CN109293774B

CN109293774B - Fully humanized antibody specifically binding to CD19 and application thereof

Info

Publication number: CN109293774B
Application number: CN201811201166.4A
Authority: CN
Inventors: 高威; 马素娟; 孙鸾; 李娜; 陈璐璐
Original assignee: Nanjing Medical University
Current assignee: Nanjing Medical University
Priority date: 2018-10-16
Filing date: 2018-10-16
Publication date: 2021-05-28
Anticipated expiration: 2038-10-16
Also published as: CN109293774A

Abstract

The invention relates to fully humanized antibodies that specifically bind to CD19 and uses thereof. The antibody has at least one of a heavy chain CDR1, a heavy chain CDR2, a heavy chain CDR3, a light chain CDR1, a light chain CDR2, and a light chain CDR 3. The antibody can be used for preparing cells or conjugates, diagnostic kits, drugs or pharmaceutical compositions; the nucleic acid is used for preparing a fully humanized antibody, a medicament or a pharmaceutical composition which specifically binds to CD 19; the cell or conjugate is used for preparing a drug or a drug composition; the medicine or the pharmaceutical composition has an anti-tumor effect on CD19 positive tumors. The invention screens out the fully humanized antibody of anti-CD 19 by phage display technology, the antibody has strong specificity and high affinity, can be combined with CD19 positive cells, can not form competitive combination relation with the existing antibody FMC63, and has anti-tumor application prospect.

Description

Fully humanized antibody specifically binding to CD19 and application thereof

Technical Field

The invention relates to a fully humanized antibody specifically binding to CD19 and application thereof, belonging to the technical field of biology.

Background

To the best of the inventors' knowledge, CD19 is a transmembrane protein specifically expressed on the surface of human normal and malignant B cells and has a molecular weight of about 95 kd. CD19 is highly expressed at all stages of B cell lineage development, but fully mature plasma cells lose expression of CD19, an important marker for B cells. CD19 forms a multimolecular complex with CD21 and CD81 on the surface of B cells. After the activation signal is obtained, 6 tyrosine residues located in the intracellular domain of CD19 are phosphorylated, recruiting downstream signaling molecules, and amplifying the activation signal of BCR. The B cell activation of CD19 knockout mice was significantly reduced, while the antibody response to most antigens was significantly suppressed. Thus, CD19 functions as a co-receptor (co-receptor) for B cell receptors, regulating B cell development, proliferation and differentiation by lowering the signaling threshold required for BCR activation^[1]。

The wide expression of CD19 on B cells makes it an important therapeutic target for B cell malignant diseases^[2]. In various types of B cell leukemia (including acute B lymphocyte leukemia, chronic B cell leukemia)B-lymphocytic leukemia), B-cell lymphoma (including hodgkin's lymphoma, non-hodgkin's lymphoma and diffuse large B-cell lymphoma), anti-tumor preclinical testing and clinical trials of CD19 antibodies, bispecific antibodies and antibody derivatives have been widely conducted; in particular, a method of treating chimeric antigen receptor T cells (CAR-T) derived from the CD19 antibody^[3]There have been two FDA approvals^[4,5]For the treatment of acute B-lymphocytic leukemia and B-lymphoma, respectively; the antibody recognizing CD19 is FMC63, and is a humanized antibody based on mouse monoclonal antibody^[6]. Therefore, the novel CD19 fully humanized antibody is screened, and the chimeric antigen receptor T cell is constructed for treating B cell malignant lesion, so that the method has important clinical application value.

The Chinese patent application with application number 201711157376.3 and application publication number CN107827991A discloses a chimeric antigen receptor T cell targeting CD19 and application thereof. Some anti-CD 19 antibodies already exist in the prior art as represented by this scheme. The subject group of the inventors has systematically studied and found a fully humanized antibody that specifically binds CD19, unlike the prior art.

Disclosure of Invention

The main purposes of the invention are: in response to the problems of the prior art, a fully humanized antibody that specifically binds to CD19 is provided that binds to CD19 positive cells.

The technical scheme for solving the technical problems of the invention is as follows:

a fully humanized antibody that specifically binds CD19, said antibody comprising a heavy chain and a light chain; characterized in that the antibody has at least one of the following technical characteristics:

i. the heavy chain includes heavy chain CDR1, amino acid residues 26-33 of the amino acid sequence shown in SEQ ID NO. 2;

ii. The heavy chain includes heavy chain CDR2, amino acid residues 50-59 of the amino acid sequence shown in SEQ ID NO. 2;

iii, the heavy chain comprises heavy chain CDR3, amino acid residue 100-103 of the amino acid sequence shown in SEQ ID NO. 2;

iv, the light chain comprises a light chain CDR1, amino acid residue 161-165 of the amino acid sequence shown in SEQ ID NO. 2;

v, the light chain includes a light chain CDR2, amino acid residue 183-186 of the amino acid sequence shown in SEQ ID NO. 2;

vi, the light chain includes light chain CDR3, amino acid residue 224-229 of the amino acid sequence shown in SEQ ID NO: 2.

Preferably, the antibody has at least one of the following technical features:

i. the heavy chain includes heavy chain CDR1, amino acid residues 26-33 of the amino acid sequence shown in SEQ ID NO. 2; the heavy chain includes heavy chain CDR2, amino acid residues 50-59 of the amino acid sequence shown in SEQ ID NO. 2; the heavy chain further comprises heavy chain CDR3, amino acid residue 161-165 of the amino acid sequence shown in SEQ ID NO. 2;

ii. The light chain comprises a light chain CDR1, amino acid residues 161-165 of the amino acid sequence shown in SEQ ID NO. 2; the light chain includes a light chain CDR2, amino acid residue 183-186 of the amino acid sequence set forth in SEQ ID NO. 2; the light chain includes light chain CDR3, amino acid residue 224-229 of the amino acid sequence set forth in SEQ ID NO. 2.

Preferably, the amino acid sequence of the antibody is shown as SEQ ID NO. 2.

Preferably, the antibody is a VH single domain antibody, a Fab fragment, a Fab 'fragment, a F (ab)'₂A fragment, a single chain variable fragment (scFv), a disulfide stabilized variable region fragment (dsFv), an IgG molecule, or a bispecific antibody.

Preferably, the antibody has a label including a fluorescent label, an enzymatic label, and a radioactive label.

The present invention also provides:

nucleic acid encoding a fully humanized antibody that specifically binds CD19 as described previously.

Preferably, the sequence of the nucleic acid is shown as SEQ ID NO. 1.

The present invention also provides:

a cell or conjugate having a fully humanized antibody as described hereinbefore that specifically binds CD 19.

Preferably, the cells include chimeric antigen receptor T cells, chimeric antigen receptor NK cells, and artificially edited cells; the conjugates include fully humanized antibody-bacterial toxin conjugates that specifically bind CD19, fully humanized antibody-bacterial toxin variant conjugates that specifically bind CD19, fully humanized antibody-cytokine conjugates that specifically bind CD19, and fully humanized antibody-chemotherapeutic drug conjugates that specifically bind CD 19.

The present invention also provides:

use of a fully humanized antibody as described hereinbefore specifically binding to CD19 for the preparation of a cell or conjugate, a diagnostic kit, a medicament or a pharmaceutical composition.

Use of a nucleic acid as hereinbefore described for the preparation of a fully humanized antibody, medicament or pharmaceutical composition that specifically binds CD 19.

Use of a cell or conjugate as hereinbefore described for the preparation of a medicament or pharmaceutical composition.

Wherein the medicine or the medicine composition has an anti-tumor effect on CD19 positive tumors.

The fully humanized antibody specifically binding to the CD19 is screened out by a phage display technology, has strong specificity and high affinity, can be combined with CD19 positive cells, does not form a competitive binding relationship with the existing antibody FMC63, has potential possibility of generating synergistic effect with the antibody FMC63 and derivatives thereof, CAR-T cells and conjugates, and has an anti-tumor application prospect.

Drawings

FIG. 1 is a schematic representation of the ELISA assay for enriched phage binding to antigen protein in example 1.

FIG. 2 is a schematic representation of the detection of antigen binding of phage monoclonals by ELISA in example 1.

FIG. 3 is a graph showing the results of SDS-PAGE in example 1.

FIG. 4 is a graph showing the results of specific binding of antibody 5G9 to CHO-CD19 cells in example 1.

FIG. 5 is a graph showing the results of affinity analysis in example 2.

FIG. 6 is a graph showing the results of specific binding of antibody 5G9 to the B cell line in example 3.

FIG. 7 is a graph showing the results of fluorescence detection in example 4, in which "CD 19 Antibody-" indicates a negative control group and "CD 19 Antibody +" indicates each Antibody group.

FIG. 8 is a graph showing the results of data processing in example 4, in which "CD 19 Antibody-" indicates a negative control group and "CD 19 Antibody +" indicates each Antibody group.

Detailed Description

The present invention will be described in further detail with reference to examples. The invention is not limited to the examples given. The methods used are conventional methods unless otherwise specified, and the reagents and materials used are commercially available products unless otherwise specified.

Example 1 screening of fully humanized antibodies that specifically bind CD19

Screening is carried out by adopting phage display technology and taking human CD19(P20-K291) protein as CD19 antigen.

The preparation process of the CD19 antigen is as follows: constructing a pFUSE-hCD19(P20-K291) -Fc eukaryotic cell expression vector; the expression vector replaces the signal peptide sequence of CD19 with the signal peptide sequence of IL-2, and leads the CD19-Fc fusion protein to be secreted into a culture medium; using Lipofectamine^TM2000(Invitrogen, Carlsbad, CA) the above expression vector was transfected into HEK293T cells, the supernatant was collected, and CD19-Fc fusion Protein was isolated and purified by Protein a Argrose (GE Healthcare, Piscataway, NJ) affinity column, and the resulting antigen was CD 19.

The specific process of phage display is: the immunoplates were coated overnight at 4 ℃ with 100. mu.g/ml of the CD19 antigen obtained above; blocking the immune plate for 1 hour at room temperature by using PBS (phosphate buffer solution) containing 5% of skimmed milk powder and 0.1% of Tween-20; tomlinson I&J phage library (Genservice Ltd., Cambridge, UK, library size 1.47x10⁸) At 10¹²Mixing pfu with 3% skimmed milk powder PBS solution 1:1, incubating at room temperature for 2 hours, adding into a sealed immune plate (100 μ l/well), and incubating at room temperature for 1 hour; washed with 0.1% Tween-20 in PBSWashing the immune plate for 20 times; 100 μ l of 100mM Triethylamine was eluted at room temperature for 30 min; the eluted phage infected TG1 cells in log phase growth, which were expanded and recovered for the next round of panning. Positive phage enrichment was analyzed by ELISA after panning.

And (3) ELISA detection: the immune plates were coated overnight at 4 ℃ with 10. mu.g/ml of the CD19 antigen obtained above and the negative control protein Frizzled-Fc, respectively; blocking the immune plate for 1 hour at room temperature by using PBS (phosphate buffer solution) containing 3 percent of skimmed milk powder and 0.1 percent of Tween-20; amplifying and recovering the enriched phage in each round, incubating with 6% skimmed milk powder PBS at room temperature for 2 hours in a ratio of 1:1, adding into a sealed immune plate (100 μ l/well), and incubating at room temperature for 1 hour; the immune plate was washed 5 times with 0.1% Tween-20 in PBS; HRP/Anti-M13 Monoclonal conjugate was treated at a rate of 1: mixing with PBS solution containing 3% skimmed milk powder and 0.05% Tween-20 at ratio of 4000, adding into washed immunoplates (50 μ l/well), and incubating at room temperature for 1 hr; the immune plate was washed 5 times with 0.05% Tween-20 in PBS; adding TMB color developing solution into an immune plate (100 μ l/well), developing at room temperature for 3 minutes, and adding 0.5M sulfuric acid to stop developing (100 μ l/well); detecting the light absorption value by an enzyme linked immunosorbent assay detector at the wavelength of 450nm, and analyzing the affinity of the phage after each round of amplification.

ELISA test results are shown in FIG. 1, and the affinity of phage population to CD19 antigen was significantly increased after four rounds of enrichment using Frizzled as antigen negative control.

And (3) performing antigen binding analysis on the fourth round of enriched phage monoclonal, wherein the specific process comprises the following steps:

TG1 cells were infected with the fourth round of enriched phage pools and 200 single clones were randomly picked from them, amplified and phage recovered. The immunoplates were coated overnight at 4 ℃ with 10. mu.g/ml of the CD19 antigen obtained above and the negative control Frizzled-Fc protein, respectively; blocking the immune plate for 1 hour at room temperature by using PBS (phosphate buffer solution) containing 3 percent of skimmed milk powder and 0.05 percent of Tween-20; incubating 200 amplified monoclonal phages with 6% skim milk powder PBS at a ratio of 1:1 for 1 hour at room temperature, adding the phages into a sealed immune plate (50. mu.l/well) coated with CD19 antigen and negative control Frizzled-Fc protein, and incubating for 1 hour at room temperature; the immune plate was washed 5 times with 0.05% Tween-20 in PBS; HRP/Anti-M13 Monoclonal conjugate was treated at a rate of 1: mixing with PBS solution containing 3% skimmed milk powder and 0.05% Tween-20 at ratio of 4000, adding into washed immunoplates (50 μ l/well), and incubating at room temperature for 1 hr; the immune plate was washed 5 times with 0.05% Tween-20 in PBS; adding TMB color developing solution into an immune plate (100 μ l/well), developing at room temperature for 3 min, and adding 0.5M sulfuric acid to stop developing (100 μ l/well); the absorbance was measured at 450nm using an enzyme linked immunosorbent assay and the binding capacity of the monoclonal phage to CD19 protein was analyzed. The results of the assay are shown in FIG. 2, and 13 positive clones were found to bind to the antigen.

Expression vectors in the form of scFv-Fc antibodies were constructed from the 13 positive clones, and each transfected into HEK293T cells, and then the supernatants were collected and purified using protein A agarose columns. The specific process takes 5G9 as an example:

the scFv sequence of 5G9 was cloned into the expression vector pFUSE-CHIg-hg1 (Invivigen, San Diego, Calif.) to make a plasmid. 5 million HEK293T cells were seeded in 5% CO in a cell culture dish using DMEM medium supplemented with 10% fetal bovine serum, 100U/ml penicillin, 0.1mg/ml streptomycin₂And culturing in an incubator at 37 ℃. When the cell density reached 60-80%, 10 μ G of pFUSE-5G9scFv-Fc plasmid was transfected into HEK293T cells using PEI; the supernatant was collected. Centrifuging the collected supernatant at 3500rpm and 4 deg.C for 20 min, and vacuum filtering with 0.45 μm microporous filter membrane to further remove debris; the supernatant was purified by separation on a Protein A Argrose (GE Healthcare, Piscataway, NJ) affinity column to obtain 5G9scFv-Fc recombinant Protein. The protein concentration was determined by the BCA method, and 5. mu.g of 5G9scFv-Fc recombinant protein was subjected to polyacrylamide gel electrophoresis, and the results are shown in FIG. 3.

Thereafter, the binding of the scFv-Fc purified proteins of 13 positive clones was verified on CHO-CD19 cells, using CHO-K1 cells or the like as a negative control. The specific process takes 5G9 as an example:

CHO-K1, Nalm6, SU-DHL6, and Raji cells were used and purchased from American ATCC (ATCC, Manassas, Va.). Using Lipofectamine^TM2000(Invitrogen, Carlsbad, Calif.) the CD19cDNA was transfected into CHO-K1 cells and puromycin screening yielded the CD19 overexpressing cell line CHO-CD 19. CHO-K1, CHO-CD19Culturing in complete F12K culture medium supplemented with 10% fetal calf serum, 100U/ml penicillin, and 0.1mg/ml streptomycin; nalm6, SU-DHL6, Raji were cultured in RPMI complete medium supplemented with 10% fetal bovine serum, 100U/ml penicillin, 0.1mg/ml streptomycin.

Respectively taking 0.5 × 10⁶CHO-CD19, CHO-K1, Nalm6, SU-DHL6, and Raji cells were centrifuged at 2000rpm for 5 minutes at 4 ℃, the supernatant was discarded, washed once with PBS, and the cells were resuspended in 200. mu.l FACS buffer and stained with 10. mu.g/ml 5G9scFv-Fc on ice for 1 hour. Centrifugation at 2000rpm for 5 min at 4 ℃ discarded supernatant, cells washed once with PBS, re-suspended in 200 μ l FACS buffer, and centrifuged at 1: a PE-labeled goat anti-human IgG secondary antibody was added at a rate of 200, and incubated on ice for 1 hour. PBS was washed once and the cells were finally resuspended in 300. mu.l PBS, the PE fluorescence signal was detected by BD Calibur and the specific binding of the 5G9scFv-Fc protein to CD19 positive cells was analyzed by FlowJo software.

The results showed that, among the 13 candidate sequences, antibody 5G9 was able to specifically bind to CD19 positive cells (i.e., CHO-CD19 cells), as shown in FIG. 4, with CHO-K1 cells as a negative control.

The DNA sequence of the scFv version of antibody 5G9 is SEQ ID NO:1, amino acid sequence of SEQ ID NO: 2.

SEQ ID NO：1：

GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGATATTGCTAATGATGGTTCTTCTACAGCTTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAATCTACTACTTCTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGAGCGGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGGTCGACGGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATTCTGCATCCACTTTGCAAAGTGGGGTCCCATTAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGACTGATACTGCTCCTTCTACGTTCGGCCAAGGGACCAAGGTGGAAATCAAA。

SEQ ID NO：2：

EVQLLESGGGLVQPGGSLRLSCAASGFTFSSYAMSWVRQAPGKGLEWVSDIANDGSSTAYADSVKGRFTISRDNSKNTLYLQMNSLRAEDTAVYYCAKSTTSFDYWGQGTLVTVSSGGGGSGGGGSGGGGSTDIQMTQSPSSLSASVGDRVTITCRASQSISSYLNWYQQKPGKAPKLLIYSASTLQSGVPLRFSGSGSGTDFTLTISSLQPEDFATYYCQQTDTAPSTFGQGTKVEIK。

in the amino acid sequence, 1-116 is the antibody heavy chain sequence, 132-239 is the antibody light chain sequence, and 117-131 is the connecting peptide sequence. The CDR regions contained therein are as follows: amino acid residues 26-33 (i.e., GFTFSSYA) are heavy chain CDR1, amino acid residues 50-59 (i.e., DIANDGSSTA) are heavy chain CDR2, and amino acid residues 100-103 (i.e., TTSF) are heavy chain CDR 3; amino acid residues 161-165 (i.e., ISSYL) are the light chain CDR1, amino acid residues 183-186 (i.e., ASTL) are the light chain CDR2, and amino acid residues 224-229 (i.e., DTAPST) are the light chain CDR 3.

Furthermore, the antibody format may be selected from VH single domain antibody, Fab fragment, Fab 'fragment, F (ab)'₂A fragment, a single chain variable fragment (scFv), a disulfide stabilized variable region fragment (dsFv), an IgG molecule, or a bispecific antibody. The antibody may optionally have a label including fluorescent, enzymatic, and radioactive labels.

Example 2 affinity analysis of antibody 5G9

Take 0.5X 10⁶CHO-CD19 cells were centrifuged at 2000rpm at 4 ℃ for 5 minutes, the supernatant was discarded and washed once with PBS, the cells were resuspended in 200. mu.l FACS buffer, 10 gradients of 5G9scFv-Fc antibody purified according to example 1 were added, 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78, 0.39, 0.195, 0. mu.g/ml, and stained on ice for 1 hour. Centrifugation at 2000rpm for 5 min at 4 ℃ discarded supernatant, cells washed once with PBS, re-suspended in 200 μ l FACS buffer, and centrifuged at 1: a PE-labeled goat anti-human IgG secondary antibody was added at a rate of 200, and incubated on ice for 1 hour. PBS was washed once and finally resuspended in 300. mu.l PBS, the PE fluorescence signal was detected by BD Calibur, and the FlowJo software analyzed the binding of different concentrations of 5G9scFv-Fc protein to CHO-CD19 cells. The 5G9scFv-Fc protein affinity curves were fitted and the affinities calculated.

The results are shown in FIG. 5, where antibody 5G9 bound to CHO-CD19 cells with an affinity of 83.48 nM.

Example 3 analysis of antibody 5G9 for specific binding to B cell line

The specific binding condition of the antibody 5G9 to a B cell line is detected by flow cytometry, Nalm6 is a B-ALL cell line, SU-DHL6 and Raji are B lymphoma cell lines, and the cell lines are CD19 positive expression cell lines. As shown in FIG. 6, the results show that the antibody 5G9 has strong specific binding ability with Nalm6, SU-DHL6 and Raji.

Example 4, antibody 5G9, antibody FMC63 and CD19 Positive B cell Competition binding assay

The example 1 antibody 5G9scFv, and the antibody FMC63scFv were used^[6](ii) a And performing Biotin labeling on the FMC63scFv to obtain FMC 63-Biotin.

A negative control group, a negative antibody group, an antibody 5G9 group and an antibody FMC63 group are set up, and the groups are respectively processed and analyzed according to the following processes:

take 0.5X 10⁶CHO-CD19 cells were centrifuged at 2000rpm at 4 ℃ for 5 minutes, the supernatant was discarded and washed once with PBS, the cells were resuspended in 200. mu.l FACS buffer, samples from each group were added and incubated on ice for 1 hour. Wherein, the sample added into the negative Control group is PBS, the sample added into the negative antibody group is negative antibody scFv (Control scFv, any scFv antibody which can not be combined with CD19 is adopted), the sample added into the antibody 5G9 group is negative antibody 5G9scFv with the concentration of 10 μ G/ml, the sample added into the antibody FMC63 group is antibody FMC63scFv with the concentration of 2 μ G/ml, and each antibody group is added with antibody to block the cell surface CD19 binding epitope.

Thereafter, centrifugation was carried out at 2000rpm at 4 ℃ for 5 minutes, the supernatant was discarded, the cells were washed once with PBS, the cells were resuspended again in 200. mu.l of FACS buffer, and after addition of 2. mu.g/ml FMC63-Biotin, incubation was carried out for 1 hour on ice; centrifugation was carried out at 2000rpm for 5 minutes at 4 ℃, the supernatant was discarded, the cells were washed once with PBS, the cells were resuspended in 200 μ l FACS buffer again, and the ratio of 1: adding PE-labeled streptavidin (SA-PE) at a ratio of 200, and incubating for 1 hour on ice; PBS was washed once and finally resuspended in 300. mu.l PBS, PE fluorescence labeling signal was detected by BD Calibur (results are shown in FIG. 7), and data was analyzed by FlowJo software (results are shown in FIG. 8).

The results indicate that the group of antibodies FMC63 rendered FMC63-Biotin unable to bind to cells due to blocking of the cell surface CD19 binding epitope with FMC63scFv, i.e. FMC63scFv was able to compete for FMC63 Biotin binding to CD19 positive B cells. The antibody 5G9 group was similar to the negative antibody group, and had no significant competitive effect on FMC63 biotin binding to CD19 positive B cells. That is, at the cellular level, the binding of antibody 5G9 to CD19 does not competitively interfere with the binding of antibody FMC63 to CD19, and the results indicate that antibody 5G9 and its derivatives, CAR-T cells, conjugates, etc. have the potential to generate synergistic effects with antibody FMC63 and its derivatives, CAR-T cells, and have potential for anti-tumor applications.

The antibody 5G9 of the invention can be specifically combined with CD19, and can be used for preparing chimeric antigen receptor T cells, chimeric antigen receptor NK cells or artificially edited cells or preparing conjugates like the existing anti-CD 19 antibody. The conjugate can be selected from antibody 5G 9-bacterial toxin conjugate, antibody 5G 9-bacterial toxin variant conjugate, antibody 5G 9-cytokine conjugate, and antibody 5G 9-chemotherapeutic drug conjugate.

In addition to the above embodiments, the present invention may have other embodiments. All technical solutions formed by adopting equivalent substitutions or equivalent transformations fall within the protection scope of the claims of the present invention.

Reference to the literature

[1]Tedder TF,Inaoki M,Sato S.The CD19-CD21complex regulates signal transduction thresholds governing humoral immunity and autoimmunity.[J].Immunity.1997,6:107-118.

[2]Katz BZ,Herishanu Y.Therapeutic targeting of CD19in hematological malignancies:past,present,future and beyond.[J].Leuk lymphoma.2014,5(55):999-1006.

[3]Carl HJ,Michel S.Chimeric Antigen Receptor Therapy.[J].NEJM.2018,379:64-73.

[4]Stephen JS,Jakub S,et al.Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas.[J].NEJM.2017,377:2545-54.

[5]Neelapu SS,Locke FL,et al.Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma.[J].NEJM.2017,377:2531-44.

[6]Cooper L J N,Jena B,Maiti S.Anti-CD19scFv(FMC63)polypeptide:,US9701758[P].2017.

Sequence listing

<110> Nanjing university of medical science

<120> fully humanized antibody specifically binding to CD19 and application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 717

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct 120

ccagggaagg ggctggagtg ggtctcagat attgctaatg atggttcttc tacagcttac 180

gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240

ctgcaaatga acagcctgag agccgaggac acggccgtat attactgtgc gaaatctact 300

acttcttttg actactgggg ccagggaacc ctggtcaccg tctcgagcgg tggaggcggt 360

tcaggcggag gtggcagcgg cggtggcggg tcgacggaca tccagatgac ccagtctcca 420

tcctccctgt ctgcatctgt aggagacaga gtcaccatca cttgccgggc aagtcagagc 480

attagcagct atttaaattg gtatcagcag aaaccaggga aagcccctaa gctcctgatc 540

tattctgcat ccactttgca aagtggggtc ccattaaggt tcagtggcag tggatctggg 600

acagatttca ctctcaccat cagcagtctg caacctgaag attttgcaac ttactactgt 660

caacagactg atactgctcc ttctacgttc ggccaaggga ccaaggtgga aatcaaa 717

<210> 2

<211> 239

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Asp Ile Ala Asn Asp Gly Ser Ser Thr Ala Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Lys Ser Thr Thr Ser Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val

100 105 110

Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Thr Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser

130 135 140

Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser

145 150 155 160

Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro

165 170 175

Lys Leu Leu Ile Tyr Ser Ala Ser Thr Leu Gln Ser Gly Val Pro Leu

180 185 190

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

195 200 205

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Asp

210 215 220

Thr Ala Pro Ser Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

225 230 235

Claims

1. A fully humanized antibody that specifically binds CD19, said antibody comprising a heavy chain and a light chain; the antibody is characterized by comprising the following all technical characteristics:

2. The fully humanized antibody that specifically binds to CD19 of claim 1, wherein the amino acid sequence of said antibody is set forth in SEQ ID No. 2.

3. According toThe fully humanized antibody specifically binding to CD19 of claim 1 or 2, characterized in that the antibody is a Fab fragment, a Fab 'fragment, F (ab)'₂A fragment, a single chain variable fragment (scFv), a disulfide stabilized variable region fragment (dsFv), an IgG molecule, or a bispecific antibody.

4. The fully humanized antibody that specifically binds CD19 according to claim 1 or 2, wherein the antibody has a label comprising a fluorescent label, an enzymatic label, and a radioactive label.

5. A nucleic acid encoding a fully humanized antibody according to any of claims 1 to 4 that specifically binds CD 19.

6. The nucleic acid of claim 5, wherein the sequence of the nucleic acid is as shown in SEQ ID NO. 1.

7. A cell or conjugate having a fully humanized antibody of any of claims 1 to 4 that specifically binds CD 19.

8. The cell or conjugate of claim 7, wherein the cell comprises a chimeric antigen receptor T cell, a chimeric antigen receptor NK cell, and an artificially edited cell; the conjugates include fully humanized antibody-bacterial toxin conjugates that specifically bind CD19, fully humanized antibody-bacterial toxin variant conjugates that specifically bind CD19, fully humanized antibody-cytokine conjugates that specifically bind CD19, and fully humanized antibody-chemotherapeutic drug conjugates that specifically bind CD 19.

9. Use of a fully humanized antibody according to any of claims 1 to 4 specifically binding to CD19 for the preparation of a cell or conjugate, a diagnostic kit, a medicament or a pharmaceutical composition.

10. Use of a nucleic acid according to claim 5 or 6 for the preparation of a fully humanized antibody, a medicament or a pharmaceutical composition specifically binding to CD 19.

11. Use of a cell or conjugate according to claim 7 or 8 for the preparation of a medicament or pharmaceutical composition.

12. Use according to claim 9 or 10 or 11, characterized in that the medicament or pharmaceutical composition has an anti-tumour effect against CD19 positive tumours.