CN109260213A - Application of the Anemodeanin A in preparation prevention or treatment liver injury medicament - Google Patents
Application of the Anemodeanin A in preparation prevention or treatment liver injury medicament Download PDFInfo
- Publication number
- CN109260213A CN109260213A CN201811392492.8A CN201811392492A CN109260213A CN 109260213 A CN109260213 A CN 109260213A CN 201811392492 A CN201811392492 A CN 201811392492A CN 109260213 A CN109260213 A CN 109260213A
- Authority
- CN
- China
- Prior art keywords
- anemodeanin
- gsh
- apap
- liver
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
The invention discloses a kind of application of Anemodeanin A in preparation prevention or treatment liver injury medicament, Anemodeanin A of the present invention paracetamol is damaged after blood plasma in GSH content obviously increase, high dose RDA increases 75.26%, restore liver GSH metaboilic level, significantly reduces the hepar damnification as caused by APAP disease model.GSH mainly makes cell from the damage of various harmful substances by its oxidation resistance in vivo, therefore, will cause to damage to body when GSH is swept off.Therefore Anemodeanin A has effectively restored hepar damnification situation caused by acetparaminosalol phenol agents.
Description
(1) technical field
The present invention relates to a kind of new application of Anemodeanin A, i.e. Anemodeanin A in preparation prevention or is treated to acetyl
Application in hepatotoxic medication caused by amino phenols.
(2) background technique
Paracetamol (acetaminophen, APAP) is a kind of common over the counter antalgesic and alexipyretic, is used for
The main reason for mild .APAP of reduction of patient is excessively most industrial countries acute hepatic failure (ALF).APAP poison
Property account for about 50% in all ALF cases in the U.S., the death rate of automobile industry is 30%.The U.S., Britain, Australia and its
Its American-European countries, APAP are excessively drug induced hepatic injury and the most common reason of ALF.And the very widely used consumption figure of APAP
Huge, in China such as Bufferin, morning-night, Tylenol, 999 cold drugs, dimension c Lonicera and Forsythia piece etc., days common medicine contains largely
APAP.It is only limitted to N-acetylcystein in the treatment at present to hepatic failure caused by APAP, effect is mainly by restoring paddy
The sweet peptide level of Guang and supportive treatment.For the people that those proceed to hepatic failure, the only effective treatment method is exactly liver
Transplanting.
Anemodeanin A (Raddeanin A, RDA) be to be isolated from Radde Anemone Rhizome (also known as pasqueflower, pointed at both ends)
A kind of triterpenoid saponin, " hospital song include " describes earliest pointed at both ends treats breast cancer.Modern pharmacological research has proven to RDA tool
There is the effects of apparent antitumor, anti-inflammatory, antipyretic-antalgic, anticonvulsion, calm.At present in experimental study, primarily with respect to tumour
With certain inhibiting effect, but the mechanism of action is still indefinite.
(3) research contents
It is an object of the present invention to provide a kind of hepatic injuries caused by preparation prevention or treatment paracetamol of Anemodeanin A
Application in drug.
The technical solution adopted by the present invention is that:
The present invention provides a kind of application of Anemodeanin A in preparation prevention or treatment liver injury medicament.
Further, the liver injury medicament is liver injury medicament caused by paracetamol.
Anemodeanin A structural formula of the present invention is as follows:
Anemodeanin A has mainly restored GSH content in body in the present invention, GSH be by glutamic acid, cysteine and
Tripeptide compound made of glycine set, mainly synthesizes in liver, plays an important role in the metabolism of liver.
The beneficial effects are mainly reflected as follows:
Anemodeanin A of the present invention paracetamol is damaged after blood plasma in GSH content obviously increase, high dose
RDA increases 75.26%, has restored liver GSH metaboilic level, significantly reduces the hepar damnification as caused by APAP disease model.GSH
Mainly make cell from the damage of various harmful substances by its oxidation resistance in vivo, therefore, when GSH is swept off
When body will be caused to damage.Therefore Anemodeanin A has effectively restored caused by acetparaminosalol phenol agents
Hepar damnification situation.
(4) Detailed description of the invention
Fig. 1 is influence of the Anemodeanin A of the present invention to glutamic-pyruvic transaminase in mice plasma (ALT).(in histogram, no
There are significant difference, P < 0.05 between the bar chart of same character).
Fig. 2 is influence of the Anemodeanin A of the present invention to glutamic-oxalacetic transaminease in mice plasma (AST).(in histogram, no
There are significant difference, P < 0.05 between the bar chart of same character).
Fig. 3 is influence of the Anemodeanin A of the present invention to GSH in mouse liver.(in histogram, the item of different characters
There are significant difference, P < 0.05 between shape figure).
Fig. 4 is influence of the Anemodeanin A of the present invention to MDA in mouse liver.(in histogram, the item of different characters
There are significant difference, P < 0.05 between shape figure).
Fig. 5 is that Anemodeanin A of the present invention influences the expression of TNF-a in mouse liver.(in histogram, different words
There are significant difference, P < 0.05 between the bar chart of symbol).
Fig. 6 is that Anemodeanin A of the present invention influences the expression of IL-1 β in mouse liver.(in histogram, different words
There are significant difference, P < 0.05 between the bar chart of symbol).
Fig. 7 is that Anemodeanin A of the present invention influences the expression of IL-6 in mouse liver.(in histogram, different characters
Bar chart between have significant difference, P < 0.05).
(5) specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in
This:
Embodiment 1
1, material:
Experimental animal: C57BL/6 male mice 30, Shanghai Slac Experimental Animal Co., Ltd., company are purchased from
Licensing number: SCXK (Shanghai) 2017-0005 is raised in Zhejiang University of Traditional Chinese Medicine's Experimental Animal Center, SPF environment.
Reagent: Anemodeanin A (RAD)；ALT, AST, reduced glutathione (GSH) assay kit (build by Nanjing
At).
RT-PCR primer:
| primer | Forward Primer | Reverse Primer |
| TNF-a | GGAACACGTCGTGGGATAATG | GGCAGACTTTGGATGCTTCTT |
| IL-1β | CACTACAGGCTCCGAGAT | ACACAGGACAGGTATAGATTC |
| IL-6 | GGCGGATCGGATGTTGTGAT | GGACCCCAGACAATCGGTTG |
2, medicine preparation
2.1. the dosage (physiological saline is as solvent) of Anemodeanin A stomach-filling liquid:
Anemodeanin A low dosage: final concentration 100mg/kg mouse weight, drug concentration 12.50mg/mL
Anemodeanin A middle dosage: final concentration 200mg/kg mouse weight, drug concentration 25.00mg/mL
Anemodeanin A high dose: final concentration 300mg/kg mouse weight, drug concentration 37.50mg/mL
2.2. the preparation of acetaminophen solution: accurately weighed paracetamol 0.5g is dissolved in 20mL physiology
In salt water, water-bath is filtered to after being completely dissolved, and taking filtrate is paracetamol (APAP) solution.Every intragastric administration on mice APAP
Solution is calculated, the practical stomach-filling volume of APAP solution=(mouse actual weight/25g) × 0.5mL, stomach-filling with every mouse 25g
Dosage is 500mg/kg.
3, method:
C57BL/6 mouse is random to the C57BL/6 mouse of 8 week old after SPF rank Animal Lab. carries out adaptation nursing
It is divided into 5 groups, every group 6, respectively control group (Control), APAP group (APAP), APAP+RDA low dose group (APAP/RDA
Low dosage), APAP+RDA low dose group (APAP/RDA middle dosage), APAP+RDA low dose group (APAP/RDA high dose).
APAP/RDA low dosage, APAP/RDA middle dosage, APAP/RDA high dose group according to 2.1 dosage in the daily morning into
Row stomach-filling 0.2mL drug, control group and APAP group use same dose physiological saline stomach-filling, continuous gavage 3 days, daily one
It is secondary, after third day stomach-filling 2h, control group stomach-filling physiological saline, APAP group and medicine group (APAP/RDA low dosage, APAP/RDA
Middle dosage, APAP/RDA high dose group) APAP stomach-filling (500mg/kg weight) is carried out, by 10% chloraldurate abdomen of mouse after 6h
Chamber injection is anaesthetized, and abdomen inferior caval vein takes hematometry ALT (glutamic-pyruvic transaminase), and AST (glutamic-oxalacetic transaminease) takes liver to detect
GSH, MDA and related gene expression.
4, experimental result:
Fig. 1 is influence of the Anemodeanin A of the present invention to glutamic-pyruvic transaminase in mice plasma (ALT).The result shows that ring
The raising of ALT caused by APAP can be significantly reduced in rhizoma cyperi element A.Glutamic-pyruvic transaminase is primarily present in liver cytoplasm, into the cell
Concentration is higher than in serum 1000-3000 times, as long as there is 1% liver cell to be destroyed, so that it may so that sero-enzyme increasing doubles.Cause
This, glutamic-pyruvic transaminase is the most sensitive Testing index of hepatic disorder by world health organisation recommendations.ALT is reduced this means that liver
Damage reduces.
Fig. 2 is influence of the Anemodeanin A of the present invention to glutamic-oxalacetic transaminease in mice plasma (AST).The result shows that ring
The raising of AST caused by APAP can be significantly reduced in rhizoma cyperi element A.AST content when normal in serum is lower, but corresponding cell by
When damage, permeability of cell membrane increases, and intracytoplasmic AST is released into blood, therefore its serum-concentration increases.
Fig. 3 is influence of the Anemodeanin A of the present invention to GSH in mouse liver.The result shows that compared with normal group, mould
Type group liver homogenate GSH content significantly reduces, and Anemodeanin A can significantly restore the content of GSH in liver, and GSH is by paddy ammonia
Tripeptide compound made of acid, cysteine and glycine set, mainly synthesizes in liver, plays in the metabolism of liver
Important role.GSH mainly makes cell from the damage of various harmful substances by its oxidation resistance in vivo, therefore,
Body will be caused to damage when GSH is swept off.And Anemodeanin A preferred dose is 300mg/kg.
Fig. 4 is influence of the Anemodeanin A of the present invention to MDA in mouse liver.The result shows that compared with normal group, mould
Type group liver homogenate MDA content significantly increases, and shows that body internal oxidition and antioxidant system are unbalance, and body is anti-oxidant and removes
The ability of free radical significantly reduces, and liver cell is severely damaged, and medicine group can effectively reduce the content of MDA, and
Anemodeanin A preferred dose is 300mg/kg.
Fig. 5 is that Anemodeanin A of the present invention influences the expression of TNF-a in mouse liver.The result shows that with normal group phase
Than, the expression of tumor necrosis factor (TNF-a) significantly increases in model group hepatic tissue, and Anemodeanin A treated mouse,
It can significantly reduce the expression of TNF-a.The adjustable immune response of the TNF-a of body normal level, it is anti-infective etc., but
The immunologic balance that body can be then destroyed when great expression, generates a variety of pathology damages together with other inflammatory factors.Ring
Rhizoma cyperi element A can significantly reduce the expression of the TNF-a as caused by APAP and increase, and Anemodeanin A preferred dose is 300mg/kg.
Fig. 6 is that Anemodeanin A of the present invention influences the expression of IL-1 β in mouse liver.The result shows that with normal group phase
Than the expression of interleukin-11 β (IL-1 β) significantly increases in model group hepatic tissue, and Anemodeanin A treated mouse, can show
Write the expression for reducing IL-1 β.The a variety of diseases such as il-1 β is a kind of proinflammatory cytokine, and wide participation tissue is destroyed
Damage process is managed, a variety of pathology damages are generated together with other inflammatory factors.Anemodeanin A can significantly reduce to be caused by APAP
IL-1 β express increase, and Anemodeanin A preferred dose be 300mg/kg.
Fig. 7 is that Anemodeanin A of the present invention influences the expression of IL-6 in mouse liver.The result shows that with normal group phase
Than the expression of interleukin 6 (IL-6) significantly increases in model group hepatic tissue, and Anemodeanin A treated mouse, can be significant
Reduce the expression of IL-6.IL-6 is a kind of cell factor generated by various kinds of cell such as macrophage, T cell, B cells,
With the occurrence and development of many diseases.IL-6 has extensive biology living as the key factor in Organism immunoregulation network
Property.IL-6 is increased with the damage of liver function in progressive.Blood serum IL-6 increases, weight liver inflammation reaction, into necrosis of liver cells.Bamboo
Section rhizoma cyperi element A can significantly reduce the expression of the IL-6 as caused by APAP and increase, and Anemodeanin A preferred dose is 300mg/kg.
5, advantage and effect:
The hepatotoxicity wind agitation caused by paracetamol can be effectively protected in Anemodeanin A, can prevent or treat to acetyl
A kind of drug of amino phenols.
Claims (2)
1. a kind of application of Anemodeanin A in preparation prevention or treatment liver injury medicament.
2. application as described in claim 1, it is characterised in that the liver injury medicament is hepatic injury caused by paracetamol
Drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811392492.8A CN109260213A (en) | 2018-11-21 | 2018-11-21 | Application of the Anemodeanin A in preparation prevention or treatment liver injury medicament |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811392492.8A CN109260213A (en) | 2018-11-21 | 2018-11-21 | Application of the Anemodeanin A in preparation prevention or treatment liver injury medicament |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109260213A true CN109260213A (en) | 2019-01-25 |
Family
ID=65189701
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811392492.8A Pending CN109260213A (en) | 2018-11-21 | 2018-11-21 | Application of the Anemodeanin A in preparation prevention or treatment liver injury medicament |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109260213A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115120583A (en) * | 2022-07-08 | 2022-09-30 | 浙江中医药大学 | Application of phenylpropanoid derivatives in preparation of drugs for preventing and treating liver failure |
-
2018
- 2018-11-21 CN CN201811392492.8A patent/CN109260213A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115120583A (en) * | 2022-07-08 | 2022-09-30 | 浙江中医药大学 | Application of phenylpropanoid derivatives in preparation of drugs for preventing and treating liver failure |
| CN115120583B (en) * | 2022-07-08 | 2023-06-27 | 浙江中医药大学 | Application of phenylpropanoid derivatives in preparation of drugs for preventing and treating liver failure |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Angelica sinensis polysaccharide attenuates CCl4-induced liver fibrosis via the IL-22/STAT3 pathway | |
| Lee et al. | Therapeutic effects of the oriental herbal medicine Sho‐saiko‐to on liver cirrhosis and carcinoma | |
| Liu et al. | Puerarin protects mouse liver against nickel-induced oxidative stress and inflammation associated with the TLR4/p38/CREB pathway | |
| Al-Rasheed et al. | Prophylactic role of α-lipoic acid and vitamin E against zinc oxide nanoparticles induced metabolic and immune disorders in rat’s liver | |
| Cao et al. | Sarcandra glabra extract reduces the susceptibility and severity of influenza in restraint-stressed mice | |
| Tian et al. | Laminaria japonica fucoidan ameliorates cyclophosphamide‐induced liver and kidney injury possibly by regulating Nrf2/HO‐1 and TLR4/NF‐κB signaling pathways | |
| Han et al. | Atractylenolide III improves mitochondrial function and protects against ulcerative colitis by activating AMPK/SIRT1/PGC-1α | |
| Zhou et al. | Hepatoprotective effect of juglone on dimethylnitrosamine‑induced liver fibrosis and its effect on hepatic antioxidant defence and the expression levels of α‑SMA and collagen III | |
| Alsop et al. | Cerebral MR spectroscopy and patient-reported mental health outcomes in hepatitis C genotype 1 naïve patients treated with ledipasvir and sofosbuvir: 48 | |
| Liu et al. | Naringenin as a natural immunomodulator against T cell-mediated autoimmune diseases: literature review and network-based pharmacology study | |
| CN114984019A (en) | Iron death inhibitor compound and application thereof in field of liver injury repair | |
| Li et al. | Cidan inhibits liver cancer cell growth by reducing COX‑2 and VEGF expression and cell cycle arrest Corrigendum in/etm/10/4/1609 | |
| CN109260213A (en) | Application of the Anemodeanin A in preparation prevention or treatment liver injury medicament | |
| CN109276566B (en) | Application of atractylenolide I in preparation of medicine for preventing or treating liver injury | |
| Hu et al. | Anti-inflammatory and antioxidant activity of astragalus polysaccharide in ulcerative colitis: A systematic review and meta-analysis of animal studies | |
| Dai et al. | Ginsenoside Rg3 inhibits grass carp reovirus replication in grass carp ovarian epithelial cells | |
| CN109288853A (en) | Application of the notoginsenoside R in preparation prevention or treatment liver injury medicament | |
| CN101549039B (en) | Application of schisandra fruit or related monomeric compound thereof for preventing or curing fatty liver | |
| CN105663147B (en) | Application of 4-hydroxy salicylanilide in preparation of antitumor drugs | |
| CN113940934A (en) | Application of sinomenine in medicine for treating autoimmune thyroid disease | |
| CN102836151A (en) | Application of Brevilin A when serving as JAK-STATs signal target inhibitor | |
| CN102342962A (en) | Application of extracts from Portulaca oleracea L. in preparation of anti-liver injury medicines and health foods | |
| Ashraf et al. | An open-label randomized clinical study to compare the effects of a nutritional supplement versus vitamin E on fibroscan score in nonalcoholic steatohepatitis (NASH) patients | |
| RU2679447C1 (en) | Application of l-lysine tiazototate as an active basis for medicines of hepatoprotective and detoxicative action | |
| CN103751305B (en) | A kind of medicine for the treatment of rheumatoid arthritis and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190125 |