CN109182475A

CN109182475A - P15 based on pyrosequencing techniquesINK4bThe method of promoter zone methylation degree quantitative detection

Info

Publication number: CN109182475A
Application number: CN201811064529.4A
Authority: CN
Inventors: 黄映辉; 马羚
Original assignee: Individual
Current assignee: Individual
Priority date: 2018-09-12
Filing date: 2018-09-12
Publication date: 2019-01-11

Abstract

The invention discloses the p15 based on pyrosequencing techniques^INK4bThe method of promoter zone methylation degree quantitative detection.It is required detection primer that the primer, which includes from upstream and downstream amplimer needed for augmentation detection segment in sample and progress pyrosequencing,.The invention further relates to detect p15 using pyrosequencing techniques^INK4bThe method and kit of promoter zone methylation degree.Disclosed primer, method and kit through the invention, can detecte out anti-oncogene p15 in genomic DNA sample^INK4bPromoter zone methylation degree has safety and stability, quantitative accurate, the high feature of susceptibility.

Description

P15 based on pyrosequencing techniquesINK4bPromoter zone methylation degree quantitative detection Method

Technical field

The invention belongs to life sciences and field of biotechnology, and in particular to a kind of tumor suppressor gene, that is, p15^INK4bGene promoter The quantitative detection of sub- specific position methylation.

Background technique

p15^INK4bGene is a kind of important tumor suppressor gene, and the albumen of coding is CDKs (cycline dependent Kinase cell cycle dependent kinase) important member in family, can specificity inhibit CDK4, CDK6 kinase activity, resistance The only product Rb protein phosphorylation of Rb (retinoblastoma retinoblastoma cell oncogene).In proliferation process, phosphorus The Rb of acidification can discharge transcription factor E2F to start the transcription of the cell proliferation genes such as archaeal dna polymerase, adenosine kinase and final Cell is caused to enter the S phase.Due to p15^INK4bThe albumen of genetic transcription inhibits Rb phosphorylation, and transcription factor can not discharge and play work With so p15^INK4bThe growing multiplication of gene pairs cell plays the role of negative regulation.p15^INK4bThe inactivation of gene will lead to carefully The abnormality proliferation of born of the same parents promotes the generation of tumour.For studies have shown that in tumour cell, there are about 80% p15INK4b genes to be in Inactivated state.p15^INK4bGene coded sequence overall length about 460kb is positioned on No. 9 the short arm of a chromosome (9p21), which contains Two exons, at gene promoter (chr9:22008659-22009472) there are an islands CpG (CpG91).Normal thin In born of the same parents, this is located at p15^INK4bThere is no methylations on the gene promoter island Chu CpG, and in tumour cell, often send out This existing island CpG is in high methylation state, so as to cause p15^INK4bThe expression silencing of gene.

DNA methylation is a kind of important epigenetics modification, its generation is usually urging by dnmt rna Change, s-adenosylmethionine provides methyl group, and the cytimidine in DNA is catalyzed as 5-methylcytosine (5-mC).DNA methylation Usually occur on CpG dinucleotides.In genome, CpG, which tends into a small bundle of straw, etc. for silkworms to spin cocoons on, to be existed, and these are rich in position, that is, quilt of CpG The referred to as island CpG.The methylation on the island CpG of promoter region and the active degree of gene expression are closely related, this is because The island CpG of methylation can recruit the methylation binding protein such as MeCP2, and then form gene silencing compound, occupy in gene Promoter position prevents transcription factor in combination.Currently, the island the CpG methylation of gene promoter region is defined as The mechanism of the third expression of tumor suppressor gene inactivation in addition to homozygous deletion and gene mutation.The study found that in tumour cell p15^INK4bThe inactivation of gene is mainly due to the island its promoter region CpG is in hyper-methylation state, this is but also p15^INK4bGene opens The methylation of mover can carry out the early diagnosis of tumour for doctor and screening provides guidance.

The detection means of gene methylation mainly has MSP (methylation status of PTEN promoter), MeDIP (methylation-specific at present Co-immunoprecipitation) and bisulfite sequencing PCR (BSP), wherein MSP method relatively easy is wanted instrument condition because it is operated It asks less and has obtained most common application, but change method only can qualitatively detect methylation.And but other two Not only operation difficulty is larger and can only carry out semi-quantitative analysis to the methylation of specific site for kind method.The present invention takes Be the method for pyrosequencing to p15^INK4bThe methylation on the island CpG is analyzed at gene promoter, and this method can be with The methylation for detecting the site every CpG in target fragment of accurate quantitative analysis.Currently, pyrosequencing has been considered as first The goldstandard of baseization detection.The central principle of pyrosequencing be by single nucleotide in conjunction with template strand after the burnt phosphorus that discharges Acid causes enzyme cascade and then promotes fluorescein luminescence, and machine is by capturing fluorescence signal come this position on judge templet chain Setting is any nucleotide.And the power of signal has also directly corresponded to the methylation state in the site.This method precise and high efficiency, And be suitable for detecting while multisample, it is p15 in detection patient gene's group^INK4bThe promising approach of gene methylation degree.

Summary of the invention

The purpose of the present invention is to provide a kind of detection p15^INK4bThe method of gene promoter CpG methylation, including 5 ' ends of upstream specificity amplification primer, downstream specificity amplification primer, middle and lower reaches specificity amplification primer have biotin Label and sequencing primer, base sequence are as follows:

F:GGGGAGTTAGTAGGTAAAGAATTT

R:ACATTCCCAAAATATTAACCTTAACT

S:GTTTTTTTATTTTTTTAGGT

The present invention provides a whole set of to detect p15^INK4bThe process of gene promoter CpG methylation, including walk as follows It is rapid:

(1) sample gene group DNA is extracted；

(2) sulphite processing is carried out to the genomic DNA that purification obtains；

(3) it is expanded, is expanded using the DNA that the specificity amplification primer handles purification and recovery sulphite Program are as follows: activation: 95 DEG C of 15min；Amplification: 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 30s carry out 47 circulations altogether；Prolong eventually It stretches: 72 DEG C of 10min.

(4) take out 5 μ l amplified productions carry out agarose electrophoresis detection, according to product band whether naked eyes it is visible and whether Judge whether amplification succeeds between the slug band of 200 and 300bp, and according to whether having under 100bp slug band Band is to determine whether there is primer dimer；

(5) for expand successfully and the sample without obvious primer dimer, using sequencing primer pair residue amplified production into Row pyrosequencing；

(6) it is analyzed according to software and obtains p15^INK4bThe methylation journey in the site CG detected in CpG island (CpG91) Degree.

The present invention is directed in the p15INK4b CpG island (CpG91) of the position chr9:22008659-22009472 Target fragment as shown in Fig. 1 devises amplimer, expanding fragment length 256bp, and devises matched pyrophosphoric acid Detection primer.

The present invention devises a for detecting p15^INK4bThe kit of gene promoter methylation degree, which includes Thermal starting polymerase (Hotstart Taq), dNTPs, PCR buffer (Tris-HCL), ddH₂O、MgCl₂And detection p15^INK4bThe amplimer and detection primer of gene promoter methylation degree.

Detailed description of the invention:

Fig. 1 is this pyrophosphoric acid test experience target fragment detected.

Fig. 2 is to carry out the gel electrophoresis figure that pcr expands products therefrom to target fragment using amplimer.

The sequence information to be measured that Fig. 3 is inputted when being using pyrosequencing instrument.

Fig. 4 is the result figure of pyrosequencing.

Specific embodiment

The present invention is further explained combined with specific embodiments below.The condition and method for not doing specified otherwise in implementation, can According to the conventional practices of the field experimenter, or the step of suggesting according to manufacturer and condition.

Example 1: p15 in detection patient blood^INK4bThe primer of Gene Promoter CpG Island (CpG91) methylation and side Method

200 μ l of patient blood is collected, extracts wherein genomic DNA, used kit Biomed using column purification method The genomic DNA of DL101-01, proposition are detected by spectrophotometer, purity OD₂₆₀/OD₂₈₀It is judged to closing for 1.7~1.9 Lattice.The genomic DNA proposed is converted through overweight sodium hydrogensulfite, and genomic DNA amount used is 2 μ g.Conversion gained DNA is wherein 2 μ l carry out PCR amplification as template, using kit of the present invention, and amplification system is as shown in the table:

Hotstart	12.5μl
		PCR buffer (Tris-HCL) (100mM)	7μl
dNTPs	0.5μl
		Primer F	1μl
Primer R	1μl
		ddH₂O	1μl
Template DNA	2μl
		Total volume	25μl

Wherein the base sequence of amplimer is as follows:

F:GGGGAGTTAGTAGGTAAAGAATTT

R:ACATTCCCAAAATATTAACCTTAACT

There is biotin labeling at the end its middle and lower reaches specificity amplification primer 5`.

Amplification program is activation: 95 DEG C of 15min；Amplification: 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 30s carry out 47 altogether Circulation；Extend eventually: 72 DEG C of 10min.

5 μ l amplified productions are taken to carry out agarose gel electrophoresis detection, gum concentration 1.5%, voltage 120v, the time is 30min, Ago-Gel detect under ultraviolet photograph glue instrument, and testing result answers band as shown in Fig. 2 clear and position is correct, nothing Obvious primer dimer.

Remaining amplified production is mixed with Pyrosequencing primer, carries out pyrophosphoric acid according to Pyro Mark Q96 operation manual Sequencing.Sequencing primer base sequence is as follows:

S:GTTTTTTTATTTTTTTAGGT

As shown in Fig. 3, sequence to be measured is inputted in Pyro Mark Q96 corresponding software are as follows:

As shown in Fig. 4, after sequencing procedure, machine generates examining report, treat the methylation of location point into Row data collection and analysis.

Example 2: p15 in detection cell^INK4bThe primer and method of Gene Promoter CpG Island (CpG91) methylation

With 25cm²For culture bottle culture A549 cell, when cell it is long to 90% or more when outwell culture medium, use 2ml PBS washes away remaining culture medium, and 1ml pancreatin is added to digest, and 37 DEG C, 4min.Add in 1ml culture medium and digestion process and by cell from training Supporting piping and druming on bottle, into liquid, 1000g is centrifuged 5min and collects cell precipitation.Gained cell precipitation is according to TIANamp Genomic The operation of DNA Kit (TIANGEN) specification extracts genomic DNA and is detected by spectrophotometer, purity OD₂₆₀/OD₂₈₀ It is determined as qualification for 1.7~1.9.Remaining step is the same as example 1.

Claims

1. for detecting p15^INK4bGene Promoter CpG Island, that is, CpG91 methylation primer, which is characterized in that the middle amplification Its base sequence of primer are as follows:

F:GGGGAGTTAGTAGGTAAAGAATTT

R:ACATTCCCAAAATATTAACCTTAACT

Wherein the end of downstream primer (R) 5 ' carries out biotin labeling

And sequencing primer needed for carrying out pyrosequencing to amplification nucleic acid product obtained, base sequence are as follows: S: GTTTTTTTATTTTTTTAGGT。

2. primer as described in claim 1, which is characterized in that be suitable for following amplified reaction program:

One, it activates: 95 DEG C of 15min；

Two, expand: 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 30s carry out 47 circulations altogether；

Three, extend eventually: 72 DEG C of 10min.

3. detecting p15^INK4bThe method of Gene Promoter CpG Island (CpG91) methylation, it is characterised in that:

One, sample gene group DNA is extracted；

Two, sulphite processing is carried out to the genomic DNA that purification obtains, the 180 μ l weight that it is 3M that processing mode, which is by concentration, is sub- Metabisulfite solution mixes with the 20 μ l aqueous solutions containing 2 μ g DNA and is placed in 98 DEG C, 10min, and then 64 DEG C, 2.5 hours；

Three, the DNA handled purification and recovery sulphite is expanded, and the primer is as described in claim 1, expands journey Sequence is as claimed in claim 2；

Four, 5 μ l amplified productions are taken out and carries out agarose electrophoresis detection, whether naked eyes are visible and be located at according to product band Judge whether amplification succeeds between the slug band of 200 and 300bp, and according to whether having band under 100bp slug band To determine whether there is primer dimer；

Five, for expanding successfully and the sample of primer free dimer, remaining amplified production is subjected to pyrosequencing, sequencing used Primer is as described in claim 1；

Six, according to experiment after PyroMark software export report obtain p15^INK4bIn Gene Promoter CpG Island (CpG91) The methylation in the site CG detected.

4. one kind is comprising for detecting p15^INK4bThe kit of primer needed for gene promoter methylation degree.

5. kit as claimed in claim 4, it is characterised in that: further include 250units thermal starting polymerase, 200 μ l concentration For 10mMdNTPs, 2ml buffer solution, 1.5mldd H₂O, 1ml concentration is the MgCl of 15mM₂One of or it is a variety of.