CN109260477A - A kind of preparation method and applications of the aptamers-DNA dendroid self-assembly of high carrying capacity load medicine - Google Patents
A kind of preparation method and applications of the aptamers-DNA dendroid self-assembly of high carrying capacity load medicine Download PDFInfo
- Publication number
- CN109260477A CN109260477A CN201811186817.7A CN201811186817A CN109260477A CN 109260477 A CN109260477 A CN 109260477A CN 201811186817 A CN201811186817 A CN 201811186817A CN 109260477 A CN109260477 A CN 109260477A
- Authority
- CN
- China
- Prior art keywords
- dna
- dendroid
- self
- aptamers
- assembly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses the preparation method and applications that a kind of high carrying capacity carries the aptamers-DNA dendroid self-assembly of medicine, the DNA dendroid self-assembly which is connected by aptamers and the anticancer drug for being embedded in assembly are formed.Present invention utilizes the aptamers of high degree of specificity and the DNA dendroid self-assemblies being easily-synthesized, to realize that targets identification and high carrying capacity carry drug effect fruit.System as described herein carries drug stabilisation in physiological conditions, and energy targeted delivery anticancer drug reduces the leakage of drug, improve therapeutic effect to cancer cell.
Description
Technical field
The invention belongs to biological medicine targeting drug delivery system technical fields, and in particular to a kind of high carrying capacity carries the adaptation of medicine
The preparation method and applications of body-DNA dendroid self-assembly.
Background technique
Dendrimer, English name: dendrimer, is the molecule for having branch dendritic morphology, and typical dendrimer includes
Porphyrin dendrimer, PAMAM dendrimer, aryl oxide dendrimer, ferrocenyl dendrimer.These dendroids
Molecule has the characteristics that accurate molecular structure, the geometrically symmetric structure of height, a large amount of functional group, nano-scale.
Self-assembling technique, which refers to, spontaneously forms orderly geometry by the interaction between basic molecular cell, should
Process can effectively avoid error interference caused by human factor without any external force, simple and easy, reliable as one
Practical package technique, by the concern of researcher in numerous package techniques.Research finds the base that can be used for assembling
This unit multiplicity, various biomolecule such as polypeptide, liposome and DNA etc. can carry out orderly self assembly under certain condition,
Make it in biomedicine field, the research fields such as bio-sensing and molecular device have vast application prospect.Wherein DNA because
With stringent base pairing effect, the advantages that predictable space structure, synthesis is simple, and sequence design is flexible, in self assembly
Technical field in be most widely used.
The high polymer that DNA dendroid is assembled by DNA completely as one kind has degree of grafting high, and there are a large amount of stickiness on surface
End and the features such as being easy to functionalization.In terms of anti-tumor drug transport, DNA arborization carrier has with traditional arborization carrier
Many advantages: (1) nano material being made of DNA has strong biocompatibility and biological degradability, does not exempt from significantly
Epidemic focus and cytotoxicity；(2) DNA dendroid assembly be it is stringent assembled according to base pair complementarity principle, can be with
Reach expected structure by the sequence of design diversity；(3) DNA dendroid self-assembly is relatively stable in physiological conditions,
It can protect and be embedded in anticancer drug therein, effectively avoid drug in the leakage of blood circulation system, cause the wound to human body
Evil.In the microenvironment of tumour, DNA dendroid self-assembly can slowly degrade again, and drug discharges therewith；(4) DNA dendroid
There is a large amount of cohesive terminus,cohesive termini, different functional modifications can be designed, designs the functional group site having without targeting, thus
Realize drug in the accurate transport of different targets.
Aptamer (Aptamer) is section of DNA (DNA) or RNA(ribonucleic acid) sequence is benefit
With in-vitro screening technology --- Fas lignand system evolution technology (the Systematic evolution of ligands of index concentration
By exponential enrichment, SELEX), the oligonucleotide fragment obtained in the nucleic acid molecule libraries has easily sieve
It selects, be easily-synthesized, high-affinity and the features such as high-biocompatibility.Current widely used aptamers have sgc8, KK1B10,
AS1411 and TDO5.Aptamer can be with plurality of target substance high specific, be with high selectivity combined, therefore is widely used
In field of biosensors, as cell imaging, the treatment of disease, the detection of microorganism and new drug research and development.
Chemotherapy is still one of the main means of current treatment of cancer, and still, chemotherapeutics not only can be to the thin of lesion
Born of the same parents kill, its non-specificity also leads to the damage of normal cell, and tissue and organ to body bring greatly secondary make
With, such as destroy immune system, nervous system and digestive system.In addition, traditional anticancer drug bioavilability is low, greatly
These chemotherapeutics are limited to the therapeutic effect of cancer.Anthracycline antibiotic containing amino, such as adriamycin, daunorubicin,
Epi-ADM, especially adriamycin are relatively conventional anti-tumor chemotherapeutic medicines.Adriamycin is clinically widely used with wide
The drug for composing efficient anticancer activity has significant curative effect to leukaemia, breast cancer, lung cancer and malignant lymphoma etc..Adriamycin can
Stable compound is formed to be embedded in DNA double chain structure, inhibits the synthesis of nucleic acid, belongs to cell cycle nonspecific agent (CCNSA), it is right
The tumour cell of various growth cycles has killing effect.
Aptamers are passed through base pair complementarity as a kind of novel chemotherapeutics carrier by DNA dendroid self-assembly
It is connected in system, active targeting transport may be implemented, by target cell endocytosis, to realize the effect of targeted therapy.
Therefore, the present invention combines DNA dendroid self-assembly with aptamers, with adriamycin for typical anticarcinogen
Object, can be embedded in using adriamycin containing the feature in-GC- nucleic acid double chain, and adriamycin is embedded in DNA dendroid assembly
Nucleic acid double chain skeleton in, realize carrying of the assembly to adriamycin.Using aptamers to the targeting of tumour cell, realize
Adriamycin makes it play anti-tumor activity in the delivering intracellular of special cancer cell, avoids or reduces the toxicity work to normal cell
With.
Summary of the invention
The present invention is to solve the deficiency of conventional anti-cancer medicines delivery system, provides a kind of aptamers-of high carrying capacity load medicine
The preparation method and applications of DNA dendroid self-assembly.Aptamers-DNA dendroid self-assembly have biofacies content it is high,
Advantage nontoxic, drugloading rate is big precisely can significantly improve the anti-of anthracene ring antitumor medicinal to tumour cell by targeted delivery of drugs
Tumor effect.
To achieve the above object, the present invention adopts the following technical scheme:
A kind of preparation method of the aptamers-DNA dendroid self-assembly of high carrying capacity load medicine, comprising the following steps:
(1) by substrate chain A1 with will substrate chain A2 dissolution after mix in proportion, the 80-90 DEG C of annealing 5min in PCR instrument, and
Program cooling is carried out, after so that it is cooled to 25 DEG C with 0.1 DEG C/s, maintains 1h, obtains substrate chain A, 4 DEG C of placement is spare；
(2) it will be mixed in proportion after substrate chain B1 and substrate chain B2 dissolution, the 80-90 DEG C of annealing 10min in PCR instrument, and
Program cooling is carried out, after so that it is cooled to 25 DEG C with 0.1 DEG C/s, maintains 1h, obtains substrate chain B, 4 DEG C of placement is spare；
(3) it is separately added into secondary substrate chain A and secondary substrate chain B in substrate chain A and substrate chain B solution, 37 DEG C of incubations in PCR instrument
30min；
(4) step (3) is obtained two solution to be uniformly mixed, initiation chain is added and draws in 37 DEG C of incubation 30min after mixing well
Send out DNA dendroid self-assembling reaction；
(5) aptamers chain is added in the solution obtained to step (4), in 37 DEG C of incubation 60min after mixing well, obtains aptamers
The DNA dendroid self-assembly of connection；
(6) a certain amount of anticancer drug is weighed, the DNA dendroid of step (5) aptamers connection obtained is added to after dissolution
In self-assembly system, 24 h are protected from light to get the DNA dendroid self-assembly of medicine is carried to high carrying capacity for 25 DEG C in PCR instrument.
Step (1) the substrate chain A1 with by substrate chain A2,2:3-1:2 is mixed in molar ratio.
2:3-1:2 is mixed step (2) the substrate chain B1 in molar ratio with substrate chain B2.
Step (3) pair substrate chain A and secondary substrate chain B adding proportion are molar ratio 1:1-1:2, and pair substrate chain A and substrate
The molar ratio of chain A is 1:3-2:3.
Step (4) additive amount for causing chain is the 1/10 of substrate chain A molal weight.
Step (5) final concentration of 70nM ~ 100nM that aptamers chain is added.
The DNA dendroid self-assembly of step (6) aptamers connection and the molar ratio of anticancer drug are 1:278-1:833.
Step (6) anticancer drug is the anthracycline antibiotic containing amino.
The anthracycline antibiotic containing amino is adriamycin.
The preparation method that a kind of high carrying capacity is carried to the aptamers-DNA dendroid self-assembly of medicine as needed is applied to system
In standby anticancer drug.
The present invention has the advantages that
The present invention using nucleic acid itself as pharmaceutical carrier, will the aptamers such as specific recognition tumour cell be connected to synthesis group
It fills on body, forms mixture with anticancer drug in addition, using the targeting of aptamers, realize drug delivery to specific cancer
Cell inhibits the growth of cancer cell, reduces the toxic effect that cancer target carries medicine drug delivery system normal tissue, controls to improve
Therapeutic effect.
Detailed description of the invention
Fig. 1 is DNA dendroid self-assembly polyacrylamide gel electrophoresis and atomic force microscopy diagram, and wherein A is atom
Force microscope figure；B is DNA dendroid self-assembly polyacrylamide gel electrophoresis figure, wherein swimming lane a, substrate chain A；Swimming lane
B, substrate chain B；The product of swimming lane c, by-product chain A(substrate chain A1 and secondary substrate chain A)；The bottom swimming lane d, by-product chain B(
The product of object chain B1 and secondary substrate chain B)；Swimming lane e, DNA dendroid self-assembly.
Fig. 2 is that the drugloading rate of aptamers-DNA dendroid self-assembly investigates figure.
Fig. 3 is aptamers-DNA dendroid self-assembly target cancer cell streaming figure.
Fig. 4 is the aptamers-DNA dendroid self-assembly target cancer cell laser confocal microscope figure carried after medicine.
Fig. 5 is lethal effect figure of the aptamers-DNA dendroid self-assembly after carrying medicine to specific cancer cell.
Specific embodiment
Further instruction is subject to the present invention combined with specific embodiments below, but does not limit the contents of the present invention.
1 synthetic DNA dendroid self-assembly of embodiment
By substrate chain A1, substrate chain A2, substrate chain B1, substrate chain B2, secondary substrate chain A, secondary substrate chain B cause chain and aptamers
The synthesis of Lian Song company.
Substrate chain A1:
GTGTGCCTATTATGTCtcctcctGTGTGCCTATTATGTCtcctcctCAGCTTCATCAA
CTAGTTcgtca
Substrate chain A2:AACTAGTTGATGAAGCTGGACATAATAGGCACACGACATAATAGGCACAC
Substrate chain B1:aggagGAGACATAATAGGCACACtgacgaaCTAGTTGATGAAGCTG
Substrate chain B2:CAGCTTCATCAACTAGGTGTGCCTATTATGTCTC
Secondary substrate chain A:GTGCCTATTATGTCGTGTGCCTATTATGTCCAGCTT
Secondary substrate chain B:GCACACCTAGTTGATGAAGC
Cause chain: tgacgAACTAGTTGATGAAGCTG
Aptamers chain:
ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAaaaaaCAGCTTCAT
CAACTAGTTCGTCA
(1) by substrate chain A1 with by substrate chain A2 dissolution after in molar ratio 2:3 mix, 85 DEG C of annealing 5min in PCR instrument,
Line program of going forward side by side cooling after so that it is cooled to 25 DEG C with 0.1 DEG C/s, maintains 1h, obtains substrate chain A, and 4 DEG C of placement is spare；
(2) 2:3 is mixed in molar ratio after dissolving substrate chain B1 with substrate chain B2,85 DEG C of annealing 10min in PCR instrument,
Line program of going forward side by side cooling after so that it is cooled to 25 DEG C with 0.1 DEG C/s, maintains 1h, obtains substrate chain B, and 4 DEG C of placement is spare；
(3) secondary substrate chain A and pair substrate chain B, secondary substrate chain A and secondary substrate chain are separately added into substrate chain A and substrate chain B solution
The molar ratio of B is 1:2, and the molar ratio of pair substrate chain A and substrate chain A is 1:3-2:3,37 DEG C of incubation 30min in PCR instrument；
(4) step (3) is obtained two solution to be uniformly mixed, is added by the 1/10 of substrate chain A molal weight and causes chain, it is sufficiently mixed
In 37 DEG C of incubation 30min after even, cause DNA dendroid self-assembling reaction；
(5) aptamers chain is added in the solution obtained to step (4), so that its final concentration is reached 100nM, at 37 DEG C after mixing well
It is incubated for 60min, obtains the DNA dendroid self-assembly of aptamers connection, Fig. 1 is DNA dendroid self-assembly polyacrylamide
Gel electrophoresis (PAGE) and atomic force microscope (AFM) figure.As shown, AFM scan has obtained the DNA with dendritic structure
Dendroid self-assembly.Electrophoresis result shows the generation with self-assembling reaction, and corresponding change occurs for band, until occurring
(swimming lane e) illustrates expected self-assembling reaction to one assembling product band got lodged on hole.
The research of 2 DNA dendroid self-assembly drugloading rate of embodiment
It is dissolved after precisely weighing adriamycin, by the DNA dendroid self-assembly of the aptamers synthesized in embodiment 1 connection and Ah mould
The ratio of 1:278,1:312,1:357,1:500,1:833 mix plain solution in molar ratio respectively, are incubated for 24 h at 37 DEG C.It is incubated for
After, it is analyzed and characterized the fluorescence intensity of prepared load medicine mixture by sepectrophotofluorometer, as a result sees that Fig. 2, Fig. 2 are
Aptamers-DNA dendroid self-assembly drugloading rate investigates result figure.Compared with the fluorescence of Dox itself, with the adaptation of addition
The content of body-DNA dendroid self-assembly gradually increases, and corresponding Dox fluorescence gradually decreases, when aptamers-DNA dendroid from
Assembly: when the ratio of Dox is the molecular proportion of 1:312, fluorescence intensity is not with the aptamers-DNA dendroid self assembly of addition
The increase of body and reduce again, illustrate that ratio at this time is optimum ratio.
Embodiment 3
Using the human B lymphocyte oncocyte (Ramos) of PTK7 low expression as negative control, with the acute leaching of the highly expressed people of PTK7
Bar chronic myeloid leukemia T lymphocyte (CCRF-CEM) is used as positive test group, investigates aptamers-DNA dendroid self-assembly pair
Ability is absorbed in the targeting of cancer cell.
It takes two kinds of cells in centrifuge tube, the probe self-assembly obtained of embodiment 1 of comparable sodium is added, in 4 DEG C
It is incubated for 50min.It is centrifuged away unbonded probe immediately, after cleaning twice, cell is resuspended and carries out stream measuring, as a result sees Fig. 3.
Fig. 3 is aptamers-DNA dendroid self-assembly target cancer cell streaming figure, as seen from the figure, the DNA dendroid of aptamers connection
Self-assembly generates targets identification effect to CCRF-CEM cell, and shows aptamers-without recognition reaction to Ramos cell
The targeting of DNA dendroid self-assembly.
Embodiment 4
By the DNA dendroid self-assembly of the aptamers that are synthesized in embodiment 1 connection and Doxorubicin solution 1:312 in molar ratio
Ratio mixes, and is incubated for 24 h at 37 DEG C, obtains adriamycin-DNA dendroid self-assembly.
It is anxious with the highly expressed people of PTK7 using the human B lymphocyte oncocyte (Ramos) of PTK7 low expression as negative control
Property lymphocytic leukemia T lymphocyte (CCRF-CEM) be used as positive test group, investigate aptamers-DNA dendroid self assembly
Targeted delivery anticancer drug ability of the body to cancer cell.
It takes two kinds of cells in centrifuge tube, the adriamycin and adriamycin-DNA dendroid self-assembly of comparable sodium is added,
In 37 DEG C of incubation 1h.After reaction time, clean twice.It adds Hoechst33342 and dye core processing is carried out to cell, clearly
It washes and is placed under laser confocal microscope observation of taking pictures.Fig. 4 is the aptamers-DNA dendroid self-assembly targeting after carrying medicine
Cancer cell laser confocal microscope figure, from figure it is found that free Dox enters cell without selectivity, CCRF-CEM and Ramos
All there is the red fluorescence of Dox in the nucleus of cell, contrastingly, the red of aptamers-DNA dendroid self-assembly-Dox
Fluorescence only occurs in the nucleus of target cell CCRF-CEM, and the Dox fluorescence of control cell Ramos is extremely faint, illustrates
Aptamers-DNA dendroid self-assembly-Dox presents excellent targeted delivery anticancer drug ability.
Embodiment 5
By the DNA dendroid self-assembly of the aptamers that are synthesized in embodiment 1 connection and Doxorubicin solution 1:312 in molar ratio
Ratio mixes, and is incubated for 24 h at 37 DEG C, obtains adriamycin-DNA dendroid self-assembly.
It is anxious with the highly expressed people of PTK7 using the human B lymphocyte oncocyte (Ramos) of PTK7 low expression as negative control
Property lymphocytic leukemia T lymphocyte (CCRF-CEM) be used as positive test group, investigate carry medicine after aptamers-DNA branch
Targeting killing effect of the shape self-assembly to specific cancer cell.
Two kinds of cells are layered in 96 orifice plates, every hole 100uL, contain 10000 cells.A certain concentration is added in every hole respectively
Adriamycin and adriamycin-aptamers-DNA dendroid self-assembly.After cultivating 2h in the incubator, it is centrifuged off in supernatant
Old cell culture fluid, rejoin the new culture medium of 100uL, continue culture for 24 hours.Then two kinds of cells of CCK-8 reagent test are used
Survival rate.Fig. 5 is lethal effect figure of the aptamers-DNA dendroid self-assembly after carrying medicine to specific cancer cell.As a result table
Bright, individual Dox can cause the death of CCRF-CEM and Ramos cell, without selectivity.And compared to Ramos cell, it fits
Ligand-DNA dendroid self-assembly-Dox but selectively causes death in CCRF-CEM cell, shows that aptamers-DNA is high
The excellent targeted therapy potentiality of Molecularly Imprinted Polymer.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification, is all covered by the present invention.
SEQUENCE LISTING
<110>University of Fuzhou
<120>a kind of high carrying capacity carries the preparation method and applications of the aptamers-DNA dendroid self-assembly of medicine
<130> 8
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 69
<212> DNA
<213>artificial sequence
<400> 1
gtgtgcctat tatgtctcct cctgtgtgcc tattatgtct cctcctcagc ttcatcaact 60
agttcgtca 69
<210> 2
<211> 50
<212> DNA
<213>artificial sequence
<400> 2
aactagttga tgaagctgga cataataggc acacgacata ataggcacac 50
<210> 3
<211> 46
<212> DNA
<213>artificial sequence
<400> 3
aggaggagac ataataggca cactgacgaa ctagttgatg aagctg 46
<210> 4
<211> 34
<212> DNA
<213>artificial sequence
<400> 4
cagcttcatc aactaggtgt gcctattatg tctc 34
<210> 5
<211> 36
<212> DNA
<213>artificial sequence
<400> 5
gtgcctatta tgtcgtgtgc ctattatgtc cagctt 36
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
gcacacctag ttgatgaagc 20
<210> 7
<211> 23
<212> DNA
<213>artificial sequence
<400> 7
tgacgaacta gttgatgaag ctg 23
<210> 8
<211> 69
<212> DNA
<213>artificial sequence
<400> 8
atctaactgc tgcgccgccg ggaaaatact gtacggttag aaaaaacagc ttcatcaact 60
agttcgtca 69
Claims (10)
1. the preparation method that a kind of high carrying capacity carries the aptamers-DNA dendroid self-assembly of medicine, which is characterized in that including following
Step:
(1) by substrate chain A1 with will substrate chain A2 dissolution after mix in proportion, the 80-90 DEG C of annealing 5min in PCR instrument, and
Program cooling is carried out, after so that it is cooled to 25 DEG C with 0.1 DEG C/s, maintains 1h, obtains substrate chain A, 4 DEG C of placement is spare；
(2) it will be mixed in proportion after substrate chain B1 and substrate chain B2 dissolution, the 80-90 DEG C of annealing 10min in PCR instrument, and
Program cooling is carried out, after so that it is cooled to 25 DEG C with 0.1 DEG C/s, maintains 1h, obtains substrate chain B, 4 DEG C of placement is spare；
(3) it is separately added into secondary substrate chain A and secondary substrate chain B in substrate chain A and substrate chain B solution, 37 DEG C of incubations in PCR instrument
30min；
(4) step (3) is obtained two solution to be uniformly mixed, initiation chain is added and draws in 37 DEG C of incubation 30min after mixing well
Send out DNA dendroid self-assembling reaction；
(5) aptamers chain is added in the solution obtained to step (4), in 37 DEG C of incubation 60min after mixing well, obtains aptamers
The DNA dendroid self-assembly of connection；
(6) a certain amount of anticancer drug is weighed, the DNA dendroid of step (5) aptamers connection obtained is added to after dissolution
In self-assembly system, 24 h are protected from light to get the DNA dendroid self-assembly of medicine is carried to high carrying capacity for 25 DEG C in PCR instrument.
2. a kind of high carrying capacity according to claim 1 carries the preparation method of the aptamers-DNA dendroid self-assembly of medicine,
It is characterized in that, step (1) the substrate chain A1 with by substrate chain A2,2:3-1:2 is mixed in molar ratio.
3. a kind of high carrying capacity according to claim 1 carries the preparation method of the aptamers-DNA dendroid self-assembly of medicine,
It is characterized in that, step (2) the substrate chain B1 is with substrate chain B2,2:3-1:2 is mixed in molar ratio.
4. a kind of high carrying capacity according to claim 1 carries the preparation method of the aptamers-DNA dendroid self-assembly of medicine,
It is characterized in that, step (3) pair substrate chain A and secondary substrate chain B adding proportion are molar ratio 1:1-1:2, and pair substrate chain A and bottom
The molar ratio of object chain A is 1:3 ~ 2:3.
5. a kind of high carrying capacity according to claim 1 carries the preparation method of the aptamers-DNA dendroid self-assembly of medicine,
It is characterized in that, step (4) additive amount for causing chain is the 1/10 of substrate chain A molal weight.
6. a kind of high carrying capacity according to claim 1 carries the preparation method of the aptamers-DNA dendroid self-assembly of medicine,
It is characterized in that, step (5) final concentration of 70nM ~ 100nM that aptamers chain is added.
7. a kind of high carrying capacity according to claim 1 carries the preparation method of the aptamers-DNA dendroid self-assembly of medicine,
It is characterized in that, the DNA dendroid self-assembly of step (6) aptamers connection and the molar ratio of anticancer drug are 1:278-1:
833。
8. a kind of high carrying capacity according to claim 1 carries the preparation method of the aptamers-DNA dendroid self-assembly of medicine,
It is characterized in that, step (6) anticancer drug is the anthracycline antibiotic containing amino.
9. a kind of high carrying capacity according to claim 8 carries the preparation method of the aptamers-DNA dendroid self-assembly of medicine,
It is characterized in that the anthracycline antibiotic containing amino is adriamycin.
10. the preparation method for the aptamers-DNA dendroid self-assembly that a kind of high carrying capacity as described in claim 1 carries medicine exists
Prepare the application in anticancer drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811186817.7A CN109260477A (en) | 2018-10-12 | 2018-10-12 | A kind of preparation method and applications of the aptamers-DNA dendroid self-assembly of high carrying capacity load medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811186817.7A CN109260477A (en) | 2018-10-12 | 2018-10-12 | A kind of preparation method and applications of the aptamers-DNA dendroid self-assembly of high carrying capacity load medicine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109260477A true CN109260477A (en) | 2019-01-25 |
Family
ID=65196603
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811186817.7A Pending CN109260477A (en) | 2018-10-12 | 2018-10-12 | A kind of preparation method and applications of the aptamers-DNA dendroid self-assembly of high carrying capacity load medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109260477A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107050464A (en) * | 2016-11-09 | 2017-08-18 | 中国药科大学 | It is a kind of to be loaded with aptamers modifying DNA nanocages of adriamycin and preparation method thereof |
| CN108611348A (en) * | 2018-04-18 | 2018-10-02 | 上海交通大学医学院附属第九人民医院 | A kind of preparation method and its usage of dendroid DNA assemblies |
-
2018
- 2018-10-12 CN CN201811186817.7A patent/CN109260477A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107050464A (en) * | 2016-11-09 | 2017-08-18 | 中国药科大学 | It is a kind of to be loaded with aptamers modifying DNA nanocages of adriamycin and preparation method thereof |
| CN108611348A (en) * | 2018-04-18 | 2018-10-02 | 上海交通大学医学院附属第九人民医院 | A kind of preparation method and its usage of dendroid DNA assemblies |
Non-Patent Citations (3)
| Title |
|---|
| FENG XUAN，ET AL.: "Triggering hairpin-free chain-branching growth of fluorescent DNA dendrimers for nonlinear hybridization chain reaction", 《J. AM. CHEM. SOC.》 * |
| HUIMIN ZHANG, ET AL.: "A controlled aptamer-based self-assembled DNA dendrimer for high affinity targeting, bioimaging and drug delivery", 《SCIENTIFIC REPORTS》 * |
| SEYED MOHAMMAD TAGHDISI,ET AL.: "Double targeting and aptamer-assisted controlled release delivery of epirubicin to cancer cells by aptamers-based dendrimer in vitro and in vivo", 《EUROPEAN JOURNAL OF PHARMACEUTICS AND BIOPHARMACEUTICS》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mohammadinejad et al. | Shedding light on gene therapy: Carbon dots for the minimally invasive image-guided delivery of plasmids and noncoding RNAs-A review | |
| Kim et al. | Drug-loaded titanium dioxide nanoparticle coated with tumor targeting polymer as a sonodynamic chemotherapeutic agent for anti-cancer therapy | |
| Zhang et al. | Dual-modified liposome codelivery of doxorubicin and vincristine improve targeting and therapeutic efficacy of glioma | |
| CN109806252B (en) | Ternary composite nano system and preparation method and application thereof | |
| CN108478531A (en) | Folate-targeted restores sensitive medicament-carried polymer nano micelle and its preparation method and application | |
| Niu et al. | Glucose transporter and folic acid receptor-mediated Pluronic P105 polymeric micelles loaded with doxorubicin for brain tumor treating | |
| AU2017226517B2 (en) | Ovarian cancer specifically targeted biodegradable amphiphilic polymer, polymer vesicle prepared thereby and use thereof | |
| CN107184987B (en) | Lipoic acid modified targeted integrin alpha v beta 3 nano-polypeptide carrier and preparation method and application thereof | |
| CN102552105B (en) | Cascade brain-targeting drug delivery system as well as preparation method and application thereof | |
| CN103012562B (en) | Dual-targeting D-configuration polypeptides and drug delivery system thereof | |
| Cui et al. | Dual-target peptide-modified erythrocyte membrane-enveloped PLGA nanoparticles for the treatment of glioma | |
| CN106265510A (en) | Multistage target polymer micelle of pH trigger-type release and preparation method thereof in a kind of tumor cell | |
| CN101991862B (en) | Cyclodextrin-polyethyleneimine-mediated supramolecular delivery system and preparation method | |
| Wu et al. | Biocompatible AIEgen/p-glycoprotein siRNA@ reduction-sensitive paclitaxel polymeric prodrug nanoparticles for overcoming chemotherapy resistance in ovarian cancer | |
| Sawant et al. | Cancer research and therapy: Where are we today | |
| CN107998082A (en) | A kind of application for reducing responsive polymer vesica Nano medication in treatment of brain tumor medicine is prepared | |
| CN108126210A (en) | A kind of application of single targeting reduction response vesica Nano medication in treatment of brain tumor drug is prepared | |
| CN109224063A (en) | The nano combined carrier and its preparation and application of dual load peptides and chemotherapeutics | |
| Fang et al. | Targeted delivery of DOX by transferrin conjugated DSPE-PEG nanoparticles in leukemia therapy | |
| CN105778081A (en) | Amphiphilic targeting nanomaterial as well as nano preparation and application thereof | |
| CN109453114A (en) | A kind of copolymeric micelles drug-loading nanoparticles and its application | |
| CN101011579B (en) | Application of cytoplasm-targeting chitosan oligosaccharide-aliphatic acid grafting medicinal-vector colloidal cluster | |
| CN109260477A (en) | A kind of preparation method and applications of the aptamers-DNA dendroid self-assembly of high carrying capacity load medicine | |
| Chen et al. | Drug-free liposomes containing mannosylated ligand for liver-targeting: synthetic optimization, liposomal preparation, and bioactivity evaluation | |
| CN105770912A (en) | Drug-loading ATP sensitive liposome with tumor near infrared fluorescence development function and preparation method of drug-loading ATP sensitive liposome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190125 |