CN109288853A - Application of the notoginsenoside R in preparation prevention or treatment liver injury medicament - Google Patents
Application of the notoginsenoside R in preparation prevention or treatment liver injury medicament Download PDFInfo
- Publication number
- CN109288853A CN109288853A CN201811391583.XA CN201811391583A CN109288853A CN 109288853 A CN109288853 A CN 109288853A CN 201811391583 A CN201811391583 A CN 201811391583A CN 109288853 A CN109288853 A CN 109288853A
- Authority
- CN
- China
- Prior art keywords
- notoginsenoside
- gsh
- liver
- apap
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a kind of application of notoginsenoside R in preparation prevention or treatment liver injury medicament, GSH content obviously increases in blood plasma after notoginsenoside R of the present invention damages paracetamol, high dose RDA increases 65.56%, restore liver GSH metaboilic level, significantly reduces the hepar damnification as caused by APAP disease model.GSH mainly makes cell from the damage of various harmful substances by its oxidation resistance in vivo, therefore, will cause to damage to body when GSH is swept off.Therefore notoginsenoside R has effectively restored hepar damnification situation caused by acetparaminosalol phenol agents.
Description
(1) technical field
The present invention relates to a kind of new application of notoginsenoside R, i.e. notoginsenoside R in preparation prevention or is treated to acetyl ammonia
Application in hepatotoxic medication caused by base phenol.
(2) background technique
Paracetamol (acetaminophen, APAP) is a kind of common over the counter antalgesic and alexipyretic, is used for
The mild of reduction of patient.In the U.S., Britain, Australia and other American-European countries, APAP is excessively drug induced hepatic injury
With the most common reason of ALF.Paracetamol (APAP) is to cause the most common drug of drug induced hepatic injury, in excess injection
Alanine aminotransferase (ALT) value can reach peak in 6~12h after APAP, be often used as the mould of drug induced hepatic injury
Type.A kind of drug of the APAP as antipyretic-antalgic, taking between overdose or length can make to accumulate a large amount of APAP in vivo, raw
At more toxicant N- acetyl 1,4-benzoquinone imines (NAPQI), to cause it to lose its activity, largely consumes intracorporal growth and swash
Plain sercretogogue (GHS) protect liver cell cannot and then cause hepatic injury, or even liver failure occurs.Those are proceeded to
For the people of hepatic failure, the only effective treatment method is exactly liver transfer operation.
Arasaponin is the main effective active composition of Panax Chinese medicine Radix Notoginseng.Notoginsenoside R
(notoginsenoside R1), is a kind of main component isolated from Radix Notoginseng and novel plant estrogen, have it is anti-inflammatory,
Anti-oxidant and anti-apoptotic property.Before studies have shown that notoginsenoside R can obviously inhibit the generation of multiple inflammatory factors, mitigate
Endotoxin mouse heart dysfunction symptom.But its rare report of influence to liver drug toxicity.
(3) research contents
It is an object of the present invention to provide a kind of hepatic injuries caused by preparation prevention or treatment paracetamol of notoginsenoside R
Application in drug.
The technical solution adopted by the present invention is that:
The present invention provides a kind of application of notoginsenoside R in preparation prevention or treatment liver injury medicament.
Further, the liver injury medicament is liver injury medicament caused by paracetamol.
Notoginsenoside R structural formula of the present invention is as follows:
Notoginsenoside R has mainly restored GSH content in body in the present invention, GSH be by glutamic acid, cysteine and
Tripeptide compound made of glycine set, mainly synthesizes in liver, plays an important role in the metabolism of liver.
The beneficial effects are mainly reflected as follows:
GSH content obviously increases in blood plasma after notoginsenoside R of the present invention damages paracetamol, and high dose RDA increases
Add 65.56%, restored liver GSH metaboilic level, has significantly reduced the hepar damnification as caused by APAP disease model.GSH is in body
It is interior mainly to make cell from the damage of various harmful substances by its oxidation resistance, therefore, when GSH is swept off
Time will cause to damage to body.Therefore notoginsenoside R has effectively restored the damage of liver caused by acetparaminosalol phenol agents
Condition of the injury condition.
(4) Detailed description of the invention
Fig. 1 is influence of the notoginsenoside R of the present invention to glutamic-pyruvic transaminase in mice plasma (ALT).It is (different in histogram
Character bar chart between have significant difference, P < 0.05).
Fig. 2 is influence of the notoginsenoside R of the present invention to glutamic-oxalacetic transaminease in mice plasma (AST).It is (different in histogram
Character bar chart between have significant difference, P < 0.05).
Fig. 3 is influence of the notoginsenoside R of the present invention to GSH in mouse liver.(in histogram, the bar shaped of different characters
There are significant difference, P < 0.05 between figure).
Fig. 4 is influence of the notoginsenoside R of the present invention to MDA in mouse liver.(in histogram, the bar shaped of different characters
There are significant difference, P < 0.05 between figure).
Fig. 5 is that notoginsenoside R of the present invention influences the expression of TNF-a in mouse liver.(in histogram, different characters
Bar chart between have significant difference, P < 0.05).
Fig. 6 is that notoginsenoside R of the present invention influences the expression of IL-1 β in mouse liver.(in histogram, different characters
Bar chart between have significant difference, P < 0.05).
Fig. 7 is that notoginsenoside R of the present invention influences the expression of IL-6 in mouse liver.(in histogram, different characters
Bar chart between have significant difference, P < 0.05).
(5) specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in
This:
Embodiment 1
1, material:
Experimental animal: C57BL/6 male mice 30, Shanghai Slac Experimental Animal Co., Ltd., company are purchased from
Licensing number: SCXK (Shanghai) 2017-0005 is raised in Zhejiang University of Traditional Chinese Medicine's Experimental Animal Center, SPF environment.
Reagent: notoginsenoside R；ALT, AST, reduced glutathione (GSH) assay kit (Nanjing is built up).
RT-PCR primer:
| primer | Forward Primer | Reverse Primer |
| TNF-a | GGAACACGTCGTGGGATAATG | GGCAGACTTTGGATGCTTCTT |
| IL-1β | CACTACAGGCTCCGAGAT | ACACAGGACAGGTATAGATTC |
| IL-6 | GGCGGATCGGATGTTGTGAT | GGACCCCAGACAATCGGTTG |
2, medicine preparation
2.1. the dosage (physiological saline is as solvent) of notoginsenoside R stomach-filling liquid:
Notoginsenoside R low dosage: final concentration 100mg/kg mouse weight, drug concentration 12.50mg/mL
Notoginsenoside R middle dosage: final concentration 150mg/kg mouse weight, drug concentration 18.75mg/mL
Notoginsenoside R high dose: final concentration 200mg/kg mouse weight, drug concentration 25.00mg/mL
2.2. the preparation of acetaminophen solution: accurately weighed paracetamol 0.5g is dissolved in 20mL physiology
In salt water, water-bath is filtered to after being completely dissolved, and taking filtrate is paracetamol (APAP) solution.Every intragastric administration on mice
APAP is calculated, the practical stomach-filling volume of APAP=(mouse actual weight/25g) × 0.5mL, given low with every mouse 25g
For 500mg/kg.
3, method:
C57BL/6 mouse is random to the C57BL/6 mouse of 8 week old after SPF rank Animal Lab. carries out adaptation nursing
It is divided into 5 groups, every group 6, respectively control group (Control), APAP group (APAP), APAP+ notoginsenoside R low dose group,
APAP+ notoginsenoside R middle dose group, APAP+ notoginsenoside R high dose group.
APAP+ notoginsenoside R low dose group, APAP+ notoginsenoside R middle dose group, APAP+ notoginsenoside R high dose
Group carries out stomach-filling 0.2mL drug in the daily morning by 2.1 dosage, and control group and APAP group use the physiological saline of same dose
Stomach-filling, continuous gavage 3 days, once a day, and after third day stomach-filling 2h, control group stomach-filling physiological saline, APAP group and medicine group
(APAP+ notoginsenoside R low dose group, APAP+ notoginsenoside R middle dose group, APAP+ notoginsenoside R high dose group) carries out
Mouse is injected intraperitoneally after 6h with 10% chloraldurate and is anaesthetized by APAP stomach-filling (500mg/kg weight), and abdomen inferior caval vein takes
Hematometry glutamic-pyruvic transaminase (ALT), glutamic-oxalacetic transaminease (AST) take liver to detect GSH, MDA and related gene expression.
4, experimental result:
Influence of Fig. 1 notoginsenoside R of the present invention to glutamic-pyruvic transaminase in mice plasma (ALT).The result shows that Radix Notoginseng soap
The raising of ALT caused by APAP can be significantly reduced in glycosides R1.Glutamic-pyruvic transaminase is primarily present in liver cytoplasm, intracellular concentration
Higher than 1000-3000 times in serum, as long as there is 1% liver cell to be destroyed, so that it may so that sero-enzyme increasing doubles.Therefore, paddy
Pyruvic transaminase is the most sensitive Testing index of hepatic disorder by world health organisation recommendations.ALT is reduced this means that hepatic injury
It reduces.
Influence of Fig. 2 notoginsenoside R of the present invention to glutamic-oxalacetic transaminease in mice plasma (AST).The result shows that Radix Notoginseng soap
The raising of AST caused by APAP can be significantly reduced in glycosides R1.AST content when normal in serum is lower, but corresponding cell damage
When, permeability of cell membrane increases, and intracytoplasmic AST is released into blood, therefore its serum-concentration increases.
Influence of Fig. 3 notoginsenoside R of the present invention to GSH in mouse liver.The result shows that compared with normal group, model group
Liver homogenate GSH content significantly reduces, and notoginsenoside R can significantly restore the content of GSH in liver, and GSH is by glutamic acid, half
Tripeptide compound made of cystine and glycine set, mainly synthesizes in liver, plays in the metabolism of liver important
Effect.GSH mainly makes cell from the damage of various harmful substances by its oxidation resistance in vivo, therefore, works as GSH
Body will be caused to damage when being swept off.And notoginsenoside R preferred dose is 200mg/kg.
Influence of Fig. 4 notoginsenoside R of the present invention to MDA in mouse liver.The result shows that compared with normal group, model group
Liver homogenate MDA content significantly increases, and shows that body internal oxidition and antioxidant system are unbalance, and body is anti-oxidant and removes freely
The ability of base significantly reduces, and liver cell is severely damaged, and medicine group can effectively reduce the content of MDA, and Radix Notoginseng
Saponin(e R1 preferred dose is 200mg/kg.
Fig. 5 is that notoginsenoside R of the present invention influences the expression of TNF-a in mouse liver.The result shows that with normal group phase
Than, the expression of tumor necrosis factor (TNF-a) significantly increases in model group hepatic tissue, and notoginsenoside R treated mouse,
It can significantly reduce the expression of TNF-a.The adjustable immune response of the TNF-a of body normal level, it is anti-infective etc., but
The immunologic balance that body can be then destroyed when great expression, generates a variety of pathology damages together with other inflammatory factors.Radix Notoginseng
Saponin(e R1 can significantly reduce the expression of the TNF-a as caused by APAP and increase, and notoginsenoside R preferred dose is 200mg/kg.
Fig. 6 is that notoginsenoside R of the present invention influences the expression of IL-1 β in mouse liver.The result shows that with normal group phase
Than the expression of interleukin-11 β (IL-1 β) significantly increases in model group hepatic tissue, and notoginsenoside R treated mouse, can show
Write the expression for reducing IL-1 β.The a variety of diseases such as il-1 β is a kind of proinflammatory cytokine, and wide participation tissue is destroyed
Damage process is managed, a variety of pathology damages are generated together with other inflammatory factors.Notoginsenoside R can significantly reduce to be caused by APAP
IL-1 β express increase, and notoginsenoside R preferred dose be 200mg/kg.
Fig. 7 is that notoginsenoside R of the present invention influences the expression of IL-6 in mouse liver.The result shows that with normal group phase
Than the expression of interleukin 6 (IL-6) significantly increases in model group hepatic tissue, and notoginsenoside R treated mouse, can be significant
Reduce the expression of IL-6.IL-6 is a kind of cell factor generated by various kinds of cell such as macrophage, T cell, B cells,
With the occurrence and development of many diseases.IL-6 has extensive biology living as the key factor in Organism immunoregulation network
Property.IL-6 is increased with the damage of liver function in progressive.Blood serum IL-6 increases, weight liver inflammation reaction, into necrosis of liver cells.Three
Seven saponin(e R1 can significantly reduce the expression of the IL-6 as caused by APAP and increase, and notoginsenoside R preferred dose is 200mg/kg.
5, advantage and effect:
The hepatotoxicity wind agitation caused by paracetamol can be effectively protected in notoginsenoside R, can prevent or treat to acetyl ammonia
A kind of drug of base phenol.
Claims (2)
1. a kind of application of notoginsenoside R in preparation prevention or treatment liver injury medicament.
2. application as described in claim 1, it is characterised in that the liver injury medicament is hepatic injury caused by paracetamol
Drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811391583.XA CN109288853A (en) | 2018-11-21 | 2018-11-21 | Application of the notoginsenoside R in preparation prevention or treatment liver injury medicament |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811391583.XA CN109288853A (en) | 2018-11-21 | 2018-11-21 | Application of the notoginsenoside R in preparation prevention or treatment liver injury medicament |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109288853A true CN109288853A (en) | 2019-02-01 |
Family
ID=65144446
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811391583.XA Pending CN109288853A (en) | 2018-11-21 | 2018-11-21 | Application of the notoginsenoside R in preparation prevention or treatment liver injury medicament |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109288853A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115120583A (en) * | 2022-07-08 | 2022-09-30 | 浙江中医药大学 | Application of phenylpropanoid derivatives in preparation of drugs for preventing and treating liver failure |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101327220A (en) * | 2007-06-21 | 2008-12-24 | 天津天士力制药股份有限公司 | Use of pseudo-ginseng saponin R1 in preparing medicament for treating liver damage |
| CN101695498A (en) * | 2009-10-26 | 2010-04-21 | 昆明理工大学 | Medicament for protecting hepatic injury caused by paracetanol and application thereof |
| CN102100711A (en) * | 2005-12-07 | 2011-06-22 | 昆明制药集团股份有限公司 | Application of pseudoginseng root total saponins and preparations thereof in adjuvant treatment of 'systemic inflammatory response syndrome' |
-
2018
- 2018-11-21 CN CN201811391583.XA patent/CN109288853A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102100711A (en) * | 2005-12-07 | 2011-06-22 | 昆明制药集团股份有限公司 | Application of pseudoginseng root total saponins and preparations thereof in adjuvant treatment of 'systemic inflammatory response syndrome' |
| CN101327220A (en) * | 2007-06-21 | 2008-12-24 | 天津天士力制药股份有限公司 | Use of pseudo-ginseng saponin R1 in preparing medicament for treating liver damage |
| CN101695498A (en) * | 2009-10-26 | 2010-04-21 | 昆明理工大学 | Medicament for protecting hepatic injury caused by paracetanol and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| LIU, JIE等: "The effect of Chinese hepatoprotective medicines on experimental liver injury in mice", 《 JOURNAL OF ETHNOPHARMACOLOGY》 * |
| 卫莹芳主编: "《中药鉴定学》", 30 September 2010, 上海科学技术出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115120583A (en) * | 2022-07-08 | 2022-09-30 | 浙江中医药大学 | Application of phenylpropanoid derivatives in preparation of drugs for preventing and treating liver failure |
| CN115120583B (en) * | 2022-07-08 | 2023-06-27 | 浙江中医药大学 | Application of phenylpropanoid derivatives in preparation of drugs for preventing and treating liver failure |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Demethyleneberberine attenuates concanavalin A-induced autoimmune hepatitis in mice through inhibition of NF-κB and MAPK signaling | |
| Lee et al. | Therapeutic effects of the oriental herbal medicine Sho‐saiko‐to on liver cirrhosis and carcinoma | |
| Zhou et al. | Hepatoprotective effect of juglone on dimethylnitrosamine‑induced liver fibrosis and its effect on hepatic antioxidant defence and the expression levels of α‑SMA and collagen III | |
| CN109276566A (en) | Application of the atractylenolide Ⅰ in preparation prevention or treatment liver injury medicament | |
| CN109288853A (en) | Application of the notoginsenoside R in preparation prevention or treatment liver injury medicament | |
| CN101549039B (en) | Application of schisandra fruit or related monomeric compound thereof for preventing or curing fatty liver | |
| CN109260213A (en) | Application of the Anemodeanin A in preparation prevention or treatment liver injury medicament | |
| CN111228287A (en) | Application of epimedium flavone glycoside compound in preparing medicine for treating melanoma | |
| AU2017206332B2 (en) | Use of Cistanche tubulosa extract and isoacteoside in protection of muscles | |
| US8927601B2 (en) | Uses of N-butylidenephthalide in treating a liver injury and improving liver function | |
| CN102188476A (en) | Composition of effective Chinese medicine components for treating hepatic fibrosis | |
| CN102342962A (en) | Application of extracts from Portulaca oleracea L. in preparation of anti-liver injury medicines and health foods | |
| CN111700900A (en) | Natural immune activator, TIL cell promoter and application thereof | |
| CN114129572B (en) | Pharmaceutical composition for synergistically inhibiting tetrandrine-induced drug-induced liver injury | |
| RU2679447C1 (en) | Application of l-lysine tiazototate as an active basis for medicines of hepatoprotective and detoxicative action | |
| CN103751305B (en) | A kind of medicine for the treatment of rheumatoid arthritis and preparation method thereof | |
| Ashraf et al. | An open-label randomized clinical study to compare the effects of a nutritional supplement versus vitamin E on fibroscan score in nonalcoholic steatohepatitis (NASH) patients | |
| CN103599102B (en) | Application of Nitrosporeusines A in drugs for treating acute renal failure | |
| CN113332416B (en) | Application of glutamine dipeptide in preparation of medicine for treating non-alcoholic fatty liver disease | |
| WO2022178967A1 (en) | Pharmaceutical composition of forskolin-isoforskolin and pentacyclic triterpenoid compound, and application thereof | |
| CN105168226A (en) | Medicine for lowering blood glucose and application of medicine | |
| CN103599105B (en) | Application of Caesanines D in drugs used for treating acute renal failure | |
| CN111228248A (en) | Medicine for treating liver injury and application of zingerone in preparing medicine for treating liver injury | |
| CN117323337A (en) | Application of begonin in preparation of medicine for treating non-alcoholic fatty liver disease | |
| CN114917211A (en) | Application of bisdemethoxycurcumin in preparation of medicines for treating nilotinib hepatotoxicity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190201 |
|
| RJ01 | Rejection of invention patent application after publication |