CN109232739A - A kind of 8 nano antibody of AntiCD3 McAb, encoding gene and application - Google Patents

Abstract

The present invention relates to a kind of 8 nano antibody of AntiCD3 McAb, encoding gene and applications.8 nano antibody of AntiCD3 McAb is following albumen a) or b): a) protein that the amino acid sequence shown in sequence 2 in sequence table forms；B) by substitution and/or one or several amino acid and the protein as derived from a) relevant to specific recognition CD38 is deleted and/or added in the amino acid sequence of sequence 2 in sequence table.8 nano antibody of AntiCD3 McAb can be with CD38 efficiently, specifically be combined, and affinity is up to 4nM, can in escherichia expression system low cost, large-scale production, it is with important application prospects in detection and pharmaceutical field.

Description

A kind of 8 nano antibody of AntiCD3 McAb, encoding gene and application

Technical field

The invention belongs to biomedical or biopharmaceutical technology, it is related to a kind of 8 nano antibody of AntiCD3 McAb, encoding gene And application.

Background technique

The 1980s, CD38 are found in T lymphocyte surface, are used as the marker of cell differentiation.2004 Year, find that CD38 is generally in high expression status in multiple myeloma cells, and normal lymphocytes, bone marrow cell with And low expression state is on some non-hematopoietic cells, this makes CD38 become a promising target for treating myeloma.Currently, having The monoclonal antibody of several AntiCD3 McAbs 8 just in clinical use or experimental stage, including daratumumab, SAR650984 and MOR202 etc..

1993, Hamers-Casterman et al. had found the heavy chain being only made of heavy chain in the blood of camelidae biology Antibody.And the variable region of heavy chain antibody, it is can have similar with heavy chain antibody anti-with the minimum antibody units of antigen binding Former binding ability, referred to as single domain antibody or nano antibody.Compared with conventional monoclonal antibody, single domain antibody has following advantage: (1) Molecular weight is small, and penetrability is good；(2) there are better dissolubility and stability；(3) easy mass production, can be in bacterium, yeast or plant It is expressed in object, so production cost is very low；(4) it is not easy to assemble；(5) immunogenicity is low, it is easier to transformation or humanization.

For single domain antibody, the production cost of monoclonal antibody is very high because it generally use mammalian cell into Row production；In addition, obtaining the high-affinity antibody relative difficulty with cytotoxic activity；And its effect performance also with body Immune state is related, often also as activity not enough needs the disadvantages of being combined with other drugs.And relative to single-chain antibody scFv For, nano antibody scFv corresponding in terms of affinity is suitable, but solubility, stability, to the resistance of aggregation, can ScFv is better than in terms of the easiness of being repetitively folded property, expression productivity and DNA operation, library construction and structure determination.

Summary of the invention

The present invention to solve the above-mentioned problems, one of technical solution provided are as follows: a kind of 8 nano antibody of AntiCD3 McAb is provided, is Following albumen a) or b):

A) protein that the amino acid sequence shown in sequence 2 in sequence table forms；

B) by substitution and/or one or several amino are deleted and/or added in the amino acid sequence of sequence 2 in sequence table Acid and the protein as derived from a) relevant to specific recognition CD38.

The present invention to solve the above-mentioned problems, the two of the technical solution provided are as follows: the volume of 8 nano antibody of AntiCD3 McAb is provided Code gene.

The encoding gene provided by the invention is following gene 1) or 2) or 3):

1) its nucleotide sequence is sequence 1 in sequence table；

2) hybridize and encode and specific recognition CD38 GAP-associated protein GAP with the DNA fragmentation that sequence 1 limits under strict conditions DNA molecular；

3) there is 90% or more homology with gene 1) or 2), and encode and specific recognition CD38 GAP-associated protein GAP DNA molecular.

The method that the present invention uses PCR amplification, obtains the CDS sequence of the encoding gene of 8 nano antibody of AntiCD3 McAb.Its CDNA sequence overall length is 375bp (sequence 1), and particular sequence is as follows:

CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTCGGTGCAGGCTGGAGGGTCTCTGAGACTCTCCTGTGCA GCCTCTGGATACACCGATAGTGATTACATCATGGCCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGCGAGGTGGTCGC AACTATTTATATTGGTGGTACGTACATCCACTATGCCGACTCCGTGAAGGGCCGATTCACCATCTCCCGAGACAATG CCGAGAACACGGTGTATCTGCAAATGAACAACCTGAAACCTGAAGACACTGCCATGTACTACTGTGCGGCCACGAAA TGGCGCCCCTTTATATCGACTCGGGCAGCTGAGTATAACTACTGGGGTCAGGGGACCCTGGTCACCGTCTCCTCA

Coding generates the albumen that length is 125 amino acid (end terminator is not included in, i.e., * * * is not included in sequence) Matter sequence (sequence 2), particular sequence is as follows:

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Asp Ser Asp Tyr Ile Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Val Val Ala Thr Ile Tyr Ile Gly Gly Thr Tyr Ile His Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Glu Asn Thr Val Tyr Leu Gln Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala Ala Thr Lys Trp Arg Pro Phe Ile Ser Thr Arg Ala Ala Glu Tyr Asn Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser***

This 8 nano antibody of AntiCD3 McAb is subjected to some modifications and transformation, for example, carry out humanization, PEGylated or other transformations with Improve its activity.

Mutation modification, such as substitution and/or deletion and/or addition one or several are carried out to the CDR region domain of this nano antibody A amino acid, to improve its affinity.

The present invention to solve the above-mentioned problems, the three of the technical solution provided are as follows: the recombination table containing the encoding gene Up to carrier.

The present invention to solve the above-mentioned problems, the four of the technical solution provided are as follows: be surrounded by the recombinant bacterium of the encoding gene Strain.

The present invention to solve the above-mentioned problems, the five of the technical solution provided are as follows: 8 nano antibody of AntiCD3 McAb, the volume The application of code gene, the recombinant expression carrier, the recombinant bacterial strain in detection and pharmaceutical field.

In above-mentioned application of the invention, including at least one of following:

1) it directly applies to and is specifically combined with sick cell, such as Huppert's disease and chronic lymphocytic leukemia Sick cell；

2) the joint efficiency molecule on 8 nano antibody of AntiCD3 McAb, such as Fc structural domain, cell factor, the poison of human antibody Property albumen, drug molecule, radioactive isotope or drug-loading nanoparticles etc., be used for pharmaceutical field；

3) fluorescent molecule or chemiluminescent groups are added on 8 nano antibody of AntiCD3 McAb, for detecting and tracking；

4) 8 nano antibody of AntiCD3 McAb is used to make colloidal gold kit or ELISA kit, is used for quantitative detection；

5) 8 nano antibody of AntiCD3 McAb is used for the preparation of his immunization therapy cell, such as CAR-T cell, CAR-DC Deng.

Implement the present invention, has the advantages that the CD38 nano antibody that we are screened has with other antibody not Same sequence can efficiently, specifically be combined with CD38, and affinity is up to 4nM, and can be in escherichia expression system Low cost, large-scale production.

Detailed description of the invention

In order to illustrate the technical solution of the embodiments of the present invention more clearly, making letter to attached drawing used in embodiment description Singly introduce.In attached drawing:

Fig. 1 first round PCR product qualification result；

Fig. 2 second takes turns PCR product qualification result；

Fig. 3 double enzyme digestion reaction product electrophoretic identification；

Fig. 4 affinity chromatography electrophoretic identification；

Fig. 5 ion-exchange chromatography electrophoretic identification；

The affinity of Fig. 6 biomembrane interference technique measurement nano antibody and CD38.

Specific embodiment

The embodiment of the present invention is specifically described below in conjunction with attached drawing.

Screening and acquisition difficulty due to monoclonal antibody is big, and monoclonal antibody need to be given birth to mammalian cell Production causes rear period cost excessively high.CD38 is immunized camel and obtains the library of its nano antibody by us, passes through phage display library Technology, screening obtain the nano antibody of this nM rank affinity.This antibody can be applied to the related diseases such as Huppert's disease Diagnosis and treatment, and can by enzyme-linked adsorption reaction etc. come it is qualitative or quantitatively dissociate CD38 albumen.

The building and screening of 1 AntiCD3 McAb of embodiment, 8 nano antibody phage display library

1.1 one-humped camels are immunized: choosing healthy adult one-humped camel one, will be pressed by the CD38 extracellular domain of Yeast expression 10 μ g/Kg and Freund's adjuvant are mixed in the ratio of 1:1, are immunized by by the way of dorsal sc multi-point injection, are immunized six times altogether, Immunization interval is 4 weeks.Freund's complete adjuvant is used except first time is immune, remaining is immunized is all made of incomplete Freund's adjuvant several times. One-humped camel neck peripheral blood 100mL is acquired after immune, for constructing phage display library.

The separation of 1.2 hunchbacked source lymphocytes: divide from the hunchbacked source anticoagulated whole blood of acquisition according to the art conventional program Analysis lymphocyte, every 3 × 10⁷1mL Trizol RNA separating liquid is added in a cell, and 2mL is taken to carry out RNA extraction, and remaining -80 DEG C It saves.

1.3 Total RNAs extractions: the extraction of total serum IgE is carried out by eZNA Total RNA Kit (OMEGA) kit specification.

1.4 reverse transcriptions synthesize cDNA:

According to Reverse Transcriptase kit TransScript Two-Step RT-PCR SuperMix (Transgene) specification Reverse transcription cDNA is carried out as template using the RNA that 1.3 steps obtain.

The amplification of 1.5 antibody variable genes: the cDNA that reverse transcription is obtained carries out PCR reaction as template.Amplification altogether into Row two-wheeled, the second wheel PCR use the product of the second wheel PCR as template.

The primer sequence of first round PCR is as follows:

Primer1:5 '-GTCCTGGCTGCTCTTCTACAAGG-3 '

Primer2:5 '-GGTACGTGCTGTTGAACTGTTCC-3 '

First round reaction condition and program are 94 DEG C of 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 30cycle；72℃ 10min

Fig. 1 is shown in the identification of first round PCR product, wherein 1-4: first round PCR product；M: molecular weight marker.

The primer sequence of second wheel PCR is as follows:

Primer1:5 '-GATGTGCAGCTGCAGGAGTCTGGRGGAGG-3 '

Primer2:5 '-CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT-3 '

Second wheel reaction condition and program are 94 DEG C of 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 45s, 30cycle；72℃ 10min

Fig. 2 is shown in second wheel PCR product identification, wherein the 1-2: the second wheel PCR product；M1-2: molecular weight marker.

1.6 vector construction

Phage vector pHEN2 is subjected to NcoI with second of PCR product respectively and EcoRI (Thermo Fisher) is double Digestion takes second of PCR product, the 2.5 μ g after digestion after 5 μ g of carrier and digestion, adds T4 DNA ligase (Thermo Fisher), connect overnight and recycle connection product for 16 DEG C.Fig. 3 is phage vector double enzyme digestion reaction product electrophoretic identification: 1- 2 be carrier double enzyme digestion product；M is molecular weight marker.

1.7 electrotransformations and storage capacity measurement

Connection product after purification is taken, the pre-cooling electricity revolving cup containing e. coli tg1 Electroporation-competent cells is added to Middle merging electroporation (MicroPulser Electroporator, Bio-Rad) carries out electrotransformation, takes out electric revolving cup, recovery is simultaneously Cultivate transformant.24 clones are selected at random, carry out sequencing identification, and calculate that storage capacity is 2 × 10 according to positive rate⁸(storage capacity =clone number × extension rate × [positive rate] sequencing result × 10).

Primer sequence is as follows:

MP57:5 '-TTATGCTTCCGGCTCGTATG-3 '

GIII:5 '-CCACAGACAGCCCTCATAG-3 '

1.8 Phage amplification

The bacterium solution of recovery is taken to be seeded in 2 × YT-AG culture medium, 37 DEG C of 220rpm cultures to culture OD600=0.5. It takes out bacterium solution and is added 5 × 10¹⁰M13KO7 helper phage, 37 DEG C of static infection 30min.4000rpm, room temperature are centrifuged 10min, go Net supernatant.Thallus, 30 DEG C of 250rpm overnight incubations are resuspended with 2 × YT-AK (containing ampicillin and kanamycins) culture medium.From The heart takes in supernatant 40ml pipe, and PEG8000/NaCl (20%/2.5M) solution is added and is sufficiently mixed, and supernatant is abandoned in centrifugation, and precipitating uses 1mL Ice PBS washing centrifugation, takes supernatant.

Measurement phage titre: TG1 is cultivated to OD600=0.4, with LB culture medium gradient dilution bacteriophage, takes multiple proportions Diluted bacteriophage TG1 culture mixed culture, next day observes Plaques assay situation in culture plate, to plaque number in 20- 200 dilution gradient plate count and calculates phage titre (pfu) according to the following formula.

Phage titre (pfu/ml)=extension rate × plaque number × 100

The screening of 1.9 nano antibodies

Pass through enzyme linked immunoassay ELISA method, using soluble CD38 as antigen, screening positive clone.It is dissolved in 100mM NaHCO₃, 5 μ g of CD38 antigen coating elisa plate (NUNC) of pH8.2,5%BSA closing, PBST (0.1%Tween- 20) it washs.100 μ l phage supernatants, 37 DEG C of placement 1h are added in every hole.Supernatant is abandoned, 150mM Glycine buffer is added PH1.5 dissociates CD38 specific antibody to come, or the antibody (GE Healthcare) of the anti-M13 of mouse of HRP label is added, 37 DEG C of placement 1h.Supernatant is abandoned, TMB solution is added, is incubated at room temperature 5min, 2M sulfuric acid terminate liquid is added in every hole, with microplate reader 450nm Reading.

Expression and purifying of 2 nano antibody of embodiment in Escherichia coli

The clone of the phage E LSIA result positive is selected, plasmid is extracted and is converted to bacterial strain BL21 DE3 competent cell, Nano antibody protein expression is induced with 100mM IPTG, collect thallus and is crushed, Ni-NTA (GE Healthcare) resin is used It is purified, is eluted and collected using various concentration imidazoles, the sample of collection is subjected to the analysis of reduced form protein electrophoresis, knot Referring to fig. 4, M is molecular weight marker to fruit；1-5 is respectively nano antibody bacterial cell disruption liquid, penetrates liquid, low concentration imidazoles elutes miscellaneous egg Bletilla elutes destination protein.

And recycle destination protein and dialyse into low salt solutions, ion-exchange chromatography is carried out, is as a result molecular weight referring to Fig. 5, M Label；1-9 is respectively nano antibody load solution, penetrates the salt ion elution albumen of liquid, various concentration.

In addition, the encoding gene of 8 nano antibody of AntiCD3 McAb is directly connected expression vector, conversion to expression bacterial strain can also be with Realize the expression of nano antibody.

3 nano antibody of embodiment and CD38 affinity determination

By biomembrane interference technique (Octet RED96, PALL Fortebio), nano antibody is coated in life by us On object sensor, and the affinity of itself and purpose antigen CD38 is measured, Fig. 6 and table 1 are measurement result.

In the present invention, immune, cell separation, the building of phage library, the screening of nano antibody by camel are screened altogether The nano antibody of 1 plant of AntiCD3 McAb 8 out.And antibody light chain and heavy chain gene are analyzed, to determine the framework region of variable region (framework regions, FR) and complementary determining region (complementarity determining regions, CDR), It is specific as follows:

FR1:Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly

FR2:Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Val Val Ala

FR3:Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Glu Asn Thr Val Tyr Leu Gln Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys

FR4:Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

CDR1:Tyr Thr Asp Ser Asp Tyr Ile

CDR2:Thr Ile Tyr Ile Gly Gly Thr Tyr Ile His

CDR3:Ala Ala Thr Lys Trp Arg Pro Phe Ile Ser Thr Arg Ala Ala Glu Tyr Asn Tyr

The embodiment of the present invention is described with above attached drawing, but the invention is not limited to above-mentioned specific Embodiment, the above mentioned embodiment is only schematical, rather than restrictive, those skilled in the art Under the inspiration of the present invention, without breaking away from the scope protected by the purposes and claims of the present invention, it can also make very much Form, all of these belong to the protection of the present invention.

Sequence table

<110>Shenzhen Graduate School of Peking University

<120>a kind of 8 nano antibody of AntiCD3 McAb, encoding gene and application

<130>

<160> 2

<210> 1

<211> 125

<212> PRT

<213>artificial sequence

<400> 1

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Asp Ser Asp Tyr

20 25 30

Ile Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Val Val

35 40 45

Ala Thr Ile Tyr Ile Gly Gly Thr Tyr Ile His Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Glu Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Ala Thr Lys Trp Arg Pro Phe Ile Ser Thr Arg Ala Ala Glu Tyr

100 105 110

Asn Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 2

<211> 375

<212> DNA

<213>artificial sequence

<400> 2

CAGGTGCAGC TGGTGGAGTC TGGGGGAGGC TCGGTGCAGG CTGGAGGGTC TCTGAGACTC 60

TCCTGTGCAG CCTCTGGATA CACCGATAGT GATTACATCA TGGCCTGGTT CCGCCAGGCT 120

CCAGGGAAGG AGCGCGAGGT GGTCGCAACT ATTTATATTG GTGGTACGTA CATCCACTAT 180

GCCGACTCCG TGAAGGGCCG ATTCACCATC TCCCGAGACA ATGCCGAGAA CACGGTGTAT 240

CTGCAAATGA ACAACCTGAA ACCTGAAGAC ACTGCCATGT ACTACTGTGC GGCCACGAAA 300

TGGCGCCCCT TTATATCGAC TCGGGCAGCT GAGTATAACT ACTGGGGTCA GGGGACCCTG 360

GTCACCGTCT CCTCA 375

Claims (7)

1. a kind of 8 nano antibody of AntiCD3 McAb, is following albumen a) or b):

A) protein that the amino acid sequence shown in sequence 2 in sequence table forms；

B) in sequence table sequence 2 amino acid sequence through substitution and/or be deleted and/or added one or several amino acid and The protein as derived from a) relevant to specific recognition CD38.

2. the encoding gene of 8 nano antibody of AntiCD3 McAb described in claim 1.

3. encoding gene according to claim 2, which is characterized in that the encoding gene is following base 1) or 2) or 3) Cause:

1) its nucleotide sequence is sequence 1 in sequence table；

2) hybridize and encode and the DNA of specific recognition CD38 GAP-associated protein GAP with the DNA fragmentation that sequence 1 limits under strict conditions Molecule；

3) there is 90% or more homology with gene 1) or 2), and encode the DNA with specific recognition CD38 GAP-associated protein GAP Molecule.

4. the recombinant expression carrier containing encoding gene described in Claims 2 or 3.

5. being surrounded by the recombinant bacterial strain of encoding gene described in Claims 2 or 3.

6. encoding gene described in 8 nano antibody of AntiCD3 McAb, Claims 2 or 3 described in claim 1 recombinates described in claim 4 Application of the recombinant bacterial strain described in expression vector, claim 5 in detection and pharmaceutical field.

7. application according to claim 6, which is characterized in that including at least one of following:

1) it directly applies to and is specifically combined with sick cell；

2) the joint efficiency molecule on 8 nano antibody of AntiCD3 McAb is used for pharmaceutical field；

3) fluorescent molecule or chemiluminescent groups are added on 8 nano antibody of AntiCD3 McAb, for detecting and tracking；

4) 8 nano antibody of AntiCD3 McAb is used to make colloidal gold kit or ELISA kit, is used for quantitative detection；

5) 8 nano antibody of AntiCD3 McAb is used for the preparation of immunization therapy cell.