CN108617495A - Molecular breeding method for improving heat resistance of rice in heading and flowering stages by using single-segment replacement line - Google Patents
Molecular breeding method for improving heat resistance of rice in heading and flowering stages by using single-segment replacement line Download PDFInfo
- Publication number
- CN108617495A CN108617495A CN201710655929.1A CN201710655929A CN108617495A CN 108617495 A CN108617495 A CN 108617495A CN 201710655929 A CN201710655929 A CN 201710655929A CN 108617495 A CN108617495 A CN 108617495A
- Authority
- CN
- China
- Prior art keywords
- rice
- plant
- molecular labeling
- molecular
- heading
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000009395 breeding Methods 0.000 title claims abstract description 29
- 235000007164 Oryza sativa Nutrition 0.000 title abstract description 45
- 235000009566 rice Nutrition 0.000 title abstract description 42
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 title abstract description 15
- 240000007594 Oryza sativa Species 0.000 title description 44
- 241000196324 Embryophyta Species 0.000 claims abstract description 51
- 241000746966 Zizania Species 0.000 claims abstract description 17
- 235000002636 Zizania aquatica Nutrition 0.000 claims abstract description 17
- 238000000034 method Methods 0.000 claims abstract description 10
- 210000000349 chromosome Anatomy 0.000 claims abstract description 5
- 238000004088 simulation Methods 0.000 claims abstract description 5
- 238000003306 harvesting Methods 0.000 claims abstract description 3
- 238000002372 labelling Methods 0.000 claims description 33
- 238000006467 substitution reaction Methods 0.000 claims description 20
- 230000000306 recurrent effect Effects 0.000 claims description 11
- 244000118056 Oryza rufipogon Species 0.000 claims description 9
- 238000012408 PCR amplification Methods 0.000 claims description 3
- 235000013339 cereals Nutrition 0.000 claims description 2
- 230000008774 maternal effect Effects 0.000 claims description 2
- 230000001488 breeding effect Effects 0.000 abstract description 17
- 239000003147 molecular marker Substances 0.000 abstract description 9
- 238000004321 preservation Methods 0.000 abstract description 5
- 210000000988 bone and bone Anatomy 0.000 abstract description 2
- 241000209094 Oryza Species 0.000 abstract 3
- 108020004414 DNA Proteins 0.000 description 13
- 239000000463 material Substances 0.000 description 9
- 238000013461 design Methods 0.000 description 6
- 238000011160 research Methods 0.000 description 6
- 238000005516 engineering process Methods 0.000 description 5
- 235000005044 Oryza sativa Indica Group Nutrition 0.000 description 4
- 244000005700 microbiome Species 0.000 description 4
- 238000012545 processing Methods 0.000 description 4
- 230000006378 damage Effects 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 230000007261 regionalization Effects 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 240000002582 Oryza sativa Indica Group Species 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 230000004720 fertilization Effects 0.000 description 2
- 239000003337 fertilizer Substances 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 238000005286 illumination Methods 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000013507 mapping Methods 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 230000002906 microbiologic effect Effects 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 238000004382 potting Methods 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 201000004569 Blindness Diseases 0.000 description 1
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 108091006146 Channels Proteins 0.000 description 1
- 108091092878 Microsatellite Proteins 0.000 description 1
- 240000002853 Nelumbo nucifera Species 0.000 description 1
- 235000006508 Nelumbo nucifera Nutrition 0.000 description 1
- 235000006510 Nelumbo pentapetala Nutrition 0.000 description 1
- 229910000831 Steel Inorganic materials 0.000 description 1
- 230000009418 agronomic effect Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000012620 biological material Substances 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000015556 catabolic process Effects 0.000 description 1
- 230000009514 concussion Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 230000007850 degeneration Effects 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000006073 displacement reaction Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 238000000227 grinding Methods 0.000 description 1
- 239000010903 husk Substances 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 238000009403 interspecific hybridization Methods 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 238000011068 loading method Methods 0.000 description 1
- 238000009629 microbiological culture Methods 0.000 description 1
- 238000001426 native polyacrylamide gel electrophoresis Methods 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 230000010152 pollination Effects 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000005086 pumping Methods 0.000 description 1
- 238000004153 renaturation Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000010959 steel Substances 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 238000010792 warming Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Botany (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Environmental Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Developmental Biology & Embryology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Forests & Forestry (AREA)
- Biochemistry (AREA)
- Ecology (AREA)
- General Engineering & Computer Science (AREA)
- Biodiversity & Conservation Biology (AREA)
Abstract
The invention belongs to the field of molecular breeding, and relates to a molecular breeding method for cultivating a new heat-resistant variety of rice in a filling stage. The method takes a medium indica two-line bone dry restoring line 9311 with the preservation number of CGMCC NO.12532 as a female parent and a wild rice chromosome segment introduction line YJ07-04-06 with the preservation number of CGMCC NO.12534 as a male parent, hybridizes for 1 generation, backcrosses for 3 generations, and then selfes for 3 generations to obtain BC3F4Each generation is single plant harvest; and then combining molecular marker-assisted selection with artificial climate chamber simulation high temperature stress identification to obtain a new rice strain. By using the method, a heat-resistant new rice strain 'Yuanye No. 2' at the heading and flowering stages is cultivated. The molecular marker assisted selection of target characters can rapidly and efficiently cultivate the heat-resistant restoring line at the heading and flowering stage within 3 to 4 years.
Description
Technical field
The invention belongs to field of molecular breeding, are related to a kind of heat-resisting using single slice substitution line improvement Rice Heading blooming stage
Property molecular breeding method, and in particular to it is a kind of to improve Rice Heading blooming stage heat resistance using wild rice single slice substitution line
Molecular breeding method.
Background technology
Climatic regionalization is the Major Natural for influencing one of the Main Factors of global yield and quality of rice, and Chinese rice makees
Disaster occurs mainly on the south the Yangtze river basin (Beijing Xiong Zhenmin, Cai Hongfa chief editor rice in China:Chinese agriculture science and technology goes out
Version society, 1992).Rice ear sprouting period obstacle by a high temperature (also referred to as heat evil) refers to rice 35 DEG C or more high temperature sides of body in full heading time
Compel to cause the pollination of grain husk flower and fertilization cannot be normally carried out, rate of fertilization degradation, cause rice significantly the underproduction the phenomenon that, it is early
Have many reports(Zhu Xingming, Zeng Qingxi, peaceful clear profit natural high-temperatures influence Chinese agricultures chasmogamous on hybrid paddy rice
Science, 1983,16 (2): 37–44).Unexpected, Disaster Area is big, it is tight to often result in occurring for rice ear sprouting period obstacle by a high temperature
Again the features such as the underproduction(Wang Zhigang, Wang Lei, vast stretch of wooded country, Pang Qianlin, E Zhiguo, Zhang Yuping, the peaks Zhu De rice Climatic regionalizations
And Progresses in Research on Heat Tolerance China rice, 2013,19 (1): 27–31).Global tropical area rice ear sprouting period is by height
There are about 4.0 × 106 hm for the area of warm potential threat2, China Yangtze river basin is also the severely afflicated area of rice florescence high temperature damage,
There is the report of rice florescence High Temperature Disaster on the ground such as Hunan, Hubei, Jiangxi, Jiangsu, Sichuan, and many kinds are big when disaster-stricken serious
Area setting percentage is reduced to 50% or less, suffers heavy losses(Wang Shoukang, Wang Gengwen, Wang and good rice Climatic regionalizations in 2003
The Anhui the investigation agronomy notification of situation, 2004,10 (1): 27–35).In recent years, global warming is further apparent, water
Rice heading stage high temperature damage shows the situation increasingly sharpened, raw to the safety of China's especially Yangtze river basin rice
Production, which forms, to be seriously threatened.
Using traditional breeding way and molecular mark technology cultivate rice heat resistant variety be it is most effective at present and
The method of feasible control high temperature stress harm.Long-grained nonglutinous rice is a subspecies of cultivated rice, and main producing region is middle and lower reach of Yangtze River Plain, four
River basin, Jiangnan each province, so be the main object of genetic research and breeding, but the early rice of the double rice cropping system in these areas is taken out
Fringe blooming stage frequently encounters continuous high temperature heat evil, influences the yield and quality of hybrid early High yield combination.Yuanjiang River wild rice is long
Phase is grown in the common wild-rice of Yuanjiang County of Yunnan Dry-hot Valley Area, has the spy for adapting to the extreme natural environments such as high temperature and drought
Property.Therefore Yuanjiang River wild rice is important the important sources of heat-resisting and drought-enduring resource.Breeders want to pass through interspecific hybridization always
Mode in channel genes to cultivated rice heat-resisting in Yuanjiang River wild rice, but since Linkage drag and filial generation are not allowed
Easily stable etc. reasons limit the cultivation of heat resistant variety.Application of the molecular marking technique in improving rice Heat-tolerance Breeding is significantly
Reduce the blindness selected in breeding process, fast implements external source elite germplasm and permeated to cultivar, widened kind
Hereditary basis.Domestic and international researcher has carried out a large amount of QTL Position Research to heat resistance, and some has been used to label auxiliary choosing
Select breeding practice.
Single slice substitution line (single segment substitution lines, SSSL) is to utilize hybridization, backcrossing
With the nurse crop whole gene group of molecular marker assisted selection (marker-assisted selection, MAS) structure
A series of near isogenic lines.An only homozygous chromosome segment from donor parents in its genome, and genome
Rest part it is identical as recurrent parent.It is to carry out genome research, the ideal of especially QTL positioning and Molecular design breeding
Material.Peleman etc.(Peleman J .D. and Vander Voort J.R., Breeding by design [J]
Trends Plant Sci, 2003,8 (7): 330-334)Propose the new concept of Molecular design breeding, including positioning correlation
The QTL of character, the allelism variation for evaluating these sites and development design and context, are expected to break through the side such as accurate high-efficient breeding of rice
Obstacle current Guangdong Province's plant molecular breedings key lab in face has cultivated more than 1600 parts of rice single slice substitution line (Xi
Z.Y., He F.H., Zeng R.Z., et al. Development of a wide population of
chromosome single segment substitution lines( SSSLs) in the genetic
Background of an elite cultivar in rice (Oryza sativa L) [J] .Genome, 2006,
49:476-484), the QTLs and its allele of many Main Agronomic Characters are identified with these materials(Yang Zifeng, Zhu Hai
Great waves, Liu Ziqiang wait rice ear sprouting period QTL upper Journal of Sex Research [J] Agricultural University Of South China journals of the based on single slice substitution line,
2014,35 (6): 24-28.), and carried out Molecular design breeding extensively(High yields of the beam sea good fortune based on single slice substitution line
The Guangzhou high-grade rice design and context [D]:Agricultural University Of South China, 2011.).
Invention content
The purpose of the present invention is the above-mentioned deficiencies for the prior art, provide a kind of utilization Yuanjiang River wild rice single slice displacement
The molecular breeding method of system's improvement Rice Heading blooming stage heat resistance.
The purpose of the present invention can be achieved through the following technical solutions:
A kind of molecular breeding method for improveing Rice Heading blooming stage heat resistance using Yuanjiang River common wild-rice single slice substitution line,
It comprises the following steps:
(1)The middle Xian two for being CGMCC NO.12532 with preserving number is that elite restorer lines 9311 are maternal, preserving number CGMCC
The Yuanjiang River common wild-rice single slice substitution line YJ07-04-06 of NO.12534 is male parent, hybridizes for 1 generation, is returned for 3 generations, then be selfed 3
Generation, which obtains, stablizes homozygous lines BC3F4, per generation is all single fringe harvest.
(2)Molecular labeling auxiliary selects for the first time:Plant BC1F1, DNA is extracted using CTAB methods, it is wild using the Yuanjiang River
The corresponding molecular labeling primer of raw rice single slice substitution line YJ07-04-06 carries out PCR amplification, selection to RM3394 and RM6223
Contain the above-mentioned 4 molecular labeling bands for deriving from Yuanjiang River common wild-rice simultaneously, molecular weight is 404bp and 184bp respectively
Single plant is returned with recurrent parent 9311, and seed is harvested by single plant;Wherein molecular labeling primer is positive/negative to RM3394 is to sequence
SEQ ID NO.1/SEQ ID NO.2, RM6223 it is positive/negative to sequence be SEQ ID NO.3/SEQ ID NO.4.
(3)Second of the selection of molecular labeling auxiliary:Plant BC2F1, after every plant is extracted DNA, recycle the molecular labeling
Primer pair determines BC2F1The genotype of single plant, while there is 2 molecular labeling bands for deriving from above-mentioned wild rice, molecular weight point
It is not single plant continuation and the backcrossing of recurrent parent 9311 of 404bp and 184bp.
(4)Molecular labeling auxiliary third time selects:Plant BC3F1, after every plant is extracted DNA, continue with the molecule mark
Note primer pair determines BC3F1The genotype of single plant, while there is 2 molecular labeling bands for deriving from above-mentioned wild rice, molecular weight
It is the individual plant selfing of 404bp and 184bp respectively, seed is harvested by single plant.
(5)Molecular labeling assists the 4th selection:Plant BC3F2, after every plant is extracted DNA, continue with the molecule mark
Note primer pair determines BC3F2The genotype of single plant, while there is 2 molecular labeling bands for deriving from above-mentioned wild rice, molecular weight
It is the individual plant selfing acquisition BC of 404bp and 184bp respectively3F3, seed is harvested by single plant.
2, according to claim 1 a kind of heat-resisting using Yuanjiang River wild rice single slice substitution line cultivation heading flowering period
The molecular breeding method for the restorer that property significantly improves, it is characterised in that the molecular breeding method further includes step(6):It will
Step(5)The BC containing homozygous genotype screened3F3Strain kind is moved into phjytotron in basin alms bowl on the day of heading, utilizes
It is new that manual simulation's high temperature stress carries out the incubation that heading flowering period heat resistance screening acquisition heading flowering period heat resistance significantly improves
Strain.
Advantageous effect:Two pastern bones of Xian are dry in a kind of improvement using Yuanjiang River wild rice single slice substitution line provided by the present invention
The molecular breeding method of restorer heading flowering period heat resistance has following excellent compared with traditional backcrossing pyramiding breeding technology
Point:There are crossing work amounts for traditional backcrossing pyramiding breeding technology greatly, the defect of selection poor reliability, breeding cycle length.Pass through
Molecular marker assisted selection objective trait can be rapidly and efficiently cultivated in 3 ~ 4 years during heading flowering period patience significantly increases
Xian two is elite restorer lines.The present invention is elite restorer lines with Yuanjiang River wild rice single slice substitution line YJ07-04-06 and middle Xian two
9311 be material, and new lines " the member open country 2 that heading flowering period heat resistance significantly improves is obtained by molecular marker assisted selection
Number ", " member is No. 2 wild " setting percentage in the case where heading flowering period simulates high temperature stress improves 13.1% than control 9311, single plant yield position
21.1g increases 1.2g than recurrent parent.
Description of the drawings
Fig. 1 molecular marker assisted selection heading flowering period heat resistances are significantly better than the new lines of recurrent parent.
Setting percentage shows under target interval different genotype high temperature stress in 9311 backgrounds of Fig. 2(2014-2015).
Biomaterial preservation proves
9311 be long-grained nonglutinous rice(Oryza sativasubsp. indica.), it is preserved in China Microbiological bacterium on May 20th, 2016
Kind preservation administration committee common micro-organisms center, address Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, the Chinese Academy of Sciences are micro-
Biological study institute, preserving number are CGMCC NO.12532.
YJ07-04-06 is long-grained nonglutinous rice(Oryza sativasubsp. indica), during on May 20th, 2016 is preserved in
State's Microbiological Culture Collection administration committee common micro-organisms center, address Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, in
Institute of microbiology of the academy of sciences of state, preserving number are CGMCC NO.12534.
Specific implementation mode
1 Selection parent of embodiment
Rice national engineering laboratory of Jiangxi Academy of Agricultural Sciences(Nanchang)Super rice research and development center is wheel with another name for Sichuan Province extensive 527
Parent is returned, with the Yuanjiang River wild rice lotus pool 3 for donor parents(Nonrecurrent parent), being returned, 5 generations selfing, 3 generations combination covering is complete
The SSR molecular marker assisted Selection of genome has been cultivated the Yuanjiang River common wild-rice single slice that a set of another name for Sichuan Province extensive 527 is background and has been replaced
It it is 112, the coverage rate of genome is up to 73.5%.It 2010, the 1st day after Rice Heading, chooses and grows consistent plant
It is packed into basin alms bowl, moves into phjytotron.Per 3 plants of potting, every part of material sets 3 repetitions, conventional water and fertilizer management.Setting is relatively wet
Degree is 85 %, illumination 12h/d .0 DEG C of constant temperature 38 (daytime)/28 DEG C (night).5 d are handled, after processing, will be tested
Material moves on under room temperature, until ripe.Setting percentage is investigated, each processing is all provided with control, and (control is field normal growing conditions
Under each test material), metrics evaluation heading flowering period heat resistance is fallen to setting percentage.Filter out heading flowering period heat resistance
The introgressive line significantly improved 11, including introgressive line YJ07-04-06, in simulation high temperature stress, setting percentage compares
According to raising 13.4%.Introgressive line YJ07-04-06 is cultivation long-grained nonglutinous rice(Oryza sativaindica), preservation on May 20 in 2016
In China Committee for Culture Collection of Microorganisms's common micro-organisms center, address Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Number, Institute of Microorganism, Academia Sinica, preserving number is CGMCC NO.12534;9311 be cultivation long-grained nonglutinous rice(Oryza sativa
indica), it is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, address on May 20th, 2016
Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica, preserving number are CGMCC NO.12532.
Embodiment 2
(1)Summer in 2011 plants each a line of YJ07-04-06 and 9311 respectively in Nanchang experiment station of Jiangxi Academy of Agricultural Sciences,
9311(CGMCC NO.12532)For female parent, YJ07-04-06(CGMCC NO.12534)It combines and generates for male parent preparing hybrid
F1, all mix and receive after ripe.Winter in 2011 plants 3 row F in Sanya, Hainan1, backcrossing acquisition BC1F1, all mix and receive after ripe.
Field management carries out according to a conventional method.
(2)Molecular marker assisted selection:Summer in 2012 plants 50 rows in Nanchang experiment station of Jiangxi Academy of Agricultural Sciences
BC2F1, often 8 plants of row, every plant of acquisition blade are put into the eppendorf pipes of 2 ml, fill the small steel ball of people, ground using high-flux tissue
Grind the SDS extracting solutions 600 that instrument high speed concussion grinding is added 1.25% laterμL extracts DNA, using YJ07-04- using SDS methods
06(CGMCC NO.5574)With 9311(CGMCC NO.5575)Molecular labeling on introgressed segment(Table 1)PCR amplification is carried out, is expanded
Increasing system 10μL, DNA profiling 1μL, 94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 0.5min, 57 DEG C of renaturation 0.5min, 72 DEG C extend
1min, after 32 recycle, 72 DEG C re-extend 10 min, and amplified production is through native polyacrylamide gel electrophoresis:Gel strength
It is 8%, electrophoretic buffer is 0.5 times of TBE, 175V constant pressures electrophoresis 1.5 hours.Select 10 single plants containing 2 molecular labelings after
Continuous backcrossing obtains BC3F1Seed.
(3)Winter in 2012 is in Sanya, Hainan by BC3F13 rows are planted, often 8 plants of row, every plant of acquisition blade, after extracting DNA,
The molecular labeling provided using table 1 determines BC3F1The genotype of single plant selects 2 the single plant all contained is marked to continue selfing and obtains
BC3F2(There are 2 molecular labeling bands that above-mentioned wild rice is derived from table 1 simultaneously).
The SSR molecular marker of 1 YJ07-04-06 introgressed segments of table
(4)Winter in 2013 is in Sanya, Hainan by BC3F210 rows are planted, often 8 plants of row, every plant of acquisition blade, after extracting DNA, profit
The molecular labeling provided with table 1 determines BC3F2The genotype of single plant selects 2 homozygous individual plant selfings of label to obtain BC3F3(Together
When in table 1 derive from above-mentioned wild rice 2 molecular labeling bands).
(5)Phjytotron simulates high temperature stress identification:2014-2015, by homozygous BC3F4And BC3F5Strain is in pumping
The 1st day after fringe, chooses and grow consistent plant loading basin alms bowl, move into phjytotron.Per 3 plants of potting, every part of material sets 3
A repetition, conventional water and fertilizer management.Relative humidity is set as 80 %, illumination 11h/d .0 DEG C of constant temperature 38 (daytime)/28 DEG C
(night).5 d are handled, after processing, test material is moved on under room temperature, until ripe.Setting percentage is investigated, and other are heavy
Economical character is wanted, each processing is all provided with control (control is each test material under the normal growing conditions of field), under setting percentage
It is reduced to metrics evaluation heading flowering period heat resistance.
By variance analysis, manual simulation is identified in being selected from the pure lines more than two eposides identified in the controlled environment chamber
Setting percentage heat resistance is significantly higher than the strain of recurrent parent, as improved line " member is No. 2 wild " in the case of high temperature stress.
It is elite restorer lines for medium rice two, therefore since the heat-resisting strain background parent that the present invention selects is 9311
It is high by " member is No. 2 wild " strain distinguishing feature of the molecular breeding method selection and breeding, with the significantly heat-resisting spy of heading flowering period
Point.
Note:The primer of RM numbers, which comes from, utilizes Temnykh etc.(2000)With McCouch etc.(2002)The SSR primers of announcement
The SSR marker of sequent synthesis(Temnykh S, Park W D, Ayres N, et al. Mapping and genome
organization of microsatellite sequences in rice (Oryza sativa L.).
Theoretical and Applied Genetics, 2000, 100(5): 697-712;McCouch S R,
Teytelman L, Xu Y, et al. Development and mapping of 2240 new SSR markers for
rice (Oryza sativa L.). DNA research, 2002, 9(6): 199-207.).
<110>Jiangxi Academy of Agricultural Sciences
<120>A kind of molecular breeding method for improveing Rice Heading blooming stage heat resistance using single slice substitution line
<160> 4
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Molecular labeling primer is to RM3394 forward direction sequences
<400> 1
GAGAGGGAAGGAGTTTCTTAGC
22
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Molecular labeling primer is to RM3394 reverse sequences
<400> 2
TAGTTTACACGTACCCATGTGC
22
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>Molecular labeling primer is to RM6223 forward direction sequences
<400> 3
TAGAGAGGGCCATCGATTCTTCG
23
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Molecular labeling primer is to RM6223 reverse sequences
<400> 4
CTGCTACAAGAAGCGGCTCACC
22
Claims (2)
1. a kind of molecular breeding method for improveing Rice Heading blooming stage heat resistance using single slice substitution line, including:
1) it is maternal, preserving number CGMCC that the middle Xian two for being CGMCC NO.12532 with preserving number, which is elite restorer lines 9311,
The Yuanjiang River common wild-rice chromosome single slice substitution line YJ07-04-06 of NO.12534 is male parent, hybridizes for 1 generation, is returned for 3 generations, then
It is selfed the acquisition of 3 generations and stablizes homozygous lines BC3F4, per generation is all single fringe harvest;
2) BC is planted1F1, DNA is extracted using SDS methods, using the Yuanjiang River wild rice chromosome single slice substitution line YJ07-
The corresponding molecular labeling primers of 04-06 are to RM6515 and RM8069(Table 1)PCR amplification is carried out, selection comes containing above-mentioned 4 simultaneously
Derived from the molecular labeling band of Yuanjiang River common wild-rice, molecular weight is the single plant and recurrent parent 9311 of 404bp and 184bp respectively
Backcrossing, seed are harvested by single plant;Wherein molecular labeling primer it is positive/negative to RM3394 to sequence be SEQ ID NO.1/SEQ ID
NO.2, RM6223 it is positive/negative to sequence be SEQ ID NO.3/SEQ ID NO.4;
3) second of selection of molecular labeling auxiliary:Plant BC2F1, after every plant is extracted DNA, recycle the molecular labeling primer
To determining BC1F1The genotype of single plant, while there are 2 molecular labeling bands for deriving from above-mentioned wild rice, molecular weight is respectively
The single plant of 404bp and 184bp continues to be returned with recurrent parent 9311;
4) molecular labeling auxiliary third time selects:Plant BC3F1, after every plant is extracted DNA, continue with the molecular labeling and draw
Object is to determining BC3F1The genotype of single plant, while there are 4 molecular labeling bands for deriving from above-mentioned Yuanjiang River common wild-rice, point
Son amount is the individual plant selfing of 404bp and 184bp respectively, and seed is harvested by single fringe;
5) molecular labeling assists the 4th selection:Plant BC3F2, after every plant is extracted DNA, continue with the molecular labeling and draw
Object is to determining BC3F2The genotype of single plant, while there are 2 molecular labeling bands for deriving from above-mentioned Yuanjiang River common wild-rice, point
Son amount is that the individual plant selfing of 404bp and 184bp obtains BC respectively3F3, seed is harvested by single fringe.
2. a kind of molecule for being improved Rice Heading blooming stage heat resistance using single slice substitution line according to claim 1 is educated
Kind method, it is characterised in that it is 59.3% that the strain shows as setting percentage for 2014 under manual simulation's high temperature stress, than wheel
It returns parent's setting percentage and increases by 18.5%;Single plant yield position 23.45g increases 7.15g, 116.1 centimetres of plant height, fringe than recurrent parent
24.3 centimetres long, Defined daily doses 97.6 averagely increase by 30.1 than recurrent parent;Setting percentage is 59.3%, compares recurrent parent
Setting percentage increases by 18.5%, reaches pole significant difference;Table 2 is shown in heading stage high temperature stress and writes the choosing system(" member is No. 2 wild ")
Setting percentage, Defined daily doses and single plant yield average value dramatically increased compared with 9311 poles, the effective fringe of plant height, spike length, single plant, per fringe
Total grain number value is not notable compared with 9311 differences;
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2016107997570 | 2016-08-31 | ||
CN201610799757.0A CN106947803A (en) | 2016-08-31 | 2016-08-31 | A kind of utilization single slice substitution line improves the molecular breeding method of Rice Heading blooming stage heat resistance |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108617495A true CN108617495A (en) | 2018-10-09 |
Family
ID=59466197
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610799757.0A Pending CN106947803A (en) | 2016-08-31 | 2016-08-31 | A kind of utilization single slice substitution line improves the molecular breeding method of Rice Heading blooming stage heat resistance |
CN201710655929.1A Pending CN108617495A (en) | 2016-08-31 | 2017-08-03 | Molecular breeding method for improving heat resistance of rice in heading and flowering stages by using single-segment replacement line |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610799757.0A Pending CN106947803A (en) | 2016-08-31 | 2016-08-31 | A kind of utilization single slice substitution line improves the molecular breeding method of Rice Heading blooming stage heat resistance |
Country Status (1)
Country | Link |
---|---|
CN (2) | CN106947803A (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112391494A (en) * | 2020-12-21 | 2021-02-23 | 江西省农业科学院水稻研究所 | Molecular breeding method for improving utilization rate of nitrogen in rice |
CN114651686A (en) * | 2022-04-11 | 2022-06-24 | 海南省农业科学院粮食作物研究所 | Method for breeding new red rice variety by utilizing medicinal wild rice |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105123505A (en) * | 2015-08-31 | 2015-12-09 | 安徽农业大学 | Cultivation method for peculiar heat-resistant paddy contiguous segment substitution lines |
-
2016
- 2016-08-31 CN CN201610799757.0A patent/CN106947803A/en active Pending
-
2017
- 2017-08-03 CN CN201710655929.1A patent/CN108617495A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105123505A (en) * | 2015-08-31 | 2015-12-09 | 安徽农业大学 | Cultivation method for peculiar heat-resistant paddy contiguous segment substitution lines |
Non-Patent Citations (3)
Title |
---|
奎丽梅等: "云南元江野生稻抽穗开花期耐热QTL定位", 《农业生物技术学报》 * |
曹志斌等: "水稻抽穗扬花期耐热QTL(qHTH5)定位及其遗传效应分析", 《中国水稻科学》 * |
陈旭等: "水稻耐高温研究进展", 《安徽农业科学》 * |
Also Published As
Publication number | Publication date |
---|---|
CN106947803A (en) | 2017-07-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104561297A (en) | Method for detecting SSR molecular marker of pepper male sterility restoring gene as well as kit of SSR molecular marker | |
CN113179945B (en) | Breeding method of high-yield lodging-resistant disease-resistant new wheat variety | |
CN106912372A (en) | The method for cultivating perennial rice sterile line using hero wild rice vegetative propagation characteristic long | |
CN103609428A (en) | Method for cultivating corn allopolyploid by using unreduced gamete characteristic of tripsacum dactyloides | |
CN103571852A (en) | Sea island cotton chromosome segment capable of obviously increasing upland cotton ginning outturn and SSR (simple sequence repeat) marker of sea island cotton chromosome segment | |
CN108486273B (en) | Excavation and application of SSR (simple sequence repeat) markers on chromosome 5 and closely linked with salt-tolerant QTL (quantitative trait locus) of rice | |
CN108617495A (en) | Molecular breeding method for improving heat resistance of rice in heading and flowering stages by using single-segment replacement line | |
CN101176425B (en) | Method for selecting and cultivating hybridized rice infertility series resisting ear germination using molecule marker | |
CN109207509A (en) | It is a kind of orientation, high effect culture salt tolerant rice kind breeding method | |
CN108703063A (en) | Molecular breeding method for improving heat resistance of rice in heading flowering phase and filling phase by utilizing single-segment replacement system polymerization | |
CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
CN105331689B (en) | Wheat-elytrigia elongata powdery mildew resistant translocation line breeding method and molecular marker thereof | |
CN104313150A (en) | Chrysanthemum aphid resistance associated molecular marker, screening method and application | |
Alam et al. | Marker-assisted foreground selection for identification of salt tolerant rice genotypes. | |
CN113943732B (en) | SNP (Single nucleotide polymorphism) marker, primer set, kit and application related to heat resistance of cucumber in adult stage | |
CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
CN102517396B (en) | Molecular breeding method for breeding new anti-verticillium cotton seed | |
CN112715349B (en) | Breeding method of female genic male sterile line of multi-year type rice | |
CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
CN108504760B (en) | QTL excavation and application of excellent salt-tolerant resources of rice | |
CN108770677B (en) | Molecular breeding method for improving heat resistance of rice in filling stage by using single-segment replacement line | |
CN107699630B (en) | Molecular marker linked with wheat disease-resistant gene Pm21 and application thereof in breeding | |
CN108719047B (en) | Molecular breeding method for improving heat resistance of rice young ear in meiosis stage by using single-segment replacement line | |
Dzyubenko et al. | Objectives of guar breeding in the Russian Federation in connection with the prospects of domestic guar gum production |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181009 |
|
WD01 | Invention patent application deemed withdrawn after publication |