ggattggcga 3840

ccactcttct ctacgtgctg ggaggaaaaa aaagataggt gtggaagagg tgggcatata 3900

tatatagacg tttggataga caatggattg atgcagaacg cgacctcgag accgcgttgg 3960

actggaggga agggaaaaaa aaataataaa aaaaaaaaag attgcagcac ctgagtttcg 4020

cgtatggtct cccactacac tactcggtca ggctcttagc agcttaacta cagttgatcg 4080

gacgggaaac ggtgctttct gctagatatg gccgcaaccg aaagagtatg gaaacgagtg 4140

ggggatatga attgagaggg gggagaagta ctattcaact gttggttggt ggcagctatt 4200

gtagaacgaa atgcttaagt ataatatttt ttttttctcg gtaggtgaaa ttgtataaga 4260

gagaagacca ctgtagatga aggatgtact gatgtgaaac tgtatgagtg gtttgacgat 4320

tctacgtagg agaattaaaa agttggggaa attggaaatt agaggagaat ctcctgttga 4380

aaaatgaaga tcaagcatga aatgtatgaa tgccaatttg gagatcagca caacgtcatg 4440

ttaaagggga attgactgaa aagcgtagaa agtccatact ccagtgatga acttgtggtt 4500

tttcaagttt ctttaatttt ttcggttgtc gcgtagcagg gtggcacgaa gaaaaaattt 4560

cgtggtacca agaaatatgt cgggggaata atatttggag gcggtaggga attagaatcg 4620

aaatgaaaaa tataaaaagc tggaggaagg tgctaaaaaa aagccaatga ataattatgt 4680

aacttttgga aaaagttata ttagagagga aattttacgt gagagatgcg gatggacttt 4740

catgcgaaag cataaaagaa gatttgaaaa ctgaatgtga agaagcgaaa gcttctgcgc 4800

gtttggggtt cgattttcga aagggagttc tgaaaagagc tcttcaaggc ctcgttgatt 4860

agtggagaga gtaaagttgt tatcgtcaga tacactttct ctcaaggcta attcaacatg 4920

ggtgatcttg ggcggtcaaa aaaaataatt tttgatggtc tgagtagcct gaacagtctc 4980

ataccaaatt tctaattatt tttgtgtgtg agcactgatg gatttagtgg attactagcc 5040

tatggcaaga attcggacca caatccaaat aaagaaagtg catggaagaa gtaatcaaat 5100

aatttttaca tagcaagcaa caatagattt atttatcatg gcagccaagt ttgaaacacg 5160

aaagcgcgta caataataat gacgtatgtt gaactttttt tctccttaac tataaaaatc 5220

agttaagccg taaatatgta gatgaggccg tgctcagtcc tgctcctcgg ccacgaagtg 5280

cacgcagttg ccggccgggt cgcgcagggc gaactcccgc ccccacggct gctcgccgat 5340

ctcggtcatg gccggcccgg aggcgtcccg gaagttcgtg gacacgacct ccgaccactc 5400

ggcgtacagc tcgtccaggc cgcgcaccca cacccaggcc agggtgttgt ccggcaccac 5460

ctggtcctgg accgcgctga tgaacagggt cacgtcgtcc cggaccacac cggcgaagtc 5520

gtcctccacg aagtcccggg agaacccgag ccggtcggtc cagaactcga ccgctccggc 5580

gacgtcgcgc gcggtgagca ccggaacggc actggtcaac ttggccatat tgtttctata 5640

ttatctttgt actaaagagc aattgataat gtgcgagaaa aactggtcct tatatgccgt 5700

ttgcagcact ccctcccgaa ctttacgaaa agtcgtgcgc cacctgattt tcatcacgcc 5760

aaaaacctac acgtatgact actccgggcc agtgttcacc acgagctata tagtgttaat 5820

taattacctt attggttagc tctgcatgta agggtggtgt gagccgggaa ttgggtctac 5880

tctagcgttc agtaaggtga tataaagctc tgtatagcca gaagtggaca tcacccaaca 5940

aggcgtctcg gggacttgcc tgtccgtgca aggttgttcc atggaagctc taccgccgga 6000

gcggcccaaa ggacaataag aagtgctaca ccacctccgc agaggacaca ggcttaaaac 6060

cctctttctc ggtttcggga ccggttcccg gagattgtct ttaccccacg caccgtgctg 6120

gagccatagc agttgttgca actttgcgag ttgtcacctt ttcctccgtg gcccgcctct 6180

tttctggtgc acggatgtag tctagaccaa 6210

<210> 7

<211> 30

<212> DNA

<213> Artificial

<220>

<223> primer1

<400> 7

gaagatctta cggttatcca cagaatcagg 30

<210> 8

<211> 30

<212> DNA

<213> Artificial

<220>

<223> primer2

<400> 8

ggggtaccta agcattggta actgtcagac 30

<210> 9

<211> 33

<212> DNA

<213> Artificial

<220>

<223> primer3

<400> 9

gaagatctga aagccacgtt gtgtctcaaa atc 33

<210> 10

<211> 30

<212> DNA

<213> Artificial

<220>

<223> primer4

<400> 10

ggggtacccc tcgtgaagaa ggtgttgctg 30

<210> 11

<211> 51

<212> DNA

<213> Artificial

<220>

<223> primer5

<400> 11

gaagatctaa ggaaaaaagc ggccgcgttg gtctagacta catccgtgca c 51

<210> 12

<211> 24

<212> DNA

<213> Artificial

<220>

<223> primer6

<400> 12

attgtttcta tattatcttt gtac 24

<210> 13

<211> 25

<212> DNA

<213> Artificial

<220>

<223> primer7

<400> 13

gcacggcctc atctacatat ttacg 25

<210> 14

<211> 59

<212> DNA

<213> Artificial

<220>

<223> primer8

<400> 14

cgggatccga tatcctatcc tgcagaaaag aattcggacc acaatccaaa taaagaaag 59

<210> 15

<211> 45

<212> DNA

<213> Artificial

<220>

<223> primer9

<400> 15

tagtacaaag ataatataga aacaatatgg ccaagttgac cagtg 45

<210> 16

<211> 41

<212> DNA

<213> Artificial

<220>

<223> primer10

<400> 16

taaatatgta gatgaggccg tgctcagtcc tgctcctcgg c 41

<210> 17

<211> 40

<212> DNA

<213> Artificial

<220>

<223> primer11

<400> 17

aaaactgcag gtcgactccc gcgactcggc gttcactttc 40

<210> 18

<211> 59

<212> DNA

<213> Artificial

<220>

<223> primer12

<400> 18

ggaattctag ggagctccca attccatatg tcgacaaacc cgcgtttgag aacttgctc 59

<210> 19

<211> 37

<212> DNA

<213> Artificial

<220>

<223> primer13

<400> 19

ggaattccat atggggttta gaccgtcgtg agacagg 37

<210> 20

<211> 27

<212> DNA

<213> Artificial

<220>

<223> primer14

<400> 20

ggaattcttg ccataggcta gtaatcc 27

<210> 21

<211> 41

<212> DNA

<213> Artificial

<220>

<223> primer15

<400> 21

aaggaaaaaa gcggccgcaa cgatctcctc gagctgctcg c 41

<210> 22

<211> 27

<212> DNA

<213> Artificial

<220>

<223> primer16

<400> 22

tttgtttttg tactttagat tgatgtc 27

<210> 23

<211> 23

<212> DNA

<213> Artificial

<220>

<223> primer17

<400> 23

ggagacgtgg aaggacatac cgc 23

<210> 24

<211> 30

<212> DNA

<213> Artificial

<220>

<223> primer18

<400> 24

gaagatctca atctccggaa tggtgatctg 30

<210> 25

<211> 50

<212> DNA

<213> Artificial

<220>

<223> primer19

<400> 25

catcaatcta aagtacaaaa acaaaatggc tttgtggcgg cctagtgaca 50

<210> 26

<211> 48

<212> DNA

<213> Artificial

<220>

<223> primer20

<400> 26

gcggtatgtc cttccacgtc tccttacttc ctggcacgta cacgcaca 48

<210> 27

<211> 50

<212> DNA

<213> Artificial

<220>

<223> primer21

<400> 27

catcaatcta aagtacaaaa acaaaatggc tttgtggcgg cctagtgaca 50

<210> 28

<211> 48

<212> DNA

<213> Artificial

<220>

<223> primer22

<400> 28

gcggtatgtc cttccacgtc tccttacttc ctggcacgta cacgcaca 48

<210> 29

<211> 50

<212> DNA

<213> Artificial

<220>

<223> primer23

<400> 29

catcaatcta aagtacaaaa acaaaatggc tttgtggaga ccttctgaca 50

<210> 30

<211> 48

<212> DNA

<213> Artificial

<220>

<223> primer24

<400> 30

gcggtatgtc cttccacgtc tccttacttt ctagctctaa ctctaact 48

<210> 31

<211> 50

<212> DNA

<213> Artificial

<220>

<223> primer25

<400> 31

catcaatcta aagtacaaaa acaaaatggc tttgtggaga ccatcagaca 50

<210> 32

<211> 48

<212> DNA

<213> Artificial

<220>

<223> primer26

<400> 32

gcggtatgtc cttccacgtc tccttacttg cgagctctga ccctcact 48

<210> 33

<211> 38

<212> DNA

<213> Artificial

<220>

<223> primer27

<400> 33

ataagaatgc ggccgcggat ccaggaagcg caacgacg 38

<210> 34

<211> 47

<212> DNA

<213> Artificial

<220>

<223> primer28

<400> 34

tgtctgatgg tctccacaaa gccatgattt gattgatgaa ggcagag 47

<210> 35

<211> 25

<212> DNA

<213> Artificial

<220>

<223> primer29

<400> 35

atggctttgt ggagaccatc agaca 25

<210> 36

<211> 30

<212> DNA

<213> Artificial

<220>

<223> primer30

<400> 36

gaagatctca atctccggaa tggtgatctg 30

<210> 37

<211> 25

<212> DNA

<213> Artificial

<220>

<223> primer31

<400> 37

cgtagtactt gttcgcgtcg ctgta 25

<210> 38

<211> 25

<212> DNA

<213> Artificial

<220>

<223> primer32

<400> 38

gcagtggacg acctcatggt aaact 25

<210> 39

<211> 25

<212> DNA

<213> Artificial

<220>

<223> primer33

<400> 39

gctggtggag gtaacaaaca ggaca 25

<210> 40

<211> 25

<212> DNA

<213> Artificial

<220>

<223> primer34

<400> 40

gcaacgtaga gaaatccatc gcacc 25

<210> 41

<211> 35

<212> DNA

<213> Artificial

<220>

<223> primer35

<400> 41

ggaattccat atggctttgt ggagaccttc tgaca 35

<210> 42

<211> 31

<212> DNA

<213> Artificial

<220>

<223> primer36

<400> 42

ccgctcgagc tttctagctc taactctaac t 31

Claims (16)

1. a kind of method for the recombination Hansenula yeast cell for generating expression HPV 18 L1 (HPV18 L1) albumen, It comprises the steps of:

A) by the way that the nucleotide for the coding HPV18 L1 albumen operably connecting with MOX promoter and MOX terminator will be included The exogenous polynucleotide insetion sequence of sequence is shown in the carrier of SEQ ID NO:6 to construct expression construct；

B) Hansenula yeast cell is converted with the expression construct obtained in step a)；With

C) the Hansenula yeast cell obtained in step b) is screened with Zeocin and G418, obtains and contains the external source multicore The recombination Hansenula yeast cell of thuja acid.

2. the method for claim 1 wherein the amino acid sequences of the HPV18 L1 albumen to be shown in SEQ ID NO:1.

3. method for claim 2, wherein the nucleotides sequence of the coding HPV18 L1 albumen is shown in SEQ ID NO:5.

4. the method for claim 1 wherein convert Hansenula yeast cell by electroporation in step b).

5. the method for claim 1 wherein the Hansenula yeast cell in step b) is ATCC26012 Hansenula yeast cell.

6. the method for claim 1 wherein the G418 of the Zeocin and 10mg/ml that use 0.25mg/ml in step c) to step b) The Hansenula yeast cell of middle acquisition is screened.

7. the method for claim 1 wherein screenings described in step c) to include

C1) the Hansenula yeast cell obtained in step b) is coated in the YPD plate of the Zeocin containing 0.25mg/ml, in 37 DEG C It is inverted culture 3-5 days；

C2) picking is inoculated in 5ml containing 0.25mg/ml in the single colonie grown on the YPD plate of the Zeocin containing 0.25mg/ml In the YPD fluid nutrient medium of Zeocin, in 37 DEG C, 200rpm shaking table culture 24-36 hours, until OD value is up to after 50, with 1: 1000 Ratio transfer in the YPD fluid nutrient medium of 5ml Zeocin containing 0.25mg/ml, culture to OD value is up to after 50, then with 1: 1000 ratio is transferred in the YPD fluid nutrient medium of 5ml Zeocin containing 0.25mg/ml, continuous to pass 10 times；

C3) the recombination expressed by Hansenula yeast bacterial strain access 5ml for reaching 10 times is free of to the YPD fluid nutrient medium of Zeocin resistance In, in 37 DEG C, 200rpm shaking table culture to OD value up to after 50, transferred in 5ml YPD fluid nutrient medium with 1: 1000 ratio, It is continuously passed 5 times in the YPD fluid nutrient medium without Zeocin resistance；With

C4) product of acquisition is coated on to the YPD plate of the G418 containing 10mg/ml, cultivated 2-3 days in 32 DEG C of inversions, picking growth Vigorous single colonie carries out copy number detection.

8. the method for any one of claim 1-7, wherein the recombination Hansenula yeast cell contains the external source of multicopy Polynucleotides.

9. method for claim 8, wherein the recombination Hansenula yeast cell contains the external source multicore that copy number is greater than 30 Thuja acid.

10. a kind of recombination Hansenula yeast cell of any one of -9 method generation according to claim 1.

11. a kind of method for generating HPV18 L1 albumen, comprising the following steps:

I) the recombination Hansenula yeast cell of claim 10 is cultivated under conditions of being suitable for the HPV18 L1 protein expression；

Ii it) is recycled from culture and purifies the HPV18 L1 albumen.

12. the method for claim 11 further includes the steps that carrying out purified HPV18 L1 albumen depolymerization and meet again.

13. the HPV18 L1 albumen that 1 or 12 method generates according to claim 1 is in preparation for preventing the epidemic disease of HPV18 infection Purposes in seedling.

14. encoding the polynucleotides of HPV18 L1 albumen, it includes nucleotide sequences shown in SEQ ID NO:5.

15. a kind of expression construct is shown in SEQ by the way that the nucleotide sequence for encoding HPV18 L1 albumen is inserted into sequence It is obtained in the expression vector pRMHP2.1 of ID NO:6.

16. a kind of expression vector, it includes nucleotide sequences shown in SEQ ID NO:6.