CN109207630B - Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-1AS and using method - Google Patents
Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-1AS and using method Download PDFInfo
- Publication number
- CN109207630B CN109207630B CN201811338221.4A CN201811338221A CN109207630B CN 109207630 B CN109207630 B CN 109207630B CN 201811338221 A CN201811338221 A CN 201811338221A CN 109207630 B CN109207630 B CN 109207630B
- Authority
- CN
- China
- Prior art keywords
- wheat
- snp
- iwb75039
- genotype
- locus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker for detecting a gibberellic disease resistant QTL Qfhb. hbaas-1AS and a using method thereof. The invention provides an application of a substance for detecting the genotype of SNP IWB75039 locus of wheat chromosome 1AS in identification or auxiliary identification of wheat scab resistance; also provides the application of the substance for detecting the genotype of the SNP IWB75039 locus of wheat chromosome 1AS in the preparation of products for identifying or assisting in identifying wheat scab resistance. The invention discovers a gibberellic disease resistant locus Qfhb. hbaas-1AS positioned on the short arm of wheat 1A chromosome through genome-wide association analysis (GWAS), further converts the associated SNP IWB75039 into a common PCR marker M-1AS-Fhb, and the marker can be used for detecting the genotype of a gibberellic disease resistant QTL Qfhb. hbaas-1AS and for molecular breeding of gibberellic disease resistance.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a molecular marker for detecting gibberellic disease resistance QTL Qfhb.
Background
Wheat scab (FHB) caused by Fusarium graminearum and the like is a widely prevalent fungal disease that seriously affects wheat yield and quality. More importantly, the infected seeds contain mycotoxin, such as Deoxynivalenol (DON), which is harmful to human and animal health and affects eating and feeding.
The middle and lower reaches of Yangtze river and the northeast wheat area in China are regions where wheat scab is frequently and repeatedly transmitted. In recent years, the disease is influenced by global climate change, popularization of straw returning under a wheat-corn rotation system and the like, tends to expand and aggravate, and becomes a common disease in Huang-Huai-wheat areas. The annual average incidence area of wheat scab in China currently exceeds 533.3 kilohm2The total annual loss is up to 337 ten thousand t in 2010-2015, which is the first of wheat diseases.
The cultivation and utilization of disease-resistant varieties is an economic and effective means for reducing the harm of gibberellic disease. A great deal of research is carried out on gibberellic disease resistance inheritance at home and abroad, about 100 scab resistant QTLs are positioned and distributed on all chromosomes of wheat, 7 disease-resistant genes such as Fhb1-Fhb7 are formally named, wherein Fhb1 from Sumai No. 3 located on the short arm of the 3B chromosome has the strongest and stable resistance. However, there are few reports of other gene breeding applications other than Fhb 1. Therefore, the anti-gibberellic disease site is further excavated, and the development of the molecular marker is significant for anti-gibberellic disease breeding.
Disclosure of Invention
An object of the present invention is to use a substance for detecting the genotype of SNP IWB75039 site of wheat chromosome 1 AS.
The invention provides an application of a substance for detecting the genotype of SNP IWB75039 locus of wheat chromosome 1AS in identification or auxiliary identification of wheat scab resistance;
or the invention provides the application of the substance for detecting the genotype of the SNP IWB75039 locus of wheat chromosome 1AS in the preparation of products for identifying or assisting in identifying wheat scab resistance.
The invention also provides the application of the substance for detecting the genotype of the SNP IWB75039 locus of the wheat chromosome 1AS in wheat breeding for resisting the gibberellic disease;
or, the invention also provides the application of the substance for detecting the genotype of the SNP IWB75039 locus of wheat chromosome 1AS in the preparation of wheat breeding products for resisting gibberellic disease.
In the application, the SNP IWB75039 locus is a locus which is located on wheat chromosome 1AS and has a physical position of 10.1 Mb;
or the genotype of the SNP IWB75039 locus is GG or AA.
In the application, the substance for detecting the genotype of the SNP IWB75039 locus of wheat chromosome 1AS is 1) or 2):
1) the primer set comprises a single-stranded DNA molecule shown in a sequence 1 in a sequence table or a derivative thereof and a single-stranded DNA molecule shown in a sequence 2 in the sequence table or a derivative thereof;
2) a PCR reagent or a kit containing the primer set.
In the application, the derivative of the single-stranded DNA molecule shown in the sequence 1 in the sequence table is a DNA molecule which is obtained by substituting the sequence 1 by one or more nucleotides and has the same function as the sequence 1;
the derivative of the single-stranded DNA molecule shown in the sequence 2 in the sequence table is a DNA molecule which is obtained by substituting the sequence 2 by one or more nucleotides and has the same function as the sequence 2.
It is another object of the invention to provide a product.
The product provided by the invention is a substance for detecting the genotype of the SNP IWB75039 locus of wheat chromosome 1 AS;
the product has at least one of the following functions 1) or 2):
1) identifying or assisting in identifying wheat scab resistance;
2) and (5) breeding wheat with resistance to gibberellic disease.
The 3 rd purpose of the invention is to provide a method for identifying or assisting in identifying the wheat scab resistance.
The method provided by the invention is used for detecting whether the genotype of the SNP IWB75039 locus of the chromosome 1AS of the wheat to be detected is GG or AA, and judging the gibberellic disease resistance of the wheat to be detected according to the genotype;
the genotype of SNP IWB75039 locus is GG, the gibberellic disease resistance of the wheat to be detected is higher than that of SNP IWB75039 locus, and the genotype of SNP IWB75039 locus is AA.
The 4 th purpose of the invention is to provide a method for breeding wheat with gibberellic disease resistance.
The method provided by the invention is used for detecting whether the genotype of the SNP IWB75039 locus of wheat chromosome 1AS is GG or AA, and breeding the wheat to be detected with the genotype of GG to obtain the wheat with gibberellic disease resistance.
In the method, the method for detecting whether the genotype of the SNP IWB75039 locus of the wheat chromosome 1AS to be detected is GG or AA is A) or B) AS follows:
A) analyzing a 90K SNP chip;
B) performing PCR amplification on the wheat genome DNA to be detected by using the set of primers in claim 4, and detecting a PCR product;
if the PCR product is a segment with size of 389bp, the genotype of the wheat SNP locus IWB75039 to be detected is AA; and if no PCR product exists, the genotype of the wheat SNP locus IWB75039 to be detected is GG.
The PCR product is 389bp fragment detected by electrophoresis or direct sequencing.
Any of the above described wheat may be, but is not limited to, the 240 wheat varieties shown in table 1 of the examples section.
The invention discovers a scab resistant locus Qfhb. hbaas-1AS positioned on the short arm of wheat 1A chromosome through genome-wide association analysis (GWAS), explains phenotypic variation of 5.6 percent, and ensures that the value of FHB index BLUE is 33.0 percent lower than that of a material containing a disease-resistant allele under 4 environments. The invention further converts the related SNP IWB75039 into a common PCR marker M-1AS-Fhb, and the coincidence rate of the two markers to 240 materials is 96.7%. The marker can be used for detecting the genotype of a gibberellic disease resistant QTL Qfhb. hbaas-1AS and molecular breeding of gibberellic disease resistance.
Drawings
FIG. 1 shows a comparison of FHB. hbaas-1AS gene-type materials FHB indexBLUE.
FIG. 2 shows the result of M-1AS-Fhb on the amplification of a portion of the species.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
Fusarium culmorum pathogen huanggang No. 1: reference documents: zhu Yan, Yangrun, 20319han, et al, analysis of gibberellic disease resistance of wheat varieties (lines) in Hubei province [ J ] wheat crop academic newspaper, 2014,34(1): 137-142. public can be obtained from grain crop research institute of agricultural academy of Hubei province.
Example 1, discovery of Qfhb. hbaas-1AS and related SNP markers
Test materials: a WAPS (wheat Association Panel for Scab research) population established in 240 wheat varieties (lines) at home and abroad is shown in Table 1. The materials used are described in the literature: the identification and source tracing of the stripe rust resistance gene Fhb1 of Chinese wheat variety [ J ] the crop academic newspaper, 2018,44(4):473 and 482. the public can be obtained from the research institute of grain crops of academy of agricultural sciences of Hubei province.
TABLE 1 WAPS population variety (line) and its sources
aIs a typing result of the 90K SNP chip;bis the detection result of the marker M-1 AS-Fhb;cFHB index BLUE value (Best linear inhibited) under 4 circumstances, "-" is chip data missing.
Discovery of Qfhb. hbaas-1AS and related SNP markers thereof
1. Identification of resistance to gibberellic disease
And (3) carrying out gibberellic disease inoculation identification on the test field of the south lake of agricultural academy of sciences of Hubei province in 2014-2017 continuously for 4 years, wherein the pathogenic bacterial strain is Huanggang No. 1. The test adopts a completely random block design, 2 rows of blocks, 1m of row length, 0.25m of row spacing and 2 times of repetition. In 2014-2016, spray inoculation is adopted, and in 2017, inoculation is carried out by a wheat grain method for spreading diseases on the ground surface. And (3) investigating the number of diseased ears, the number of spikelets per ear and the number of diseased spikelets 20 days after inoculation by using a formula: the scab disease index (FHB index) is the disease incidence multiplied by the severity, and FHBendex is calculated, wherein the disease incidence is the ratio of the number of the diseased ears to the total number of ears, and the severity is the average value of the ratio of the number of the small ears to the number of the small ears of each ear disease, and the percentage is calculated. The 4-year FHB index BLUE value (Best linear approximated) is then calculated.
2. Genotyping analysis
The WAPS population is subjected to genotype analysis by using a 90K SNP chip, 22922 SNPs with good typing results are selected for subsequent analysis, markers with deletion rate of more than 20% and minimum allele frequency of less than 5% are removed, and the rest 19803 SNPs are used for GWAAS.
3. GWAS analysis
Association analysis is carried out by adopting a mixed linear model of a Tassel v5.0 software kinship (K) + PCA method. When P is less than or equal to 0.001, the marker is considered to be significantly associated with the trait.
4. Hbaas-1AS and its linked SNP marker
Association analysis found that the site was located on 1AS and resistant to head blight, was significant in both 2016 and 2017 environments, accounting for 5.6% phenotypic variation, and a representative association marker was IWB75039 flanked by the sequences: 5 '-GATTGACAAAGTCACCACATGCACACATGCACCTCAGTCAACAGGTACGT [ A/G ] ATCTACAGCTGGACAAATAGCCTACCCATGTCAAGCTCTGCCGGGTGGAC-3' (SEQ ID NO: 3, SNP site at position 51 of SEQ ID NO: 3). The physical position on the Chinese reference genomic sequence (IWGSC, http:// www.wheatgenome.org) was 10.1Mb (Table 2).
TABLE 2 Qfhb. hbaas-1AS and its linked SNP markers
| SNP markersa | Site of variationb | Chromosome | Physical locationc(Mb) | Environment(s) | P value | R2d(％) |
| IWB75039 | A/G | 1AS | 10.1 | 2016、2017 | 3.12E-04 | 5.6 |
aA representative SNP marker is a marker for a protein,bthe disease-resistant alleles are shown underlined,cchinese spring reference genome physical location (IWGSC, http:// www.wheatgenome.org),daccounting for phenotypic variation.
The physical position of the SNP locus IWB75039 at 1AS chromosome is 10.1Mb, the polymorphism is A/G, and the genotype of the SNP locus is AA or GG.
Through the detection of SNP locus genotype and gibberellic disease resistance identification, the FHB index BLUE value of the material with SNP locus genotype GG is 33.0 percent lower than that of the material with SNP locus genotype AA under 4 environments (figure 1). Indicates that the phenotype differed significantly at the 0.01 level between the two genotypic materials.
Design of M-1AS-Fhb labeling special primer and establishment of method thereof
1. Genome specific primer design
The flanking sequence of SNP IWB75039 is compared in EnsemblPlants database (http:// places. ensemblel. org) to obtain the homologous sequence, and 1A chromosome specific primer P5039 (sequence 1 and sequence 2) is designed, also named M-1AS-Fhb marker, and synthesized by Beijing Optimalaceae New Biotechnology Limited.
P5039F: 5'-GTTTTCAGGGCCTTATCAACTGAAG-3' (SEQ ID NO: 1);
P5039R: 5'-GGTTCGGTTGGTGCTTAATCACT-3' (SEQ ID NO: 2).
2. Detection method establishment
Test materials: WAPS population established by 240 parts of wheat variety (series) at home and abroad (Table 1).
And (3) PCR amplification: extracting genome DNA of wheat to be detected, adding ddH2O diluted to 30 ng/. mu.L as a template, and PCR amplification was performed using a primer pair consisting of primer P5039F and primer P5039R.
The PCR amplification system is shown in Table 3;
TABLE 3 PCR System for primer P5039
PCR procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 1min for 30s for 35 cycles; extending for 5min at 72 ℃; storing at 4 ℃.
Detecting the PCR product by using 1.5% agarose gel electrophoresis, wherein if the product is a 389bp fragment, the genotype of the SNPIWB75039 locus is AA; if no amplification product exists, the genotype at the SNPIWB75039 site is GG.
FIG. 2 shows 1-4 varieties whose IWB75039 genotype is AA, and 5-8 varieties whose IWB75039 genotype is GG; as can be seen, the size of the segment of the amplification product of AA materials with the genotype of 389bp and the amplification product of GG materials with the genotype of GG are shown to be different, which shows that the marker can distinguish IWB75039 genotypes and further distinguish alleles of gibberellic disease resistance QTL Qfhb. hbaas-1AS, and the marker is named AS M-1AS-Fhb (figure 2).
The consistency rate of the detection result of the marker WAPS population and the SNP IWB75039 typing result is 96.7%, which indicates that the marker is successfully transformed.
Therefore, the SNP IWB75039 marker can be used for auxiliary detection on whether the wheat to be detected is resistant to the gibberellic disease or not and for molecular breeding of resistance to the gibberellic disease; the specific method comprises the following steps:
detecting the genotype of an SNP locus IWB75039 in a wheat genome to be detected, and judging according to the following method:
the genotype of the SNP locus IWB75039 is GG of wheat to be detected, and the gibberellic disease resistance of the wheat to be detected is higher than or is higher than that of the candidate IWB75039 genotype of the wheat to be detected, and the wheat to be detected is AA.
The method for detecting the genotype of the SNP locus IWB75039 in the wheat genome to be detected comprises the following steps:
1) analyzing a 90K SNP chip;
2) performing PCR by using P5039F and P5039R, wherein if the product is a 389bp fragment, the genotype of the wheat SNP site IWB75039 to be detected is AA; if no PCR product exists, the genotype of the wheat SNP locus IWB75039 to be detected is GG;
3) PCR was performed with P5039F and P5039R to directly sequence the amplified product.
Example 2 actual sample detection
Test materials: WAPS population varieties shown in table 1.
Identification of resistance to gibberellic disease
The same as in example 1.
Second, M-1AS-Fhb marker detection
Using M-1AS-Fhb marker in the same manner AS in example 1, 240 varieties shown in Table 1 were PCR-amplified.
If the PCR product is a segment with size of 389bp, the genotype of the wheat SNP locus IWB75039 to be detected is AA; and if no PCR product exists, the genotype of the wheat SNP locus IWB75039 to be detected is GG.
The results of the marker detection of 240 wheat varieties and the average value of FHB index are shown in Table 1. The results of table 1 were subjected to statistical analysis to obtain the results of table 4.
TABLE 4 difference in resistance to gibberellic disease of different genotypes of M-1AS-Fhb
As can be seen from the above, the SNP locus IWB75039 is that the gibberellic disease resistance of the wheat to be detected with the GG genotype is higher than or is higher than that of the wheat to be detected with the AA genotype as a candidate.
Sequence listing
<110> institute of crop science of agricultural sciences, China institute of agricultural sciences, Hubei province
<120> molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-1AS and using method
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 25
<212> DNA
<213> Artificial sequence
<400> 1
gttttcaggg ccttatcaac tgaag 25
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence
<400> 2
ggttcggttg gtgcttaatc act 23
<210> 3
<211> 101
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (51)..(51)
<223> n is a or g
<400> 3
gattgacaaa gtcaccacat gcacacatgc acctcagtca acaggtacgt natctacagc 60
tggacaaata gcctacccat gtcaagctct gccgggtgga c 101
Claims (6)
1. SNP (single nucleotide polymorphism) for detecting wheat chromosome 1AS (specific allele polymorphism)IWB75039The application of the substance of the genotype of the locus in the auxiliary identification of the wheat scab resistance;
or detecting SNP of wheat chromosome 1ASIWB75039The application of the substance of the genotype of the locus in the preparation of a product for assisting in identifying the resistance to wheat scab;
the SNPIWB75039The site is 51 th site of the sequence 3; the SNPIWB75039The genotype of the locus is GG or AA.
2. SNP (single nucleotide polymorphism) for detecting wheat chromosome 1AS (specific allele polymorphism)IWB75039The application of the substance of the genotype of the locus in the wheat auxiliary breeding for resisting the gibberellic disease;
or, detecting SNP of wheat chromosome 1ASIWB75039The application of the substance of the genotype of the locus in the preparation of wheat auxiliary breeding products for resisting the gibberellic disease;
the SNPIWB75039The site is 51 th site of the sequence 3; the SNPIWB75039The genotype of the locus is GG or AA.
3. Use according to claim 1 or 2, characterized in that:
the SNP for detecting wheat chromosome 1ASIWB75039The genotype of the locus is as follows 1) or 2):
1) the primer set consists of a single-stranded DNA molecule shown in a sequence 1 in a sequence table and a single-stranded DNA molecule shown in a sequence 2 in the sequence table;
2) a PCR reagent or a kit containing the primer set.
4. A method for auxiliary identification of wheat scab resistance is to detect SNP of wheat chromosome 1AS to be detectedIWB75039The genotype of the locus is GG or AA, and the gibberellic disease resistance of the wheat to be detected is judged according to the genotype;
SNP IWB75039the gibberellic disease resistance of wheat to be detected with the locus genotype of GG is higher than that of SNPIWB75039Wheat to be detected with the genotype of the locus AA;
the SNPIWB75039The site is 51 th site of the sequence 3; the SNPIWB75039The genotype of the locus is GG or AA.
5. An auxiliary method for breeding wheat with gibberellic disease resistance for detecting SNP of wheat chromosome 1ASIWB75039The genotype of the locus is GG or AA, and the wheat to be detected with the genotype of GG is bred to obtain the wheat with gibberellic disease resistance;
the SNPIWB75039The site is 51 th site of the sequence 3; the SNPIWB75039The genotype of the locus is GG or AA.
6. The method of claim 5, wherein:
detecting wheat to be detectedSNP of chromosome 1ASIWB75039The method for determining whether the genotype of the locus is GG or AA is A) or B) as follows:
A) analyzing a 90K SNP chip;
B) performing PCR amplification on the wheat genome DNA to be detected by using the set of primers in claim 3, and detecting a PCR product;
if the PCR product is a segment with the size of 389bp, the wheat SNP locus to be detectedIWB75039The genotype of (A) is AA; if no PCR product exists, the wheat SNP locus to be detectedIWB75039The genotype of (a) is GG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811338221.4A CN109207630B (en) | 2018-11-12 | 2018-11-12 | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-1AS and using method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811338221.4A CN109207630B (en) | 2018-11-12 | 2018-11-12 | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-1AS and using method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109207630A CN109207630A (en) | 2019-01-15 |
| CN109207630B true CN109207630B (en) | 2021-12-24 |
Family
ID=64996101
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811338221.4A Active CN109207630B (en) | 2018-11-12 | 2018-11-12 | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-1AS and using method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207630B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110878300B (en) * | 2019-11-28 | 2022-09-13 | 中国农业大学 | DNA marker closely linked with wheat 7DL chromosome gibberellic disease resistant gene and application thereof |
| CN111607664B (en) * | 2020-07-13 | 2023-08-08 | 湖北省农业科学院粮食作物研究所 | Application of SNP molecular marker on 1DS chromosome related to wheat stripe rust |
| CN111748645B (en) * | 2020-08-07 | 2023-04-25 | 湖北省农业科学院粮食作物研究所 | Molecular marker for detecting scab resistance QTL QFhb.hbaas-5DL and application method thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107338310B (en) * | 2017-07-31 | 2020-12-25 | 中国农业科学院作物科学研究所 | Marker for detecting wheat scab-resistant gene PFT and using method thereof |
| CN108004345B (en) * | 2017-12-20 | 2021-03-02 | 中玉金标记（北京）生物技术股份有限公司 | Method for high-throughput detection of wheat scab resistance genotyping and kit thereof |
| CN108359739B (en) * | 2018-04-24 | 2021-03-30 | 南京农业大学 | SNP (Single nucleotide polymorphism) marker primer of gibberellic disease resistant related gene TaRLK-B and application of SNP marker primer |
-
2018
- 2018-11-12 CN CN201811338221.4A patent/CN109207630B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109207630A (en) | 2019-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109852719B (en) | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-5AL and using method | |
| Ren et al. | An integrated genetic and cytogenetic map of the cucumber genome | |
| CN108977440B (en) | Molecular marker for detecting stripe rust resistance QTL of Zhongmai 895 and using method | |
| CN109207630B (en) | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-1AS and using method | |
| CN107338310B (en) | Marker for detecting wheat scab-resistant gene PFT and using method thereof | |
| CN109913577B (en) | Molecular marker closely linked with wheat stripe rust resistance gene Yr1152 and application thereof | |
| CN109797241B (en) | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-5AS and using method | |
| CN112080582A (en) | KASP molecular marker closely linked with spike length major QTL locus and application thereof | |
| CN111575400A (en) | Wheat stripe rust resistant QTL molecular marker IWB12253 and application thereof | |
| CN113273489B (en) | Molecular marker-assisted breeding method for high-yield wheat with resistance to gibberellic disease | |
| CN111560464A (en) | Molecular marker IWB59718 and application thereof in detection of wheat stripe rust resistance | |
| CN109554494B (en) | Universal codominant molecular marker of rice brown planthopper resistant BPH9 multi-allele, and detection method and application thereof | |
| CN106434948B (en) | The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application | |
| CN109055594B (en) | Molecular marker for detecting gibberellic disease resistance QTL of Zhongmai 895 and using method | |
| Dontsova et al. | Analysis of polymorphism of microsatellite markers linked to a longterm net form of net blotch resistance gene in winter barley varieties in the south of Russia | |
| Yan et al. | Genetic divergence in domesticated and non-domesticated gene regions of barley chromosomes | |
| CN110592260B (en) | Competitive allele specific polymerase chain reaction marker of hard wheat adult plant leaf rust resistant locus and application thereof | |
| CN111778346A (en) | Molecular marker for detecting stripe rust resistant QTL QYr. hbaas-4BL.1 and using method thereof | |
| CN111635957A (en) | Molecular marker for detecting wheat stripe rust resistance QTL and application of molecular marker in disease-resistant breeding | |
| LIU et al. | Mapping of a wheat resistance gene to yellow mosaic disease by amplified fragment length polymorphism and simple sequence repeat markers | |
| Sanghvi et al. | Molecular markers in plant biotechnology | |
| Vijaykumar et al. | Molecular characterization of intergenic spacer region of 5S ribosomal RNA genes in subgenus Vigna: extensive hybridization among V. unguiculata subspecies | |
| Badr et al. | Genetic diversity in white clover and its progenitors as revealed by DNA fingerprinting | |
| CN115927736B (en) | SNP locus related to wheat spike number per spike and application thereof | |
| CN116640878B (en) | Molecular marker of wheat floret number QTL per spike developed based on novel mode of multi-single-combined-standard-evidence and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20190115 Assignee: Wuhan Xinbai Bioengineering Co.,Ltd. Assignor: HUBEI ACADEMY OF AGRICULTURAL SCIENCES INSTITUTE OF FOOD CROPS Contract record no.: X2022980004755 Denomination of invention: A QTL qfhb for detecting scab resistance Molecular marker of hbaas-1as and its application Granted publication date: 20211224 License type: Common License Record date: 20220425 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20190115 Assignee: Hubei huichuzhi Biotechnology Co.,Ltd. Assignor: HUBEI ACADEMY OF AGRICULTURAL SCIENCES INSTITUTE OF FOOD CROPS Contract record no.: X2022420000059 Denomination of invention: A molecular marker and application method for detecting Scab Resistant QTL qfhb.hbaas-1as Granted publication date: 20211224 License type: Common License Record date: 20220714 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20190115 Assignee: Jingzhou jiazhiyuan Biotechnology Co.,Ltd. Assignor: HUBEI ACADEMY OF AGRICULTURAL SCIENCES INSTITUTE OF FOOD CROPS Contract record no.: X2022420000061 Denomination of invention: A molecular marker and application method for detecting Scab Resistant QTL qfhb.hbaas-1as Granted publication date: 20211224 License type: Common License Record date: 20220714 Application publication date: 20190115 Assignee: Hubei Meitian Biotechnology Co.,Ltd. Assignor: HUBEI ACADEMY OF AGRICULTURAL SCIENCES INSTITUTE OF FOOD CROPS Contract record no.: X2022420000060 Denomination of invention: A molecular marker and application method for detecting Scab Resistant QTL qfhb.hbaas-1as Granted publication date: 20211224 License type: Common License Record date: 20220714 Application publication date: 20190115 Assignee: Jingzhou Changnong Agricultural Technology Co.,Ltd. Assignor: HUBEI ACADEMY OF AGRICULTURAL SCIENCES INSTITUTE OF FOOD CROPS Contract record no.: X2022420000062 Denomination of invention: A molecular marker and application method for detecting Scab Resistant QTL qfhb.hbaas-1as Granted publication date: 20211224 License type: Common License Record date: 20220714 Application publication date: 20190115 Assignee: Hubei Chuyu Seed Industry Co.,Ltd. Assignor: HUBEI ACADEMY OF AGRICULTURAL SCIENCES INSTITUTE OF FOOD CROPS Contract record no.: X2022420000063 Denomination of invention: A molecular marker and application method for detecting Scab Resistant QTL qfhb.hbaas-1as Granted publication date: 20211224 License type: Common License Record date: 20220714 |