CN109206512A

CN109206512A - The IgG antibody and application of anti-Staphylococcus aureus richness serine repetitive proteins SraP

Info

Publication number: CN109206512A
Application number: CN201810961838.5A
Authority: CN
Inventors: 周婷婷; 岳岩; 朱进; 郑峰
Original assignee: Inst Of Military Medicine Nanjing Military Area Pla
Current assignee: Inst Of Military Medicine Nanjing Military Area Pla
Priority date: 2018-08-22
Filing date: 2018-08-22
Publication date: 2019-01-15
Anticipated expiration: 2038-08-22
Also published as: CN109206512B

Abstract

The IgG antibody and application of anti-Staphylococcus aureus richness serine repetitive proteins SraP.The antibody can specifically bind rich serine repetitive proteins L-Lectin block, by combining S. aureus L-forms surface anchor proteins SraP, to reduce the quantity of S. aureus L-forms bacterium to the adherency and intrusion of cell and in mouse blood, the action target spot of anti-S. aureus L-forms infection Antybody therapy intervention can be used as.

Description

The IgG antibody and application of anti-Staphylococcus aureus richness serine repetitive proteins SraP

Technical field

The present invention relates to staphylococcus aureus richness serine repetitive proteins SraP gene cloning, source of mouse monoclonal antibodies to prepare skill The application of art and the monoclonal antibody in infection of staphylococcus aureus treatment, preventive medicine.

Background technique

Rich serine repetitive proteins (Serine-rich repeat proteins, SRRPs) are since 1998 in secondary blood Streptococcus (Streptococcus parasanguinisFW213 since being found for the first time in), SRRPs is again in other hammers Bacterium, staphylococcus aureus (Staphylococcus aureus), staphylococcus epidermis (Staphylococcus epidermidis) etc. in be found.It is known that SRRPs is a kind of positioned at gram-positive bacteria cell surface, can mediate The glycoprotein adhered between bacterium and bacterium or between host cell.SRRPs can not only adherency in mediating bacterial kind, may be used also To mediate the adherency of inter-species, bacterium is set to be colonized on host cell by forming biomembrane, and then develop into infection, it is such as sub- Acute bacterial endocarditis, mouth infection, pneumonia and meningitis etc..Therefore, SRRPs can be used as pharmaceutical intervention or new Type protective antigens target.

Staphylococcus aureus (S.aureus) it is to endanger one of important pathogen of human health, it is widely present in people's On respiratory tract and skin, mucous membrane, skin infection, infectious endocarditis or whole body seriousness infection such as septicemia can be caused Deng.SraP (serine-rich adhesion for platelets) is the SRR albumen in S. aureus L-forms, and SraP not only can be with It combines and can be combined with the bacterium of deletion form with the bacterium of wild type, be not only involved in the formation of S. aureus L-forms biomembrane, may be used also With the adherency of mediating bacterial inter-species.The non-duplicate area SraP can tie in conjunction with blood platelet with saliva agglutinant protein gp340 It closes, gp340 is expressed in saliva, small intestine and lung as a kind of glycoprotein.SraP is mainly the trisaccharide component NeuAc with gp340 α (2-3) Gal β (1-4) GlcNAc is combined.Crystal structure shows, the ligand binding domain of SraP is mainly made of β-piece, can be with It is divided into four subdomains: L-Lectin module, β-GF and CDHL-1 and CDHL-2 module, SraP_BRWith A₅₄₉Cell glues It is attached that adherency and intrusion of the S. aureus L-forms to epithelial cell are mainly mediated in conjunction with Neu5Ac by its L-Lectin block.Thus it says Bright SraP_BRMiddle L-lectin block plays main function, L-lectin, CDHL-1 and CDHL-2 during with Binding Capacity Module contains calcium ion, mainly plays the integrally-built effect of stable albumen.SraP_BRPass through L-lectin block and host The Neu5Ac on cell (such as blood platelet) surface is combined, it may be possible to the main reason for causing S. aureus L-forms inner cavity to be infected.Therefore SraP L-Lectin block as an important virulence factor of S. aureus L-forms can be used as prevention and control S. aureus L-forms infection potential drug or Vaccine development target spot.

At present for S. aureus L-forms infection treatment be still by vein for a long time a large amount of antibiotic treatment with reduce infection, However the effect is unsatisfactory, and as the abuse of antibiotic causes S. aureus L-forms to generate serious drug resistance, occurs within the hospital Therefore the superbacterias such as MRSA, VRSA develop the alternative medicine of bacterial-infection resisting, such as the treatment based on antibody, become current There is an urgent need to.S. aureus L-forms can be infected by the Mechanism establishing of various complexity, such as by its generate cell embrane-associated protein, A series of adherency of glycopolymers and toxin mediating bacterials promotes host cell lysis, interferes antibody function, and complement is inhibited to swash Access living simultaneously infects phagocyte.Therefore for the antibody of various virulence relevant molecules and vaccine just in active development.With biography System antibiotic is compared, and antibody has some unique advantages, for example specific height, long half time, mediated cell swallow lethal effect Deng.You Duo company or research structure have carried out the research of S. aureus L-forms monoclonal antibody now, and achieve some make us It is rousing oneself as a result, many antibody have been introduced into clinical investigation phase, but some the effect is unsatisfactory, such as directed toward bacteria pod membrane 5/8 type of polysaccharide serum is directed to lipoteichoicacid (Lipoteichoic acid, LTA), ATP box movement system (ATP- Binding cassette, ABC) transport protein etc. proceeds to clinical three phases experiment and counts out.The angle selected from target spot It sees, the exploitation of bacterial-infection resisting antibody still faces many limitations at present, therefore opening up new valuable target spot is still one important Research direction, about the selection of Staphylococcus aureus antibody novel targets, there are also very big rooms for promotion in Chinese patent.

Summary of the invention

The technical issues of solution: the present invention provides a kind of resisting for anti-Staphylococcus aureus richness serine repetitive proteins SraP Body IgG and application, having been screened by monoclonal antibody technology of preparing has the recombinant protein of the L-Lectin block of SraP The monoclonal antibody of high-affinity, cell and animal experiments show that, which can significantly reduce Staphylococcus aureus Adherency and intrusion and good animal protection function of the bacterium to host cell.

Technical solution: the IgG antibody of anti-Staphylococcus aureus richness serine repetitive proteins SraP, including light chain L and again The amino acid sequence of the variable region chain H, the light chain L is as shown in SEQ ID NO.1, the variable region amino acid sequence such as SEQ of heavy chain H Shown in ID NO.2.

The nucleic acid sequence of the IgG antibody of above-mentioned anti-Staphylococcus aureus richness serine repetitive proteins SraP is encoded, is encoded The nucleic acid sequence of the variable region light chain L is as shown in SEQ ID NO.3, the nucleic acid sequence of the variable region encoding heavy chain H such as SEQ ID NO.4 It is shown.

The IgG antibody of above-mentioned anti-Staphylococcus aureus richness serine repetitive proteins SraP, the amino acid of light chain L constant region Sequence is as shown in SEQ ID NO.5, and the amino acid constant region sequence of heavy chain H is as shown in SEQ ID NO.6.

The nucleic acid sequence of the IgG antibody of above-mentioned anti-Staphylococcus aureus richness serine repetitive proteins SraP is encoded, is encoded The nucleic acid sequence of light chain L constant region is as shown in SEQ ID NO.7, the nucleic acid sequence of encoding heavy chain H constant region such as SEQ ID NO.8 It is shown.

The IgG antibody of above-mentioned anti-Staphylococcus aureus richness serine repetitive proteins SraP is in preparation treatment S. aureus L-forms infection Application in drug

The utility model has the advantages that the present invention provides a kind of monoclonal antibody with high protectiveness, high specific, the anti-SraP of high-affinity IgG.SraP is the rich serine repetitive proteins in S. aureus L-forms, can pass through its L-Lectin block and host cell surface Adherency and intrusion of the Neu5Ac combination mediating bacterial to host cell.Therefore anti-SraP monoclonal antibody IgG of the invention can be answered For the treatment of related S. aureus L-forms infection, in Prevention Research.

The present invention screens the anti-SraP Monoclonal Antibody Cell of source of mouse using the L-Lectin block recombinant protein of SraP as antigen Strain SraP-001.Function Identification is carried out to the source of mouse monoclonal antibody IgG of preparation.Immunology detection shows, the source of mouse monoclonal antibody can with not It is specifically bound with truncated SraP recombinant protein (block containing L-Lectin), cell experiment shows anti-SraP source of mouse monoclonal antibody IgG S. aureus L-forms adherency can be significantly reduced and enter the quantity of epithelial cell.Mouse after anti-SraP source of mouse monoclonal antibody IgG injection, Neng Goubao Protecting mouse reduces the quantity of S. aureus L-forms in blood.

Detailed description of the invention

Fig. 1 is the SDS-PAGE testing result figure that the ligand binding domain SraP difference truncates type recombinant protein, wherein M, marker；1, SraP_BR-HisWhole bacterial protein after-pET28a induction；2-3, the SraP of purifying_BR-HisRecombinant protein；4, SraP_L-Lectin-HisWhole bacterial protein after-pET28a induction；5-6, the SraP of purifying_L-Lectin-HisRecombinant protein；7, SraP_{L-Lectin&β-GF-His}Whole bacterial protein after-pET28a induction；8, the SraP of purifying_{L-Lectin&β-GF-His}Recombinant protein.

Fig. 2 is the SDS-PAGE testing result figure of IgG purification antibody, M, marker；1, IgG antibody；

Fig. 3 is the enzyme-linked immunosorbent assay testing result figure of IgG monoclonal antibody；

Fig. 4 is the western blotting qualification result that IgG monoclonal antibody and the ligand binding domain SraP difference truncate type recombinant protein Figure, M, marker；

Fig. 5 knocks out USA300 bacterial strain using the method for homologous recombinationsraP _L-lectinGene constructed deletion mutant strain figure；

Fig. 6 cell experiment is the influence diagram that IgG monoclonal antibody infects S. aureus L-forms adherency and intrusion, as a result visible to work as antibody When final concentration reaches 100ng/mL, adherency and intrusion of the bacterium to cell can significantly reduce, effect is suitable with knock-out bacterial strain；Wherein A is cell surface adhesion bacterium relative percentage, and B is intracellular intrusion bacterium relative percentage ,-indicate asialo enzyme ,+ Indicate the NeuAc that sialidase removal cell surface is added;C is cell surface adhesion bacterium relative percentage, and D is intracellular Invade bacterium relative percentage.

Fig. 7 zoopery is the result figure of IgG monoclonal antibody animal vivo test, which gives in every mouse When 100ug antibody, the quantity of bacterium in mouse blood can be significantly reduced.

Specific embodiment

The preparation of 1 source of mouse monoclonal antibody IgG of embodiment and selective mechanisms

1) anti-SraP monoclonal antibody is prepared using hybridoma technology, the specific steps are as follows:

One, antigen (SraP is prepared_L-LectinRecombinant protein)

Construct SraP_L-LectinExpression plasmid: extracting staphylococcus aureus USA300 genome, extracts reagent according to DNA of bacteria Cassette method carries out, and expands SraP by following primer PCR_L-LectinBlock genetic fragment,

F (5 ' -3 '): CCGGATCCTTTGCGTCAGCAGCGACG；

R (5 ' -3 '): CACAAGCTTTATATTCGAATGTTCCAAATTGTAC；

It is added at its both endsBamHⅠWithHindⅢRestriction endonuclease sites.By gene fragment clone into pET28a expression vector In, construct pET28a-SraP_L-LectinRecombinant plasmid.Recombinant plasmid constructs successfully through double digestion and DNA sequencing identification.

Above-mentioned plasmid is converted into Escherichia coli BL-21 competent cell, screening positive transformant carries out prokaryotic expression, to table SDS-PAGE detection is carried out up to product, the recombinant protein of 30kDa is obtained, with SraP_L-LectinThe molecular size range of albumen is consistent, Purified with His affinity column (Amersham company of the U.S.) to destination protein, is obtained with His label SraP_L-LectinRecombinant protein is named as SraP_L-LectinAlbumen.See Fig. 1；

Construct the ligand binding domain SraP and its different truncation type (SraP_BR、 SraP_{L-lectin&β-GF} 、SraP_90-723aa) expression Plasmid；, method is as described above, primer sequence is as follows:

SraP_BR- F (5 ' -3 '): CCGGATCCTTTGCGTCAGCAGCGACG；

SraP_BR- R (5 ' -3 '): CACAAGCTTTTAATTTCTTGTTACTTCATATTTA；

SraP_{L-lectin&β-GF}- F (5 ' -3 '): CCGGATCCTTTGCGTCAGCAGCGACG；

SraP_{L-lectin&β-GF}- R (5 ' -3 '): CACAAGCTT TTACATCAGTAAAATAATATG；

SraP_90-723aa- F (5 ' -3 '): CCGGATCCGCTTCTGATGCACCATTA；

SraP_90-723aa- R (5 ' -3 '): CACAAGCTTTTAAATGTTTGTTGGTGTACC；

Recombinant plasmid constructs successfully through double digestion and DNA sequencing identification.

Above-mentioned plasmid is converted into Escherichia coli BL-21 competent cell, screening positive transformant carries out prokaryotic expression, to table SDS-PAGE detection, 55kDa, 40kDa, 72kDa recombinant protein obtained respectively, the molecule with expected albumen are carried out up to product Amount size is consistent, and is purified with His affinity column (Amersham company of the U.S.) to destination protein, obtains and marks with His The SraP of label_BR、 SraP_{L-lectin&β-GF}And SraP_90-723aaRecombinant protein, be named as SraP_BR、 SraP_{L-lectin&β-GF}With SraP_90-723aaAlbumen.See Fig. 2；

Two, anti-SraP is prepared_L-LectinHybridoma cell strain (all mouse myeloma SP2/0 for hybridoma technology are thin Born of the same parents system derives from pure lines BALB/c mouse):

Use SraP_L-LectinRecombinant protein is subcutaneously injected in mouse web portion as immunogene and carries out immunity inoculation, every time 100 μ g/ ML totally five times, carries out intraperitoneal booster immunization in last time immunity inoculation first three days.The fusion same day takes mouse spleen, uses RPMI-1640 incomplete culture medium (GIBCO company of the U.S.) is prepared into single cell suspension, in 50% PEG(pH 8.0) in the presence of, Splenocyte and SP2/0 murine myeloma cell are merged, with HAT selective medium (RPMI-1640 culture medium 98mL, HT stores liquid 1mL, and A stores liquid 1mL) culture 7 days, use HT culture medium (RPMI-1640 culture medium 99mL, HT 1mL) culture instead.

Three, anti-SraP_L-LectinThe screening of positive monoclonal antibody

It is detected and is screened according to Growth of Hybridoma Cell situation row routine ELISA, take the cell cloning again for detecting positive hole, warp 5 time clonings are crossed, are all anti-SraP to monoclonal cell detection in all holes_L-LectinAfter the positive, access hole expands culture simultaneously Part freezes.The final hybridoma for choosing the anti-SraP antibody of 1 plant of stably excreting, is respectively designated as SraP-001.

Four, the subtype identification of monoclonal antibody

The hypotype of antibody is carried out with the monoclonal antibody subtype identification kit (ISO-2KT) of Sigma Co., USA, as the result is shown Anti- SraP_L-LectinThe hypotype of antibody SraP-001 is IgG1.

Five, the mass propgation of monoclonal antibody and purifying

With the dedicated serum free medium of hybridoma (Hybridoma, Gibico) mass propgation hybridoma cell strain.It is collected after 5 days Culture supernatant is dispensed, -70 DEG C with Protein G affinity column (Amersham company of the U.S.) antibody purification after measuring concentration It freezes.Antibody purity reaches 95% or more to purification result as shown in Figure 3.

2) the functional activity identification of anti-SraP monoclonal antibody IgG

One, ELISA

With enzyme-linked immunosorbent assay to IgG and SraP_L-lectinThe combination of albumen is identified.Method particularly includes: use coating buffer (0.1M carbonate buffer solution, pH9.6) dilutes SraP_L-lectinAlbumen is coated with 96 orifice plate of ELISA to 2 μ g/mL, and every hole is added 100 μ L, 4 DEG C overnight；PBST(PBS contains 0.5% Tween20) closing of 5% skim milk-washing buffer, 37 DEG C of incubation 2h；PBST After washing 5 times, be added 100 μ L IgG(2 μ g/mL initial concentrations in each hole, 15 concentration gradients dilutions) 4 DEG C overnight；With 1: 4000 diluted 100 holes μ L/ of sheep anti mouse secondary antibody (Beijing Zhong Shan company) are added in hole, 37 DEG C of incubation 1h；Peroxidase bottom 100 hole μ L/ of object developing solution, uses 2M sulfuric acid stopped reaction at room temperature after 15 minutes, upper machine testing colorimetric uses 450 nm/ of dual wavelength 690 nm.As a result see that Fig. 4 is shown: the monoclonal antibody of purifying antibody titer with higher.

Two, WB

To SraP_L-lectinCarry out western blotting qualification.Method particularly includes: with the e. coli strains of expression of other proteins be feminine gender Control, respectively by SraP_L-lectin、SraP_BR、 SraP_{L-lectin&β-GF}And SraP_90-723aaRecombinant protein expresses bacteria lysis supernatant It carries out 10%SDS-PAGE electrophoresis and electricity is gone on nitrocellulose membrane, by this film and 2 μ g/mL SraP_L-lectinBe incubated at room temperature 1h, 1: 2000 diluted sheep anti-mouse igg secondary antibodies (Beijing Zhong Shan company) and ECL luminescence reagent box (Pierce company of the U.S.) are exposed to solidifying Glue imaging system (Bio-Rad company).As a result as shown in Figure 5: IgG antibody truncation type different from what it is containing L-Lectin block SraP recombinant protein have specific binding.

Three, test cell line

Cell (A will be tested₅₄₉) cultivate in the DMEM (Dulbecco ' s for containing 10% calf serum (FBS) and 1% antibiotic (P/S) Modified Eagle Medium) in culture medium, cultivated under 37 DEG C of 5% carbon dioxide conditions.A549 cell 5 × 10⁴/ hole connects Kind is in 24 orifice plates, in 37 DEG C of DEG C of cultures to A₅₄₉Cell is paved with bottom hole, and PBS is washed cell 3 times；It is added final concentration of 100 The anti-SraP IgG antibody of the purifying of ng/mL, 50 ng/mL is incubated for 2 h in 37 DEG C in advance, and S. aureus L-forms USA300 is cultivated to logarithm Growth period, about 1 × 109 CFU/mL are added 2 × 10 with the every hole of DMEM culture solution dilution bacterium⁷A cell is incubated for 1 in 37 DEG C altogether hr.5 times are washed to remove nonadherent bacterium with PBS again after removal culture medium.Disappeared with 200 μ L trypsase (2.5mg/mL) Change 5 min of cell to cell all digest, then plus 400 μ L lysate (PBST) lytic cells, be eventually adding PBST polishing To l mL.It dilutes certain multiple and applies TSA plate count.

Intrusion is tested: bacterium is after 37 DEG C of 1 hr of incubation, with the gentamicin (14 μ g/mL) of the fresh configuration of DMEM Continue to be incubated for 1 hr to kill extracellular bacterium.5 times are washed to remove nonadherent bacterium with PBS again after removal culture medium. It is all digested with 200 μ L trypsase (2.5 mg/mL) vitellophag 5min to cell, then plus 400 μ L lysates (PBST) lytic cell, last polishing to l mL.It dilutes certain multiple and applies TSA plate count.In triplicate, every hole is at least for experiment More than in triplicate.As a result as shown in Figure 6: the anti-SraP monoclonal antibody IgG incubated cell of 50 ng/mL of final concentration, bacterium pair The adherency of host cell and infiltration capability decline 40% or so, 100 ng/mL anti-SraPL-Lectin monoclonal of final concentration is anti- Body incubated cell, bacterium is to the adherency of host and 50% or more infiltration capability decline.

Four, animal passive immunity is tested

Experiment the previous day, 4 ~ 5 week old Balb/c mouse (100 μ g/ are only) intraperitoneal injection IgG monoclonal antibody, control group injection Isometric PBS.S. aureus L-forms USA300 was cultivated to logarithmic growth phase, about 1 × 10 in second day⁹CFU/mL is washed with sterile PBS It washs 3 times, dilutes 10 times, every mouse peritoneal injects 100 μ L.Two days later, it plucks eyeball and takes blood, coated plate counts gold in blood and kidney Portugal bacterium clones number.Every group of 4 ~ 6 mouse, are repeated 2 times.As a result see Fig. 7, IgG monoclonal antibody can protect animal to reduce blood The infection quantity of middle S. aureus L-forms.

The experiment shows that IgG monoclonal antibody provided by the invention has the function of good control bacterium infection, can be with Applied to preparing bacterial-infection resisting therapeutic agent.

Sequence table

<110>Chinese People's Liberation Army Medical Research Institute Of Nanjing Military Region

<120>IgG antibody and application of anti-Staphylococcus aureus richness serine repetitive proteins SraP

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 111

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 1

Asp Ile Val Met Thr Gln Ser His Lys Val Met Ser Thr Ser Val Gly

1 5 10 15

Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Ser Thr Asp Val Ala

20 25 30

Val Ala Trp His Gln Gln Lys Pro Gly Gln Ser Pro Lys Pro Leu Ile

35 40 45

Tyr Ser Ala Ser Tyr Gln Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala

65 70 75 80

Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln His Thr Asp Tyr Ser Ile

85 90 95

Pro Val Ala Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 2

<211> 118

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 2

Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Ser Arg Asp Phe Tyr Phe

20 25 30

Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Ser Ser Pro Asp Lys Ile Asn Tyr Met Pro Ser Leu

50 55 60

Lys Asp Lys Phe Ile Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Lys Val Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Pro Asp Phe Tyr Tyr Ala Met Asp Phe Trp Gly Gln Gly Thr

100 105 110

Ser Val Thr Val Ser Ser

115

<210> 3

<211> 333

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

gacattgtga tgacccagtc tcacaaagtc atgtccacat cagtaggaga cagggtcagc 60

atcacctgca aggccagtca gagtactgat gtggctgtag cctggcatca acagaaacca 120

ggacaatctc ctaaaccact gatttactcg gcatcctacc agtacactgg agtccctgat 180

cgcttcactg gcagtggatc tgggacggat ttcactttca ccatcagcag tgtgcaggct 240

gaagacctgg cagtttatta ctgtcagcaa catactgatt acagtattcc ggtggcttgg 300

acgttcggtg gaggcaccaa gctggaaatc aaa 333

<210> 4

<211> 354

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

gaggtgaagc ttctcgagtc tggaggtggc ctggtgcagc ctggaggatc cctgaaactc 60

tcctgtgcag cctcaggaag tagagatttt tacttctgga tgagttgggt ccggcaggct 120

ccagggaaag ggctagaatg gattggagaa attaatagca gtccagataa gataaactat 180

atgccatctc taaaggataa attcatcatc tccagagaca acgccaaaaa tacgctgtac 240

ctgcaaatga gcaaagtgag atctgaggac acagcccttt attactgtgc aagacctgat 300

ttttactacg ctatggactt ctggggtcaa ggaacctcag tcaccgtctc ctca 354

<210> 5

<211> 106

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 5

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

1 5 10 15

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

20 25 30

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

35 40 45

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

50 55 60

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

65 70 75 80

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

85 90 95

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

100 105

<210> 6

<211> 324

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 6

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro

195 200 205

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln

210 215 220

Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val

225 230 235 240

Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val

245 250 255

Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln

260 265 270

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn

275 280 285

Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val

290 295 300

Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His

305 310 315 320

Ser Pro Gly Lys

<210> 7

<211> 318

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

gcagatgctg caccaactgt atccatcttc ccaccatcca gtgagcagtt aacatctgga 60

ggtgcctcag tcgtgtgctt cttgaacaac ttctacccca aagacatcaa tgtcaagtgg 120

aagattgatg gcagtgaacg acaaaatggc gtcctgaaca gttggactga tcaggacagc 180

aaagacagca cctacagcat gagcagcacc ctcacgttga ccaaggacga gtatgaacga 240

cataacagct atacctgtga ggccactcac aagacatcaa cttcacccat tgtcaagagc 300

ttcaacagga atgagtgt 318

<210> 8

<211> 972

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

gccaaaacga cacccccatc tgtctatcca ctggcccctg gatctgctgc ccaaactaac 60

tccatggtga ccctgggatg cctggtcaag ggctatttcc ctgagccagt gacagtgacc 120

tggaactctg gatccctgtc cagcggtgtg cacaccttcc cagctgtcct gcagtctgac 180

ctctacactc tgagcagctc agtgactgtc ccctccagca cctggcccag cgagaccgtc 240

acctgcaacg ttgcccaccc ggccagcagc accaaggtgg acaagaaaat tgtgcccagg 300

gattgtggtt gtaagccttg catatgtaca gtcccagaag tatcatctgt cttcatcttc 360

cccccaaagc ccaaggatgt gctcaccatt actctgactc ctaaggtcac gtgtgttgtg 420

gtagacatca gcaaggatga tcccgaggtc cagttcagct ggtttgtaga tgatgtggag 480

gtgcacacag ctcagacgca accccgggag gagcagttca acagcacttt ccgctcagtc 540

agtgaacttc ccatcatgca ccaggactgg ctcaatggca aggagttcaa atgcagggtc 600

aacagtgcag ctttccctgc ccccatcgag aaaaccatct ccaaaaccaa aggcagaccg 660

aaggctccac aggtgtacac cattccacct cccaaggagc agatggccaa ggataaagtc 720

agtctgacct gcatgataac agacttcttc cctgaagaca ttactgtgga gtggcagtgg 780

aatgggcagc cagcggagaa ctacaagaac actcagccca tcatggacac agatggctct 840

tacttcgtct acagcaagct caatgtgcag aagagcaact gggaggcagg aaatactttc 900

acctgctctg tgttacatga gggcctgcac aaccaccata ctgagaagag cctctcccac 960

tctcctggta aa 972

<210> 9

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

ccggatcctt tgcgtcagca gcgacg 26

<210> 10

<211> 34

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

cacaagcttt taatttcttg ttacttcata ttta 34

<210> 11

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

ccggatcctt tgcgtcagca gcgacg 26

<210> 12

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

cacaagcttt tacatcagta aaataatatg 30

<210> 13

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

ccggatccgc ttctgatgca ccatta 26

<210> 14

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

cacaagcttt taaatgtttg ttggtgtacc 30

<210> 15

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

ccggatcctt tgcgtcagca gcgacg 26

<210> 16

<211> 34

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

cacaagcttt atattcgaat gttccaaatt gtac 34

Claims

1. the IgG antibody of anti-Staphylococcus aureus richness serine repetitive proteins SraP, it is characterised in that including light chain L and heavy chain The amino acid sequence of the variable region H, the light chain L is as shown in SEQ ID NO.1, the variable region amino acid sequence such as SEQ of heavy chain H Shown in ID NO.2.

2. encoding the nucleic acid sequence of the IgG antibody of anti-Staphylococcus aureus richness serine repetitive proteins SraP described in claim 1 Column, it is characterised in that the nucleic acid sequence of the coding variable region light chain L is as shown in SEQ ID NO.3, the nucleic acid of the variable region encoding heavy chain H Sequence is as shown in SEQ ID NO.4.

3. the IgG antibody of anti-Staphylococcus aureus richness serine repetitive proteins SraP, feature exist according to claim 1 In light chain L constant region amino acid sequence as shown in SEQ ID NO.5, the amino acid constant region sequence of heavy chain H such as SEQ ID Shown in NO.6.

4. encoding the nucleic acid sequence of the IgG antibody of anti-Staphylococcus aureus richness serine repetitive proteins SraP described in claim 3 Column, it is characterised in that the nucleic acid sequence of coding light chain L constant region is as shown in SEQ ID NO.7, the nucleic acid of encoding heavy chain H constant region Sequence is as shown in SEQ ID NO.8.

5. the IgG antibody of the anti-Staphylococcus aureus richness serine repetitive proteins SraP of claim 1 or 3 is treated in preparation Application in S. aureus L-forms infection medicine.