CN109207509A - It is a kind of orientation, high effect culture salt tolerant rice kind breeding method - Google Patents
It is a kind of orientation, high effect culture salt tolerant rice kind breeding method Download PDFInfo
- Publication number
- CN109207509A CN109207509A CN201810997951.9A CN201810997951A CN109207509A CN 109207509 A CN109207509 A CN 109207509A CN 201810997951 A CN201810997951 A CN 201810997951A CN 109207509 A CN109207509 A CN 109207509A
- Authority
- CN
- China
- Prior art keywords
- rice
- salt tolerant
- salt
- strong
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to orientations, the breeding method of the strong salt tolerant of high effect culture, strong advantage rice varieties, it specifically discloses a kind of based on CRISPR/Cas9 gene editing technology, the breeding method that the strong salt tolerant of orientation, high effect culture, strong advantage rice varieties are especially combined with heterosis utilization technology, specifically according to riceOsRR22Exon sequence selects specific target sites sequence, edits simultaneously to hybrid rice parents, and the mutantion line that significantly improves of initiative salt tolerance is that excellent salt tolerant parent carries out hybridization combo test again, the hybrid paddy rice new varieties of the strong salt tolerant of final breeding, strong advantage.It thus overcomes that the conventional salt tolerant rice kind tolerance of salinity is low, the unconspicuous deficiency of advantage, provides a kind of method of the completely new more efficient strong salt tolerant of cultivation, strong advantage hybrid paddy rice new varieties.
Description
Technical field
The invention belongs to rice biological technology Breeding fields, and in particular to one kind is based on CRISPR/Cas9 gene editing skill
Art and heterosis utilization technology combine the breeding method of the strong salt tolerant of orientation, high effect culture, strong advantage new rice variety.
Background technique
Rice (Oryza sativa L.) is cereal crops important in the world, in the world more than the population of half with rice
Rice is main food.In China, rice is as the first big subsistence crop, and about 65% population is using rice as staple food.But current, people
Mouthful rapidly expansion, the problems such as cultivated area is reduced year by year, grain growth is increasingly slow gradually grain security in crisis China.And
On the other hand, nearly 1,500,000,000 mu of China salt-soda soil gross area cover national 17 provinces, and tilth salinization problem is increasingly tight
Weight, salt-soda soil 80% are in uncultivated state, and wherein rainwater resource is relatively abundant, can be used for the saline alkali land area of Rice Cropping in the recent period reaches
200000000 mu, Potential Comprehensive Utilization is huge.Therefore, salt tolerant rice new varieties are cultivated and are produced to Monitoring of Paddy Rice Plant Area and raising paddy is expanded
Amount ensures that China's grain security is particularly important.
Currently, salt tolerant rice rearing new variety is based on utilization traditional breeding way breeding saline-alkali tolerant conventional rice variety；It needs
By repeatedly hybridizing and the salt tolerance of acceptor material could be improved by systematic breeding, and there are period length, low efficiency, chain
The deficiencies of burden, salt tolerance difference and low output.The limitation of Gonna breakthrough tradition salt tolerant breeding " less varieties, low output ", must just open
Send out a kind of cultivate salt tolerant rice new approaches.
CRISPR/Cas9 technology as latest generation gene editing technology there is simple, efficient, separation offspring can reject and turn
The advantages such as gene element.In rice genetic improvement breeding, it is related to fertility etc. which has been successfully realized antagonism, quality
The fixed point editor of functional gene, such as Xu (Rice, 7 (1), 2014) utilize CRISPR/Cas9 technical antagonism herbicide resistance gene BEL
Rite-directed mutagenesis is carried out for target spot, successfully obtains the Mutant Rice material sensitive to herbicide-Bentazon；(the Plos such as Wang
One, 11 (4), 2016) editor is oriented to OsERF922, receptor rice material is improved to the resistance of rice blast；Zhou etc.
(Sci Rep, 6,2016) and using rice temp-sensing sterile gene TMS5 as target spot, successful incubation Rice Engineering temp-sensing sterile line.Together
When, at present in the Rice Salt gene cloned, OsRR22 is one of most important negative regulator gene of Salt Resistance of Rice；The base
Because being located at No. 1 chromosome of rice, coding one contains the corresponding regulatory protein of Type B of 696 amino acid, participates in basic element of cell division letter
Number transduction and metabolism；And the afunction of the gene can cause the significant offer of Salt Resistance of Rice.Zhang Anning etc.
(CN107828794A) the expection target for being located at the 1st area CDS OsRR22 by CRISPR/Cas9 technology orientation editor is proposed
The method that mutant is formulated in site, and filtered out the mutant that salt tolerance improves under 0.75% sodium chloride concentration stress
WDR58-cas-1, but this method only belongs to the Primary Study of mutant method for creating does not suggest that a kind of orientation, high effect culture
The specific method of strong salt tolerant, strong advantage new rice variety.
Summary of the invention
The technical problem to be solved by the present invention is to overcome the deficiencies of existing Rice Salt breeding technique, provide one kind and are based on
CRISPR/Cas9 gene editing technology is especially combined with heterosis utilization technology, targeting modification hybrid paddy rice backbone parent
Resistant gene of salt OsRR22 formulates salt tolerant excellent parent, and the strong salt tolerant of directive breeding, strong advantage and the hybridization for being free of transgene component
The breeding method of new rice variety.The present invention has the characteristics that high directivity, genetic background change is small, hybrid vigour is obvious, and
The possible risk of transgenosis can be evaded.
For this purpose, being based on the present invention provides a kind of orientation, the breeding method of high effect culture salt tolerant rice kind
CRISPR/Cas9 gene editing technology obtains the salt tolerant excellent parent that salt tolerance significantly improves, it is characterised in that: in parent material
After the beginning codon ATG of OsRR 22 in the 308th to the 721 i.e. sequence in the 3rd area CDS, sequence shown in SEQ ID NO.2 is selected
Column are used as specific target sites.
Preferably, the salt tolerant excellent parent plant that salt tolerance significantly improves is obtained method particularly includes:
(1) the gene editing recombinant vector containing the target site sequence segment is constructed；
(2) constructed gene editing recombinant vector is transferred in receptor parent Rice Callus and obtains transgenosis plant
Strain；
(3) above-mentioned transgenic plant is screened, transgenic positive plant is obtained；
(4) target site amplification, sequencing are carried out to above-mentioned transgenic positive plant, screening obtains the mutation that targeting mutates
Body.
Preferably, the gene editing recombinant vector is pCRISPR/Cas9 recombinant vector.
Method described further includes the following steps:
(5) screening acquisition stablizes mutating strain series without the homozygosis of transgene component after adding generation to plant above-mentioned mutant；
(6) salt stress processing screening is carried out to above-mentioned homozygous mutation strain and obtains the mutating strain series that salt tolerance significantly improves.
It preferably, further include carrying out backcrossing 2-3 using receptor parent as female parent to it for pure wherein in described (6) step
Change background, reselection is through backcrossing purifying, leaf morphology and maternal consistent stable mutating strain series as salt tolerant Parents.
Further, the method includes the following steps:
(7) hybridization combo is carried out to above-mentioned salt tolerant Parents, Tolerant salt is tested, breeding is without transgene component, strong
The combination of salt tolerant, strong advantage is as salt tolerant hybrid paddy rice new varieties.
Wherein, positive transgenic rice plant is obtained by the identification of hygromycin gene Molecular Detection in the step (3).
Preferably, the step (5) specifically: harvest T0 continues to plant T1 for segregating population for the seed of mutant plant,
The stabilization that sequencing analysis obtains target point gene type homozygosis and is free of transgene component is expanded by hygromycin Molecular Detection, target spot
Mutant plant, adding generation stablize mutating strain series at homozygosis.
Preferably, the step (6) specifically: harvest seed of the T1 generation without transgene component, homozygous mutation strain, after
Continued broadcasting kind seedling carries out salt tolerance after being put into the sodium-chloride water solution Stress treatment 7d that concentration is 0.8% when three one heart stages of leaf
Evaluation, screening obtain the salt tolerant Parents that salt tolerance significantly improves.
Preferably, the step (7) specifically: hybridization combo test is carried out to salt tolerant Parents, by cenospecies and right
Its growth potential is observed according to kind progress salt stress pot experiment, measures Na in the tissue of its aerial part+Content and K+/
Na+Content ratio, breeding without transgene component, strong salt tolerant, strong advantage hybrid paddy rice new varieties.
Compared with prior art, the invention has the following advantages:
1. it is miscellaneous based on CRISPR/Cas9 gene editing technology targeting mutation OsRR22 cultivation salt tolerant that the present invention provides one kind
The method for handing over rice excellent parent generally only needs 2-3 generation that can formulate salt tolerant excellent parent, is measured test and salt tolerant through parents
Characters Identification can the strong salt tolerant of breeding, strong advantage hybrid paddy rice new varieties.Breeding cycle is substantially reduced, breeding process is accelerated,
Save time and cost.Wherein the target site sequence that is directed to of the present invention is more effective, and the salt tolerant effect of acquisition is more preferable, be with
The sodium-chloride water solution Stress treatment 7d that concentration is 0.8% identifies salt tolerance effect.
2. the target site sequence that the present invention selects has many advantages, such as that undershooting-effect is low, the suitable Mutation induction of G/C content, and target
Site is located at the key function region of OsRR22.
3. the present invention can screen the salt tolerant parent material for obtaining and not containing transgene component, the method one in Mutant progeny
Aspect has evaded the possible security risk of transgenosis, on the other hand the party compared with the methods of physical mutagenesis, chemical mutagenesis
The high directivity of method, mutation efficiency are higher, and due to being targeting mutation, more have genomic DNA to damage small advantage.
4. the present invention carries out rite-directed mutagenesis to target gene using CRISPR/Cas9 gene editing technology, do not change receptor
The genetic background of parent material；And no matter conventional method is returned, how much is selfed for infiltration that all can be more or less and target gene
Other genes of close linkage cause the change of acceptor material genetic background even to bring certain bad characters into.
5. further, the present invention is also based on CRISPR/Cas9 gene editing technology and heterosis utilization technology is tight
Close combination, the method to cultivate strong salt tolerant, strong advantage hybrid paddy rice new varieties.It is resistance to that this method overcomes conventional salt tolerant rice kind
Salinity is low, the unconspicuous deficiency of advantage, provides the completely new strong salt tolerant of more effectively cultivation of one kind, strong advantage hybrid paddy rice new varieties
Method.
Detailed description of the invention
Fig. 1 be for 22T3-1-4,22T3-1-5,22T3-1-8,22T3-1-6 obtained in the embodiment of the present invention,
The T1 of 22T3-1-9 is for plant hygromycin Molecular Detection as a result, wherein 1-9,10-18,19-27,28-36,37-46 are respectively
For plant, N indicates that negative control, P indicate positive by 22T3-1-4,22T3-1-5,22T3-1-8,22T3-1-6,22T3-1-9T1
Control.
Fig. 2 is the salt-tolerant phenotype observation of salt tolerant Parents obtained in the embodiment of the present invention as a result, wherein 22T3-1-5-
T2,22T3-1-9-T2, CK are respectively salt tolerant restorer, salt tolerant sterile line, salt tolerant check variety salt round-grained rice 10.
Fig. 3 is strong salt tolerant obtained in the embodiment of the present invention, strong advantage hybrid paddy rice new varieties Salt Tolerance at Seedling Stage Phenotypic Observation knot
Fruit, wherein NY1, WT are respectively that Hybrid, the excellent China of check variety grand two account for.
Fig. 4 is strong salt tolerant obtained in the embodiment of the present invention, the observation of strong advantage hybrid paddy rice new varieties tillering stage salt-tolerant phenotype
As a result, wherein NY1, WT are respectively that Hybrid, the excellent China of check variety grand two account for.
Fig. 5 is Na in the tissue of strong salt tolerant, strong advantage hybrid paddy rice new varieties aerial part obtained in the embodiment of the present invention+
Content and K+/Na+Content ratio, wherein NY1, WT are respectively that cenospecies, the excellent China of check variety grand two account for；* it indicates in 0.05 level
Significant difference.
Specific embodiment:
Come that the present invention is furture elucidated below by the detailed description of specific embodiment, but is not to limit of the invention
System, only illustrates.
Embodiment
(1) extract that hybrid paddy rice backbone parent-China accounts for, simultaneously reverse transcription is at the first chain cDNA for the total serum IgE of grand section 638S, then with the
One chain cDNA is that template clone China accounts for, the 308th to 721 (i.e. after the OsRR22 gene translation initiation codon ATG of grand section 638S
3rd area CDS) sequence, be sequenced.Sequencing result shows that two parent this partial dna sequences are completely the same, is SEQ
Sequence shown in ID NO.1:
TGTTATCAGTAAATGGAGAGACAAAGACTGTGATGAAGGGGATAACTCATGGTGCCTGTGACTATCTTC
TAAAACCGGTCCGAATCGAAGAACTAAGGAACATATGGCAGCATGTTGTTAGGAGGAAGTTCGGTAATCGTGAGCGA
AACAATCTTGATTTCTCCAAAGAATGCAATAAGCCGCAAAGCGCGGATACTGATCATGGACCATACCAACCTACCTG
TGGTTCTTCTGATCAAAATGGGAGGTCCAGCAGGAAAAGGAAAGAACTACACGGCGAGGACGACGATGAAGGCGATG
ATAATGATTATCAAGAAAATGATGAGCCCTCAGCTGCAAAGAAGCCCAGAGTTGTATGGTCAGTTGAGCTGCACCGA
AAATTGTTGCCGCTGTCAACCAGCTTGGAATTGACA
(2) it according to one target site sequence of sequence design in step (1), is named as 22T3-1:
22T3-1 (SEQ ID NO.2):
Above-mentioned target site sequence contains 5 '-(N)X- NGG-3 ' structure adds frame portion to be divided into NGG structure.
(3) it constructs the pYLgRNA-U3 carrier of mono- target spot containing 22T3-1: being respectively synthesized the few chain with cohesive end first
Target spot primer 2 2T3-1F (SEQ ID NO.3), 22T3-1R (SEQ ID NO.4).By a pair of 90 DEG C of primer denaturation of few chain target spot
After be cooled to room temperature completion annealing, by annealing after segment attach on pYLgRNA-U3 carrier, and pass through two-wheeled PCR amplification
Obtain the U3-gDNA linear fragment containing 22T3-1 target spot.
22T3-1F (SEQ ID NO.3): GGCAGACAAAGACTGTGATGAAG
22T3-1R (SEQ ID NO.4): AAACCTTCATCACAGTCTTTGTC
(4) it constructs the pCRISPR/Cas9 expression vector of the expression cassette containing U3-22T3-1-gDNA: being obtained above-mentioned through PCR amplification
To the U3-gDNA linear fragment containing 22T3-1 target spot be connected to the albumen containing Cas9 pCRISPR/Cas9 expression vector on.
(5) transgenic plant obtains: being converted using the pCRISPR/Cas9 expression vector of the above-mentioned target spot containing 22T3-1 to agriculture
In bacillus competence EHA105, and accounted for, in grand section 638S callus by Agrobacterium tumefaciens-mediated Transformation to China, screened,
Break up, take root with after hardening, plants in greenhouse.It is identified by hygromycin gene (hpt) Molecular Detection and obtains positive transgenic water
Rice plants.
(6) transgenic homozygous mutant plant obtains: selecting above-mentioned positive transgenic rice plant DNA is template, uses primer
C22-F2 (SEQ ID NO.5), C22-R2 (SEQ ID NO.6) and high fidelity enzyme expand the DNA fragmentation containing target site, amplification
The purified Hou Song company sequencing of product, compared with sequencing result compares strain (WT) sequence with unconverted receptor parent, analysis mutation
Situation, referring specifically to SEQ ID NO.7-SEQ ID NO.12.
Reaction system: 2 10 μ L, KOD enzyme of μ L, 2Xbuffer of 1 μ L, C22-F2/C22-R2 of DNA profiling each 0.5 μ L, dNTP
0.5 μ L adds ddH2O to 20 μ L of total volume.
Response procedures: 95 DEG C of 3min, 30 circulations: 98 DEG C of 10s, 62 DEG C of 30s, 68 DEG C of 40s, 68 DEG C of 3min.C22-F2
(SEQ ID NO.5): GGATCAGCTGTTGTGTAAAAATGTC
C22-R2 (SEQ ID NO.6): CTTGCAACATTTTCCCTGGTGAG
WT (SEQ ID NO.7): AGACAAAGACTGTGATGAAG
22T3-1-4 (SEQ ID NO.8): AGACAAAGACTGTGA--AAG-2
22T3-1-5 (SEQ ID NO.9): AGACAAAGACTGTG-------6
22T3-1-8 (SEQ ID NO.10): AGACAAAGACTGTG--AAAG-2
22T3-1-6 (SEQ ID NO.11): AGACAAAGACTGTG----AG-4
22T3-1-9 (SEQ ID NO.12): AGACAAAGACTGTGAT-----4
Wherein, WT is that China accounts for, grand section 638S compares strain；22T3-1-4,5,8 are that China accounts for the T0 of background for transgenic homozygous
Mutant plant, 22T3-1-6,9 are the T0 of grand section 638S receptor background for transgenic homozygous mutant plant；Relative to WT sequence, sequence
"-" represents base deletion in column, digital representation base number thereafter, has the missing of base to illustrate targeting modification success.
Sequencing analysis the result shows that, accounted for using China, grand section 638S as the OsRR22 gene mutation efficiency of receptor background is respectively
85% (17/20), 60% (12/20), wherein homozygous mutation frequency is 17.65% (3/17), 16.67% (2/12).
(7) the OsRR22 homozygosis without transgene component is stablized mutating strain series and is obtained: the above-mentioned code area OsRR22 being selected to send out
Raw frameshift mutation terminates in advance, and the T0 of OsRR22 afunction is caused to carry out selfing adding generation for homozygous mutation plant, in
T1 is for transgenosis segregating population seedling stage Molecular Detection hygromycin gene (hpt).As a result referring to Fig. 1, screening contains without hpt
The mutant in OsRR22 homozygous mutation site.Mutant is selfed adding generation, becomes the T2 generation without transgene component
OsRR22 homozygosis stablizes mutating strain series.
(8) salt tolerant Parents obtain: the above-mentioned OsRR22 homozygosis without transgene component is stablized mutating strain series sowing
Seedling is seen after being placed in the continuous Stress treatment 7d of sodium-chloride water solution that concentration is 0.8% when three one heart stage of leaf of rice seedlings
It examines, as a result referring to fig. 2；Screening obtains mutating strain series 22T3-1-5-T2,22T3-1-9-T2 that salt tolerance significantly improves respectively, and
Accounted for respectively using China, grand section 638S as recurrent parent (make maternal) was returned for 2 generations to it, selection is through backcrossing purifying, leaf morphology and female
This consistent stable mutating strain series 22T3-1-5-T2-BC, 22T3-1-9-T2-BC are salt tolerant restorer, salt tolerant sterile line.
(9) strong salt tolerant, strong advantage hybrid paddy rice breeding of new variety and salt-tolerance character identification: with above-mentioned salt tolerant Parents
22T3-1-5-T2-BC, 22T3-1-9-T2-BC are that Parent carries out hybridization combo test and obtains cenospecies-NY1, by NY1 and right
According to kind grand two, excellent China accounts for normal germination, when three one heart stage of leaf of rice seedlings, is put into the sodium-chloride water solution that concentration is 0.8% and coerces
Compel continuous processing 10d, observe two groups of growth of seedling situations daily and cleaned seedling with clear water in 10d, then blots surface water
Point, every group takes 10 plants to survey its root long, plant height, seedling fresh weight respectively.As a result referring to Fig. 3, table 1.
Table 1.
* it indicates in 0.05 horizontal upper significant difference.
The results show that grand two excellent China account for Stress treatment 2d seedling start occur wilt, 10d seedling whole dehydration it is dead
It dies, and NY1 remains to Survival and growth in Stress treatment 10d seedling；The indexs such as root long, plant height, seedling fresh weight of NY1 relatively compare simultaneously
The excellent China of kind grand two accounts for compare and be significantly increased.Thus illustrate that growth potential of the Hybrid-NY1 under condition of salt stress is significantly strong
In check variety.
The excellent China of NY1 and check variety grand two is accounted for into normal sowing seedling again, 25d is latter to carry out potting examination with transplanting to basin alms bowl
It tests, 2 plants of every potting, 3 repetitions.The sodium-chloride water solution progress salt stress processing of rice shoot unified perfusion 0.6% after turning green, to not
The growth potential that same time NY1 and grand two excellent China account for is observed, measures Na in the tissue of its aerial part+Content and K+/Na+Contain
Measure ratio, tillering stage result referring to fig. 4, Fig. 5.
The results show that the growth potential of Hybrid-NY1 is remarkably reinforced compared with the excellent China of check variety grand two accounts for, and its ground
Na in the tissue of upper part+Content significant decrease, K+/Na+Content ratio significantly improves.
To sum up, Hybrid-NY1 is the strong salt tolerant of breeding acquisition, strong advantage hybrid paddy rice new varieties.
Sequence table
<110>Agricultural University Of Hunan；Hunan Research Centre for Hybrid Rice
<120>a kind of orientation, the breeding method of high effect culture salt tolerant rice kind
<160>12
<210>1
<211>413
<212>DNA
<213>rice
<400> 1
TGTTATCAGTAAATGGAGAGACAAAGACTGTGATGAAGGGGATAACTCATGGTGCCTGTGACTATCTTCTAA
AACCGGTCCGAATCGAAGAACTAAGGAACATATGGCAGCATGTTGTTAGGAGGAAGTTCGGTAATCGTGAGCGAAA
CAATCTTGATTTCTCCAAAGAATGCAATAAGCCGCAAAGCGCGGATACTGATCATGGACCATACCAACCTACCTGT
GGTTCTTCTGATCAAAATGGGAGGTCCAGCAGGAAAAGGAAAGAACTACACGGCGAGGACGACGATGAAGGCGATG
ATAATGATTATCAAGAAAATGATGAGCCCTCAGCTGCAAAGAAGCCCAGAGTTGTATGGTCAGTTGAGCTGCACCG
AAAATTGTTGCCGCTGTCAACCAGCTTGGAATTGACA 413
<210>2
<211>23
<212>DNA
<213>artificial sequence
<400>2
AGACAAAGACTGTGATGAAGGGG 23
<210>3
<211>23
<212>DNA
<213>artificial sequence
<400>3
GGCAGACAAAGACTGTGATGAAG 23
<210>4
<211>23
<212>DNA
<213>artificial sequence
<400>4
AAACCTTCATCACAGTCTTTGTC 23
<210>5
<211>25
<212>DNA
<213>artificial sequence
<400>5
GGATCAGCTGTTGTGTAAAAATGTC 25
<210>6
<211>23
<212>DNA
<213>artificial sequence
<400>6
CTTGCAACATTTTCCCTGGTGAG 23
<210>7
<211>20
<212>DNA
<213>artificial sequence
<400>7
AGACAAAGACTGTGATGAAG 20
<210>8
<211>18
<212>DNA
<213>artificial sequence
<400>8
AGACAAAGACTGTGA- -AAG 18
<210>9
<211>14
<212>DNA
<213>artificial sequence
<400>9
AGACAAAGACTGTG- - - - - - 14
<210>10
<211>18
<212>DNA
<213>artificial
<400>10
AGACAAAGACTGTG- -AAAG 18
<210>11
<211>16
<212>DNA
<213>artificial
<400>11
AGACAAAGACTGTG- - - -AG 16
<210>12
<211>16
<212>DNA
<213>artificial
<400>12
AGACAAAGACTGTGAT- - - - 16
Claims (10)
1. a kind of orientation, the breeding method of high effect culture salt tolerant rice kind, are obtained based on CRISPR/Cas9 gene editing technology
Obtain the prominent body body plant of salt tolerance, it is characterised in that: in receptor rice materialOsRR22Beginning codon ATG after the 308th to 721
The 3rd area CDS sequence in, select sequence shown in SEQ ID NO.2 as specific target sites.
2. breeding method as described in claim 1, it is characterised in that: obtain prominent body body plant method particularly includes:
(1) the gene editing recombinant vector containing the target site sequence segment is constructed；
(2) constructed gene editing recombinant vector is transferred in receptor parent Rice Callus and obtains transgenic plant；
(3) above-mentioned transgenic plant is screened, transgenic positive plant is obtained；
(4) target site amplification, sequencing are carried out to above-mentioned transgenic positive plant, screening obtains the mutant that targeting mutates.
3. breeding method as described in claim 1, it is characterised in that: the gene editing recombinant vector is pCRISPR/Cas9
Recombinant vector.
4. breeding method as claimed in claim 2, it is characterised in that: further comprise following step:
(5) screening acquisition stablizes mutating strain series without the homozygosis of transgene component after adding generation to plant above-mentioned mutant；
(6) salt stress processing screening is carried out to above-mentioned homozygous mutation strain and obtains the mutating strain series that salt tolerance significantly improves, preferably
It further include carrying out backcrossing 2-3 generation purifying background using receptor parent as female parent to it, reselection passes through back in ground described (6) step
Hand over purifying, leaf morphology and maternal consistent stable mutating strain series as salt tolerant Parents.
5. breeding method as claimed in claim 4, it is characterised in that: further comprise following step:
(7) to above-mentioned salt tolerant Parents carry out hybridization combo, Tolerant salt test, breeding without transgene component, strong salt tolerant,
The combination of strong advantage is as salt tolerant hybrid paddy rice new varieties；
Preferably, the step (7) specifically: hybridization combo test is carried out to salt tolerant Parents, by cenospecies and reference substance
Kind carries out salt stress pot experiment and is observed its growth potential, measures Na in the tissue of its aerial part+Content and K+/Na+Contain
Measure ratio, breeding without transgene component, strong salt tolerant, strong advantage hybrid paddy rice new varieties.
6. breeding method as claimed in claim 4, it is characterised in that: pass through hygromycin base in the step (1) and step (2)
It is identified because of Molecular Detection and obtains positive transgenic rice plant.
7. breeding method as claimed in claim 6, it is characterised in that: the step (5) specifically: T0 is for mutant plant for harvest
Seed, continue to plant T1 for segregating population, pass through hygromycin Molecular Detection, target spot expands sequencing analysis and obtains target point gene
Type is homozygous and is free of the stabilization mutant plant of transgene component, and adding generation stablizes mutating strain series at homozygosis.
8. breeding method as claimed in claim 4, it is characterised in that: the step (6) specifically: harvest T1 generation, which is free of, turns base
Because of ingredient, the seed of homozygous mutation strain, continue to sow seedling, when three one heart stages of leaf, is put into the sodium chloride that concentration is 0.8%
Evaluation of Salt Tolerance is carried out after aqueous solution Stress treatment 7d, screening obtains the salt tolerant Parents that salt tolerance significantly improves.
9. a kind of orientation, the breeding method of high effect culture salt tolerant rice kind, it is characterised in that: be based on CRISPR/Cas9 gene
Editing technique is to receptor rice materialOsRR22Gene carries out gene editing, obtains salt tolerant mutantion line, is mutated again with salt tolerant thereafter
System is that parent passes through the strong salt tolerant of hybridization combo mode breeding, strong advantage new hybrid rice varieties.
10. breeding method as claimed in claim 9, it is characterised in that: be wherein select sequence shown in SEQ ID NO.2 as
Specific target sites.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810997951.9A CN109207509B (en) | 2018-08-29 | 2018-08-29 | Breeding method for directionally and efficiently cultivating salt-tolerant rice variety |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810997951.9A CN109207509B (en) | 2018-08-29 | 2018-08-29 | Breeding method for directionally and efficiently cultivating salt-tolerant rice variety |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109207509A true CN109207509A (en) | 2019-01-15 |
| CN109207509B CN109207509B (en) | 2023-04-14 |
Family
ID=64985309
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810997951.9A Active CN109207509B (en) | 2018-08-29 | 2018-08-29 | Breeding method for directionally and efficiently cultivating salt-tolerant rice variety |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207509B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110885837A (en) * | 2019-12-03 | 2020-03-17 | 湖南杂交水稻研究中心 | Rice OsRR22-1Mutant gene and identification method thereof, KASP typing primer for identification and application |
| WO2021109344A1 (en) * | 2019-12-03 | 2021-06-10 | 湖南杂交水稻研究中心 | Method for identifying physicochemically mutagenic plant m1 generation mutation and obtaining mutant, typing primer for identifying rice mutation, mutant gene, and application |
| CN116326477A (en) * | 2022-12-30 | 2023-06-27 | 许可 | Method for breeding salt-tolerant hybrid japonica rice |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104651392A (en) * | 2015-01-06 | 2015-05-27 | 华南农业大学 | Method for obtaining temperature-sensitive sterile line by performing site-specific mutagenesis on P/TMS12-1 through CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system |
| CN106544357A (en) * | 2016-08-25 | 2017-03-29 | 湖南杂交水稻研究中心 | A kind of method for cultivating low cadmium-accumulation rice variety |
| WO2018018979A1 (en) * | 2016-07-26 | 2018-02-01 | 浙江大学 | Recombinant plant vector and method for screening non-transgenic gene-edited strain |
| CN107828794A (en) * | 2017-09-30 | 2018-03-23 | 上海市农业生物基因中心 | A kind of method for creating of Rice Salt gene OsRR22 mutant, its amino acid sequence encoded, plant and the mutant |
-
2018
- 2018-08-29 CN CN201810997951.9A patent/CN109207509B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104651392A (en) * | 2015-01-06 | 2015-05-27 | 华南农业大学 | Method for obtaining temperature-sensitive sterile line by performing site-specific mutagenesis on P/TMS12-1 through CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system |
| WO2018018979A1 (en) * | 2016-07-26 | 2018-02-01 | 浙江大学 | Recombinant plant vector and method for screening non-transgenic gene-edited strain |
| CN106544357A (en) * | 2016-08-25 | 2017-03-29 | 湖南杂交水稻研究中心 | A kind of method for cultivating low cadmium-accumulation rice variety |
| CN107828794A (en) * | 2017-09-30 | 2018-03-23 | 上海市农业生物基因中心 | A kind of method for creating of Rice Salt gene OsRR22 mutant, its amino acid sequence encoded, plant and the mutant |
Non-Patent Citations (3)
| Title |
|---|
| WANG H等: "WB1, a Regulator of Endosperm Development in Rice, Is Identified by a Modified MutMap Method.", 《INT J MOL SCI》, 24 July 2018 (2018-07-24), pages 2159 * |
| 汪鸿儒;储成才;: "组学技术揭示水稻杂种优势遗传机制", no. 01, pages 4 - 9 * |
| 陈友倩等: "水稻转基因及其安全性研究进展", 《现代农业科技》, no. 15, 2 August 2018 (2018-08-02), pages 25 - 27 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110885837A (en) * | 2019-12-03 | 2020-03-17 | 湖南杂交水稻研究中心 | Rice OsRR22-1Mutant gene and identification method thereof, KASP typing primer for identification and application |
| WO2021109344A1 (en) * | 2019-12-03 | 2021-06-10 | 湖南杂交水稻研究中心 | Method for identifying physicochemically mutagenic plant m1 generation mutation and obtaining mutant, typing primer for identifying rice mutation, mutant gene, and application |
| CN116326477A (en) * | 2022-12-30 | 2023-06-27 | 许可 | Method for breeding salt-tolerant hybrid japonica rice |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109207509B (en) | 2023-04-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mujeeb-Kazi et al. | Breeding strategies for structuring salinity tolerance in wheat | |
| CN109097346A (en) | Application based on the ALS mutein and its gene of gene editing technology in plant breeding | |
| CN106191107A (en) | A kind of molecular improvement method reducing rice grain seed holding | |
| CN108239647A (en) | A kind of gene, molecular labeling and application for controlling rape plant type | |
| CN104969855B (en) | Method for cultivating rice breeding material with broad spectrum and lasting spike blast resistance | |
| CN102918154B (en) | Control gene Dro1 and the application thereof of plant deep root feature | |
| CN107245480A (en) | Acetolactate synthase mutain and its application with Herbicid resistant | |
| Kantar et al. | Evaluating an interspecific Helianthus annuus× Helianthus tuberosus population for use in a perennial sunflower breeding program | |
| CN109207509A (en) | It is a kind of orientation, high effect culture salt tolerant rice kind breeding method | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| WO2021109344A1 (en) | Method for identifying physicochemically mutagenic plant m1 generation mutation and obtaining mutant, typing primer for identifying rice mutation, mutant gene, and application | |
| CN110463599B (en) | Breeding method of direct-seeding rice | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| Janick | Predictions for loquat improvement in the next decade | |
| CN102964437A (en) | Soybean nuclear factor protein and encoding genes of protein and applications of protein and encoding genes | |
| CN100425125C (en) | Laver quick breeding method | |
| CN108486273B (en) | Excavation and application of SSR (simple sequence repeat) markers on chromosome 5 and closely linked with salt-tolerant QTL (quantitative trait locus) of rice | |
| CN109750061A (en) | One kind overcoming the self-incompatible method of Diploid Potato | |
| CN101773067B (en) | Method for recurrently and selectively breeding non-glutinous rice by using recessive cytoblast sterile material | |
| CN110938122B (en) | Male sterile gene OsNIN5, application thereof and fertility restoration method | |
| CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
| CN114128619B (en) | Method for rapid breeding of salt-tolerant rice in whole growth period | |
| Hladni et al. | Sunflower and abiotic stress: genetics and breeding for resistance in the—omics era sunflower abiotic stress breeding | |
| CN108617495A (en) | A kind of molecular breeding method for improveing Rice Heading blooming stage heat resistance using single slice substitution line | |
| CN108703063A (en) | It is a kind of using the polymerization improved Rice Heading blooming stage of single slice substitution line and the molecular breeding method of pustulation period heat resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |