CN109136241A - A kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody - Google Patents

A kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody Download PDF

Info

Publication number
CN109136241A
CN109136241A CN201811046531.9A CN201811046531A CN109136241A CN 109136241 A CN109136241 A CN 109136241A CN 201811046531 A CN201811046531 A CN 201811046531A CN 109136241 A CN109136241 A CN 109136241A
Authority
CN
China
Prior art keywords
cell
pgex
plasmid
mouse
purifying
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811046531.9A
Other languages
Chinese (zh)
Inventor
陆桂丽
黄炯
苗书魁
马文戈
王杰
沙依兰·卡伊扎
王延
刘丽娅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xinjiang Academy Of Animal Sciences Veterinary Research Institute
Original Assignee
Xinjiang Academy Of Animal Sciences Veterinary Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xinjiang Academy Of Animal Sciences Veterinary Research Institute filed Critical Xinjiang Academy Of Animal Sciences Veterinary Research Institute
Priority to CN201811046531.9A priority Critical patent/CN109136241A/en
Publication of CN109136241A publication Critical patent/CN109136241A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1027Paramyxoviridae, e.g. respiratory syncytial virus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18411Morbillivirus, e.g. Measles virus, canine distemper
    • C12N2760/18422New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pulmonology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses the preparation methods of a kind of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody, comprising the following steps: PPR virus V prokaryotic expression vector constructs pGEX -4T-V;Recombinate pGEX -4T-V protein SDS-PAGE and western-blot identification;PGEX -4T-V protein purifying and concentration mensuration;Recombination pGEX -4T-V protein is immunized mouse and prepares monoclonal antibody;The preparation of odd contradictive hydroperitoneum;The Peptide systhesis of one segment (known array) of peste des petits ruminants V gene prepares monoclonal antibody;Eukaryotic expression peste des petits ruminants V protein;Three plants of monoclonal antibody indirect immunofluorescences and antibody typing test etc..The present invention is that reliable technical guarantee and support are established in the diagnosis of peste des petits ruminants recombinant vaccine.

Description

A kind of preparation of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody Method
Technical field
The invention belongs to field of biotechnology, specifically, being related to a kind of peste des petits ruminants V protein protokaryon and eukaryon table It reaches, purify and the preparation method of monoclonal antibody.
Background technique
Peste des petits ruminants (PPR) is caused by Paramyxoviridae Morbillivirus PPR virus (PPRV) with hair Acute, the highly contagious disease that heat, stomatitis, diarrhea, pneumonia are characterized cause serious economic damage to animal husbandry It loses.The disease is classified as A class deadly infectious disease by OIE, and China is classified as I class animal epidemic.In July, 2007, China's Ali Area, Xizang PPR has been broken out for the first time.The Ministry of Agriculture discloses prevention and control PPR National Technical specification, prevention and control PPR emergency immediately Plan, and implement PPR monitoring strategies from 2008 in the whole nation.
China takes attenuated vaccine (Nigera75/1) to inoculate against PPR at present, and the immune effect of vaccine is preferable, but due to Difficulty is brought to the diagnosis and detection of disease with poison and toxin expelling.Live vaccine induction body has high compared with viral inactivation vaccine Strong phenomenon is returned with potential virulence, inactivated virus vaccine will be a safer substitute.Current commercialization not yet PPR inactivated vaccine, acne carrier bacterin etc., the also not correlative study about the preparation of PPRV albumen monoclonal antibody, but PPR vaccine research becomes To in gene engineering vaccine and inactivated vaccine.
V genetic fragment 924bp is expanded from PPR virus total serum IgE using existing RT-PCR technology (to mark for HA Label), it is cloned into pGEX-4T-1 carrier, prokaryotic expression PPRV albumen, purifying protein is prepared for V protein monoclonal antibody, for examining for PPR It is disconnected to provide technical support with prevention.
In the prior art, there are no the systems about a kind of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody The relevant report of Preparation Method.
Summary of the invention
The purpose of the present invention is to provide the systems of a kind of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody Preparation Method.
Itself the specific technical proposal is:
A kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody, comprising the following steps:
(1) design of primers of Nigera75/1 vaccine virus V gene:
According to NCBI serial number: X74443 downloads V gene sequence, 897bp.It is analyzed using DNAStar software, in design The restriction enzyme site of trip and downstream primer sequence.Upstream restriction enzyme site is EcoRI, and downstream restriction enzyme site is SmaI.Downstream primer adds HA label, HA sequence are as follows: TACCCATACGACGTCCCAGACTACGCT, HA label reverse transcription sequence: AGC GTA GTC TGG GAC GTC GTA TGG GTA。
According to 7 software design V gene primer of Oligo, upstream primer P1:
AACCGAATTCATGGCAGAAGAACAAGCATACCAT;Downstream primer adds HA label as follows,
P2:ATTTCCCGGGTTAAGCGTAGTCTGGGACGTCGTATGGGTAGGCTGAGTCAGTGATGC。
Mutant primer M1:
Mutant primer M2: Base in box is the catastrophe point of V gene.Primer is synthesized by Shanghai bioengineering Co., Ltd.
(2) extraction of Nigera75/1 vaccine virus (preservation of this laboratory) RNA:
TRIzol LS extraction method: extract is cell culture fluid poison, and when extraction, all goods used were without RNA enzyme.
1, virus stock solution used 250ul is added in the eppendorf pipe of 1.5ml, adds TRIzol LS 750ul, sufficiently It mixes, is placed at room temperature for 5min;
2, the chloroform of 200ul is added, covers tightly centrifuge tube lid, firmly shake centrifuge tube (solution is fully emulsified, at milky white shape, No phase separation phenomenon), it is placed at room temperature for 3min (due to chloroform low boiling point, volatile, centrifuge tube may pop when oscillation, careful);
3,4 DEG C, 12000r/min is centrifuged 15min, and upper phase is taken to move into another pipe (never inhaling dynamic white interphase);
4, isometric isopropanol is added, gently overturns centrifuge tube and mixes well liquid, be placed at room temperature for 10min;
5,4 DEG C, 12000r/min is centrifuged 10min, and all supernatants are carefully sucked with rifle;
6, plus 1ml75% ethyl alcohol is washed one time, and 4 DEG C, 8000r/min is centrifuged 10min, and all supernatants are carefully sucked with rifle, Drying at room temperature 5min;
7,25ul DEPC is added and handles water, carry out PT-PCR amplification immediately.
(3) RT-PCR amplification Nigera75/1 vaccine virus V gene
Template is done with the 2.5uLRNA solution of extraction, is loaded according to RT-PCR kit of precious biotech firm, is applied P1 and M2, P2 and M1 are that primer carries out RT-PCR amplification.Reaction system: 2 × Buffer 25uL, each 1uL of upstream and downstream primer, RNA template 2.5uL, enzyme 1uL, water 19.5uL, total system 50uL.Response procedures are as follows: 50 DEG C of 30min, 94 DEG C of 2min, 94 DEG C 45s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min.RT-PCR product is carried out with 1% agarose gel electrophoresis Analysis.The clip size of P1 and M2 primer amplification is 705bp, is named as N1;The clip size of P2 and M1 primer amplification is 220bp is named as N2.
(4) fusion DNA vaccine expands
Using P1 and P2 as primer, N1 and N2 are that template carries out PCR amplification.Reaction system: 10 × Buffer 5uL, upstream and downstream Primer each 0.35uL of each 1uL, template N1 and N2, Ex Taq enzyme 0.3uL, dNTP4uL, water 38uL, total system 50uL.Response procedures Are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min.With 1% agarose gel electrophoresis Carry out PCR product analysis.Target fragment V gene size 924bp.
(5) recycling of PCR product glue and purifying
Using the glue recovery purifying kit of Shanghai bioengineering Co., Ltd, the V gene of recycling and purifying PCR amplification.
(6) difference single endonuclease digestion V gene and -1 vector plasmid of pGEX -4T
30 DEG C of SmaI overnight -1 vector plasmid of digestion V gene and pGEX -4T (laboratory preservation), applies after recovery purifying 37 DEG C of single endonuclease digestion V genes of EcoRI and -1 vector plasmid of pGEX -4T.
(7) the V gene after double digestion and the recycling of -1 vector plasmid glue of pGEX -4T and purifying
Using the glue recovery purifying kit of Shanghai bioengineering Co., Ltd, recycle and purify above-mentioned (six) V gene and - 1 vector plasmid of pGEX -4T, -20 DEG C save backup.
(8) connection and conversion of -1 carrier of V gene and pGEX -4T (in DH5 α).
1, the V gene after double digestion and -1 vector plasmid of pGEX -4T are attached (16 DEG C overnight) and conversion.
2, connection product converts.
It is thin that whole connection products and -1 vector plasmid of 0.5uL pGEX -4T is added separately to 50uL E. coli competent Born of the same parents DH5 α (being purchased from Tiangeng company) crosses 4 μ L) in;After ice bath 30min, 42 DEG C of heat shock 90s, ice bath 2min;Add 900uL non-resistant LB culture medium shakes shaken cultivation 60min in 37 DEG C of shaking tables slowly;50-100uL is taken to be coated in containing ampicillin (100 μ after centrifugation G/mL on LB solid medium), 37 DEG C of inversion overnight incubations.
Bacillus coli DH 5 alpha/pGEX -4T -1 (Escherichia coli DH5 α/pGEX -4T -1) is preserved in Chinese Typical Representative Culture collection, deposit number are CCTCC NO.M2018400, and the deposit date is on June 26th, 2018.Preservation address Are as follows: No. 299 Wuhan Universitys of Wuhan City, Hubei Province Wuchang District Bayi Road are in the school.
(9) extraction and identification of recombinant plasmid pGEX -4T-V (in DH5 α)
1, the extraction of recombinant plasmid pGEX -4T-V
7 single colonies in picking agar plate are inoculated into the LB liquid medium containing ampicillin (100 μ g/mL) In, 37 DEG C are shaken bacterium overnight.Second day extraction plasmid, according to the plasmid extraction kit of Shanghai bioengineering Co., Ltd illustrate into The extraction of row recombinant plasmid pGEX -4T-V.Recombinant plasmid agarose gel electrophoresis, the swimming lane of Preliminary Identification 1 and 2 are positive restructuring matter Grain names plasmid 1 and plasmid 2 respectively.PCR and double digestion identification are carried out in next step.
2, recombinant plasmid pGEX -4T-V PCR is identified
PCR reaction system: 10 × Buffer 5uL, P1 and P2 each 1uL of upstream and downstream primer, template 0.5uL, Ex Taq enzyme 0.5uL, dNTP4uL, water 38uL, total system 50uL.Response procedures are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C 1min, 35 circulations, 72 DEG C of 10min.PCR product analysis is carried out with 1% agarose gel electrophoresis.We choose 1 He of plasmid Plasmid 2 is expanded, V genetic fragment size about 900bp or so, and amplification is correct;
3, recombinant plasmid pGEX -4T-V double digestion is identified
Plasmid 1 and plasmid 2 carry out double digestion identification respectively, and size is completed correct.
4, recombinant plasmid pGEX -4T-V is sequenced
Plasmid 1 and plasmid 2 serve the raw work in sea and carry out sequencing strain sequencing, and sequencing result is correct, overall length 924bp (V gene+ HA sequence), as follows:
ATGGCAGAAGAACAAGCATACCATGTCAACAAGGGACTGGAATGTATCAAGTCTCTCAAAGCCTCTC CCCCGGATCTATCCACCATCAAAGATGCCCTTGAGAGCTGGAGAGAGGGGCTTAGCCCCTCAGGCCG TGCAACAC CGAACCCTGATACGTCCGAGGGAGACCATCAGAATATCAACCAATCATGCTCACCAGCA ATCGGATCAGACAAAG TCGACATGTCTCCTGAAGATAATCTCGGATTTAGAGAGATCACTTGTAATGA CAGTGAGGCTGGGCTCGGAGGAG TTCTGGATAAAGGATCCAACTCTCAAGTACAGCGTTACTATGTT TATAGCCACGGGGGTGAAGAGATTGAAGGAC TCGAGGATGCTGACTCTCTCGTGGTTCAAGCAAAT CCTCCAGTTACTGACACCTTCAATGGAGGAGAGGATGGAT CTGACGACAGCGATGTGGACTCTGGC CCAGATGATCCCGGCAGAGATCCTCTATATGACCGGGGATCTGCTGCCG GCAATGATGTCTCTAGGTC AACAGATGTCGAAAAATTAGAAGGAGATGACATTCAAGAAGTTCTTAACTCCCAGA AGAGTAAAGG AGGAAGATTCCAAGGCGGGAAAATCTTGCGGGTCCCGGAAATACCCGATGTCAAGAACTCTAGACC ATCAGCCCAATCAATTAAAAAGGGGCACAGACGGGAACTCAGTCTTATCTGGAACGGTGACGGAGT GTTCATCGA TAAGTGGTGCAACCCAAGCTGTGCCAGAGTCCAAATGGGAGTCATCAGAGCGAAATG CGTCTGTGGGGAGTGTCC CCAAATCTGCGAGGGGTGCAAAGACGATCCAGGGGTTGACACAAGAAT CTGGTACCATAGCATCACTGACTCAGC CTACCCATACGACGTCCCAGACTACGCTTAA
(10) vector plasmid pGEX -4T -1 and positive recombinant plasmid pGEX -4T-V is transformed into the Escherichia coli impression of expression In state cell BL21 (DE3)
It converts, choose the specific method of bacterium, plasmid extraction before as described in (eight) and (nine).
(11) pGEX -4T-V protein SDS-PAGE identification is recombinated
Positive restructuring bacterium is inoculated into LB liquid medium of the 5mL containing ampicillin (100 μ g/mL) according to 1%, 37 DEG C, 250rpm/min shake bacterium stay overnight.In second day preservation strain to 50% glycerol, 10mL LB liquid is inoculated into according to 2% Culture medium shakes 2 hours of bacterium and surveys bacterium solution OD values between 0.6~0.8 plus 1mM/mLIPTG induction expression protein, add inducer it Before take 1mL bacterium solution to do negative control.It after inducing expression 4 hours, takes in bacterium solution to 10mL centrifuge tube, centrifugation discards supernatant, uses PBS It washed once.It is dissolved with the PBS of 2mL, ultrasonication, ultrasonic 4s, is spaced 5s, ultrasound 25 times.12000rpm/min centrifugation 10min, packing supernatant is dissolved with 500uLPBS to be precipitated.(PBS dissolution) is precipitated after taking induction and each 60ul of supernatant is dissolved in 4 times Sample-loading buffer in, while take induction after carrier precipitation and supernatant do negative control, 5min, loading 10ul are boiled in boiling water Carry out SDS-PAGE.
(12) western-blot identification
1 piece of glue carries out transferring film after SDS-PAGE, using pvdf membrane, shift liquid shift to an earlier date 2 hours and be put into -20 DEG C of preservations it is standby With.The glue taken out is rinsed with deionized water, is put into transfer liquid;6 layers of the filter paper bigger than protein adhesive is cut, is put into and turns In liquid relief;In the sponge to transfer liquid for impregnating black, then it is put into transferring film Cao;The filter paper of immersion is put on sponge;Protein adhesive is put On filter paper, it is immersed in film in methanol and is placed on glue;The other 3 layers of filter paper impregnated is placed on film;It drives extra bubble away, is put into The Black Sea impregnated is continuous;Overall clamping is put into transferring film Cao, is poured into transfer liquid and is put ice bag, and 100V 1 hour.
The film shifted is taken out, PBST is washed 3 times, each 3min;It is stayed overnight with 5% 4 DEG C of skimmed milk power closings;PBST Washing 3 times, adds monoclonal antibody (purchased from Shanghai bioengineering Co., Ltd) 1:150 of anti-HA label, and room temperature shaker is incubated for 2 hours; PBST is washed 3 times, adds the secondary antibody 1:2500 of anti-mouse, and room temperature shaker is incubated for 2 hours;PBST is washed 3 times, colour developing;Develop the color formula of liquid: 1ml deionized water, 0.01 gram of nickel chloride, the This-HCl of 9ml 20mMpH7.6,0.006 gram of DAB, 10ul30% hydrogen peroxide; Observation result is dried after colour developing.
(13) pGEX -4T-V protein purifying
Inducing expression 300mlpGEX -4T-V recombinant bacterium;Centrifugation, precipitating are washed 1 time with PBS;It is dissolved and is precipitated with 6mlPBS, Ultrasonic 4s is spaced 5s, ultrasound 30 times;12000rpm/min is centrifuged 15min, and supernatant 2ml/ pipe is dispensed into EP pipe;Use GE public affairs The GST gravity column of department to specifications the step of to carry out the albumen of purifying expression be that immune mouse is prepared.
(14) determination of protein concentration purified
Using the BCA method determination of protein concentration kit of Shanghai bioengineering Co., Ltd, the albumen for measuring purifying is dense Then Balb/c mouse is immunized in degree.
(15) mouse immune
The albumen 3.00mg/mL of purifying, is mixed in equal volume with 0.1mg/mL and Freund's complete adjuvant, selects 7 week old Balb/ 0.2mL is injected intraperitoneally in c female mice;It is (immune with incomplete Freund's adjuvant emulsification antigen booster immunization respectively in the 14th, 28d Position and method are exempted from head), dock in 42d and take a blood sample, separates serum;Antibody level detection is carried out with indirect ELISA method, it is right Immune effect is preferably and antibody titer measures higher mouse peritoneal and injects 0.1mL albumen, 45d is sterile take mouse boosting cell into Row fusion.
The preparation of (16) Nigero75/1 virus
Vero cell is saved by this laboratory.Expand the Vero cell of culture in 225cm2It is passed in cell bottle, together Step connects Nigero75/1 virus, 37 DEG C, saturated humidity, 5%CO according to 2%2It is cultivated in incubator.Observation cell state daily, Third day cytopathy is obvious, and multigelation 20 DEG C of preservations of rear ﹣ three times carry out viral concentration.
The venom 10000rpm centrifugation 30min of 500ml removes cell fragment;Centrifuge tube 6000rpm is concentrated by ultrafiltration with 100KD It is centrifuged 15min;V-type liquid in pipe is drawn, the liquid in centrifuge tube is abandoned it.It is centrifuged repeatedly repeatedly, the virus liquid being finally concentrated 100ml.The venom of concentration is dispensed into 2ml centrifuge tube, 70 DEG C of ﹣ freeze it is spare.
The foundation of (17) indirect ELISA monoclonal antibody selective mechanisms method
It is dense to determine that antigen (Nigero75/1 virus) is most preferably coated with using square matrix method for routinely indirect ELISA operating procedure Degree, antibody best effort concentration and betray and calibrate standard.According to the OD value of positive blood borehole cleaning close to 1.0, value < 0.2 negative serum OD, P/N > 2.1 are the positive, while setting up blank control and the control of SP2/0 supernatant.
The Nigero75/1 virus of purifying is as antigen coat, and be measured using square matrix test: virus is made of coating buffer 1:1,1:2,1:4,1:8 dilution, are added ELISA Plate, 100 holes μ L/, and flick or oscillating flat plate is so that Antigen distribution is uniform.It will Coated ELISA Plate is sealed with lid, and 4 DEG C overnight, discard liquid in elisa plate, and cleaning solution is added with multichannel pipettor, and (PBST is molten Liquid) 200 holes μ L/, 3min is slightly shaken at room temperature, is gently patted dry on cloth, and repeated washing is three times.It is closed with 5% skimmed milk power 250 hole μ L/ of liquid, 37 DEG C of closing 60min, same washing three times, pat dry.The extension rate of the mouse positive and negative serum is 1: 100,1:200,1:400,1:800,1:1600,1:3200 are added in ELISA Plate, 100 holes μ L/, while setting blank control, and 37 DEG C 45min is acted on, washing three times, pats dry.The diluted rabbit anti-mouse igg of 1:10000,100 holes μ L/ is added, 25 DEG C of effect 45min are washed It washs three times, pats dry.Add TMB developing solution, 100 holes μ L/, terminate liquid (2M H is added in 25 DEG C of effect 3-5min2SO4Solution), 100 μ OD450nm light absorption value is read in the hole L/ in microplate reader.With the OD value of positive blood borehole cleaning close to the antigen serum of 1.0, P/N > 2.1 Greatest dilution is as antigen and the most suitable working concentration of control serum.Finishing screen selects the Nigero75/1 virus conduct of purifying Antigen coat optium concentration is 1:8, antibody dilution 1:800.
(18) cell fusion
1, the preparation of feeder cells
1 day before fusion, select 1 cervical dislocation of Balb/c female mice of 7 week old lethal, 75% alcohol soaking disinfection 5 min, are fixed on shelf, move into super-clean bench, lift mouse part skin with tweezers, sterile abdominal cut skin (pays attention to not Peritonaeum can be damaged), peritonaeum is exposed sufficiently through tweezers removing.Basic culture solution 10mL injection is drawn with disposable sterilized injector Mouse peritoneal, the fixed syringe of the right hand remain stationary, and left hand clamps cotton ball soaked in alcohol with tweezers and gently rubs mouse web portion 2-3 Min, then be sucked out intraperitoneal culture solution (including macrophage) with syringe, it injects in sterilizing plates.Draw 20% training completely Nutrient solution 50mL (contain HAT), is added in 5 piece of 96 porocyte culture plates, 100 holes μ L/ with multichannel pipettor, 37 DEG C, saturated humidity, 5%CO2It is cultivated in incubator.Cell growth state is observed after 18-24h, cell is in pleomorphism, and it is adherent close, when refractivity is good It can use.
2, the preparation of SP2/0 cell
Myeloma SP2/0 cell returns purifying through 8-AG selection culture and Balb/c female mice abdominal cavity respectively.It is merging First 30 days or so, cell recovery, with the DMEM complete culture solution selection culture three generations of 8-AG (20 μ g/mL) or more is added, to protect Hold HGPRT-deficiency.The cell for taking growth conditions good to handle through 8-AG, centrifugation, PBS buffer solution washed once, and platform is expected Cell, is diluted to 10 by blue stain living cells numeration6A/mL, through incomplete Freund's adjuvant is injected intraperitoneally before being inoculated into one week The Balb/c female mice that (0.5mL/ is only) stimulated is intraperitoneal.Pay attention to observing mouse state, (one week when mouse peritoneal expands Left and right), aseptic collection ascites adjusts cell density, 37 DEG C, saturated humidity, 5%CO with complete culture solution2It is passed in incubator Culture, freezes spare.
3, the preparation of splenocyte
The Balb/c mouse of booster immunization is taken, eyeball excise bloodletting separates serum for positive antibody;Mouse cervical vertebra is taken off Mortar is put to death, 75% alcohol disinfecting 5min, is moved into superclean bench, is fixed on shelf, is cut off respectively with sterilizing scissors, tweezers Skin and film abdomen, sterile taking-up spleen put people and have filled clear Xian in the sterilized petri dishes of basic culture solution, remove the connective on envelope Tissue.Spleen is moved into the plate that another fills 10mL basic culture solution and 0.22um copper mesh, is existed with syringe needle tube Spleen to be ground on copper mesh, and splenocyte suspension in plate is transferred in 50mL centrifuge tube, piping and druming mixes 1000rpm and is centrifuged 5min, It is resuspended and is mixed with 10mL basic culture solution.
4, cell fusion
It merges according to a conventional method, immune mouse spleen cell is taken to mix with myeloma cell SP2/0 by cell quantity 5:1, be added In the sterile centrifugation tube of 50mL, 1000rpm is centrifuged 5min, and abandoning supernatant mixes well two kinds of cells with finger attack tube bottom, Until at paste;Centrifuge tube is placed in the beaker of 37 DEG C of water, draws the 50%PEG solution 1mL of 37 DEG C of preheatings in 45sec It being slowly dropped into, centrifuge tube is rotated in drop, static 1min is slowly dropped into 1 mL of basic culture solution of 37 DEG C of preheatings in 45sec, Centrifuge tube is rotated in drop, stands 15sec;Basic culture solution 2mL is instilled in 45sec, it is same to rotate centrifuge tube in drop;Then 4mL basic culture solution is added in 3min, finally adding basic culture solution and being gently agitated for centrifuge tube to 30mL keeps PEG thoroughly dilute It releases and loses fusion.800rpm is centrifuged 8min, abandons supernatant, and cell precipitation is gently suspended to 50mL containing 20% fetal calf serum In the HAT selection culture solution of preheating, it is uniformly mixed, is added to the 96 hole cell culture added with feeder cells with multichannel pipettor In plate, culture plate is moved to 37 DEG C, 5%CO by every 100 μ L of hole2, cultivate in saturated humidity incubator.
The screening of (19), positive hybridoma cell
Fused cell 5d replaces culture solution, using partly changing liquid mode.Culture solution used presses incubation time not It is same and different, HAT culture solution is used in fusion 10d;HT culture solution is used after 10d, is used after three time clonings common complete Culture solution.Hybridoma it is long to 15d when, i.e., desirable 100 μ L of cells and supernatant is coated indirectly with Nigero75/1 virus ELISA method carries out the detection of specific antibody, while making negative control with SP2/0 cell culture supernatant.
The clone of (20), hybridoma freezes and recovers
1, it clones and expands (limiting dilution assay)
The hybridoma colonies being detected as in the positive particular bore of secretion are blown afloat into mixing, cell Trypan Blue It counts, takes above-mentioned cell suspension, be diluted to 10/mL cell with the HT culture solution containing 20% fetal calf serum, it is thin by what is diluted 100 μ L of born of the same parents' suspension, which is added in 96 porocyte culture plates added with feeder cells in advance, to be cultivated.After clone under the 10th day microscope Observation monoclonal hole simultaneously marks.It is operated by 3 time cloningizations, until when all cloning cell hole Positive rates are 100%, It can determine the hybridoma cell strain for having obtained secrete monoclonal antibody.One plant of monoclonal antibody is filtered out, 3E6 is named as.
2, cell cryopreservation
By Cryopreservation of Hybridoma Cells before each cloning, the hybridoma cell strain of secrete monoclonal antibody has in addition been obtained 3E6's freezes.The good 3E6 cell centrifugation to be frozen of vigorous, form will be grown, with cells frozen storing liquid (containing 10%DMSO, 90% fetal calf serum) cell is adjusted to 3-5 × 106A/mL is added in 1.8mL cell cryopreservation tube, marks, and then will Cryopreservation tube is put into freezing storing box, in -70 DEG C of low temperature refrigerators overnight, in second day investment liquid nitrogen container, and is made a record.
3, cell recovery
A 3E6 cell cryopreservation tube is taken out at interval from liquid nitrogen container after one month, be put into the burning for filling 37 DEG C of water rapidly In cup, being kept stirred melts it rapidly, moves to superclean bench, and cell suspension is suspended in basis by sterile unlatching cryopreservation tube In culture solution, 1000rpm is centrifuged 5min washing, and cell precipitation is resuspended with 5mL complete culture solution, moves into Tissue Culture Flask, sets 5%CO2, 37 DEG C, cultivate in saturated humidity incubator.Whether verifying cell freezes.There is no problem for cell cryopreservation, raw after recovery Length is vigorous.
The preparation of (21), monoclonal antibody ascites
1 week before the hybridoma of inoculation secrete monoclonal antibody, 8 week old female BAl BIcs/every abdominal cavity of c mouse is first given Inject 0.5mL norphytane.The hybridoma of culture is rinsed from Tissue Culture Flask, 1000rpm is centrifuged 5min, then uses PBS buffer solution (PH7.2) suspended centrifugal washs 1 time, and Trypan Blue labors after cell count cell density number being adjusted to 2 × 106A/mL, every mouse peritoneal injects 0.5mL cell suspension, containing about 1 × 106A cell.Observation mouse shape is paid attention to after inoculation State is obviously expanded (7~12d) to mouse web portion, when handicapped, after sterilizing lower abdomen skin with cotton ball soaked in alcohol, can use No. 12 Syringe needle is pierced into abdominal cavity, it is seen that has ascites to ooze, is collected with sterile centrifugation tube, 4 DEG C stand overnight, and 5000rpm is centrifuged 5min, supernatant As ascites, packing, label, -70 DEG C of preservations;Interval 2-3 days takes, a mouse is general again after ascites regeneration accumulation with method It can extract 2-3 times.
Present invention test and the crucial difference of relevant report are exactly the peste des petits ruminants Nigero75/1 vaccine virus applied V protein.
Compared with prior art, the invention has the benefit that China takes attenuated vaccine (Nigera75/1) to connect at present Kind prevention PPR, the immune effect of vaccine is preferable, but due to bringing difficulty to the diagnosis and detection of disease with poison and toxin expelling.Epidemic disease living Seedling induction body has high and potential virulence to return strong phenomenon compared with viral inactivation vaccine, and inactivated virus vaccine will be one A safer substitute.The PPR inactivated vaccine, acne carrier bacterin etc. of current commercialization not yet, also not about PPRV albumen The correlative study of monoclonal antibody preparation, but PPR vaccine research is intended to gene engineering vaccine and inactivated vaccine.The present invention is peste des petits ruminants base Because reliable technical guarantee and support are established in the diagnosis of engineered vaccine.
Detailed description of the invention
Fig. 1 RT-PCR amplification Nigera75/1 vaccine virus V gene, wherein 1 and 3 be N1;2 and 4 be N2;Negative control; M is Marker 2000bp;
Fig. 2 fusion DNA vaccine expands Nigera75/1 vaccine virus V gene, wherein 1 to 5 swimming lane amplifies V gene;For feminine gender Control;M is Marker 2000bp;
Fig. 3 recombinant plasmid pGEX -4T-V agarose gel electrophoresis figure, wherein 1 and 2 swimming lanes are positive recombinant plasmid;M is Marker 15000bp;
Fig. 4 recombinant plasmid pGEX -4T-V PCR identification, wherein 1 and 2 swimming lanes are the V base that plasmid 4F21 and plasmid 2 expand Because of segment;M is Marker 15000bp;
Fig. 5 double digestion identifies plasmid 1 and plasmid 2;
Fig. 6 recombinates pGEX -4T-V protein SDS-PAGE identification, wherein 1 and 2 swimming lanes be respectively recombinate V protein precipitating and on Clearly;3 and 4 swimming lanes are respectively the precipitating and supernatant of carrier after inducing;M is rainbow Marker;
Fig. 7 recombinates pGEX -4T-V protein western-blot identification, wherein 1 and 2 swimming lanes are respectively carrier after inducing Supernatant precipitating;3 and 4 swimming lanes are respectively to recombinate V protein supernatant precipitating;M is rainbow Marker;
Fig. 8 recombinates the purifying of pGEX -4T-V protein, wherein 1 to 9 swimming lane is the albumen of purifying;M is rainbow Marker;
Fig. 9 RT-PCR amplification Nigera75/1 vaccine virus V gene, wherein 1 swimming lane is N1;2 and 3 swimming lanes are N3;M is Marker 2000bp;
Figure 10 fusion DNA vaccine expands Nigera75/1 vaccine virus V gene, wherein 1 and 2 swimming lanes amplify V gene;M is Marker 2000bp;
Figure 11 recombinant plasmid pFastBacTMDual-V agarose gel electrophoresis figure, wherein 7 and 10 swimming lanes are positive restructuring Plasmid, other swimming lanes are empty carrier plasmid;M is Marker 15000bp;
Figure 12 recombinant plasmid pFastBacTMDual-V PCR identification, wherein 1 and 2 swimming lanes are that plasmid 7 and plasmid 10 expand The V genetic fragment of increasing;3 swimming lanes are empty carrier;M is Marker 2000bp;
Figure 13 double digestion identifies recombinant plasmid pFastBacTMDual-V, wherein 1 swimming lane is pFastBacTMDual carrier Double digestion;Plasmid 7 and plasmid 10 expand V genetic fragment;M is Marker 15000bp;
Figure 14 M13 primer PCR identifies bacmid dna, wherein 1 to 8 swimming lane is restructuring rod granule;9 and 10 be carrier rod granule;M For Marker 15000bp;
Figure 15 P1 and B2 primer PCR identifies bacmid dna, wherein 1 to 8 swimming lane is restructuring rod granule;9 be carrier rod granule; M For Marker 2000bp;
Figure 16 transfection reagent box;
Figure 17 recombinant baculovirus expression V protein, wherein 1 and 2 swimming lanes are the precipitating of P3 generation poison respectively;3 swimming lanes are rod granule The precipitating of DNA vector transfection Sf9 cell;M is rainbow Marke;
Western-the blot of Figure 18 recombinant baculovirus expression V protein is identified, wherein 1 and 2 swimming lanes are P3 generation poison respectively Precipitating, 3 swimming lanes be bacmid dna carrier transfect Sf9 cell precipitating;M is rainbow Marker;
The indirect immunofluorescence assay of Figure 19 Sf9 cell expression V protein;
The indirect immunofluorescence assay of Figure 20 vero cell inoculation PPR virus Nigera75/1;
Tri- plants of antibody mab types of Figure 21.
Specific embodiment
Technical solution of the present invention is described in more detail in the following with reference to the drawings and specific embodiments.
The design of primers of 1 (one) Nigera75/1 vaccine virus V gene:
According to NCBI serial number: X74443 downloads V gene sequence, 897bp.It is analyzed using DNAStar software, in design The restriction enzyme site of trip and downstream primer sequence.Upstream restriction enzyme site is EcoRI, and downstream restriction enzyme site is SmaI.Downstream primer adds HA label, HA sequence are as follows: TACCCATACGACGTCCCAGACTACGCT, HA label reverse transcription sequence: AGC GTA GTC TGG GAC GTC GTA TGG GTA。
According to 7 software design V gene primer of Oligo, upstream primer P1:
AACCGAATTCATGGCAGAAGAACAAGCATACCAT;Downstream primer adds HA label as follows,
P2:ATTTCCCGGGTTAAGCGTAGTCTGGGACGTCGTATGGGTAGGCTGAGTCAGTGATGC。
Mutant primer M1:
Mutant primer M2: Base in box is the catastrophe point of V gene.Primer is synthesized by Shanghai bioengineering Co., Ltd.
(2) extraction of Nigera75/1 vaccine virus (preservation of this laboratory) RNA:
TRIzol LS extraction method: extract is cell culture fluid poison, and when extraction, all goods used were without RNA enzyme.
1, virus stock solution used 250ul is added in the eppendorf pipe of 1.5ml, adds TRIzol LS 750ul, sufficiently It mixes, is placed at room temperature for 5min;
2, the chloroform of 200ul is added, covers tightly centrifuge tube lid, firmly shake centrifuge tube (solution is fully emulsified, at milky white shape, No phase separation phenomenon), it is placed at room temperature for 3min (due to chloroform low boiling point, volatile, centrifuge tube may pop when oscillation, careful);
3,4 DEG C, 12000r/min is centrifuged 15min, and upper phase is taken to move into another pipe (never inhaling dynamic white interphase);
4, isometric isopropanol is added, gently overturns centrifuge tube and mixes well liquid, be placed at room temperature for 10min;
5,4 DEG C, 12000r/min is centrifuged 10min, and all supernatants are carefully sucked with rifle;
6, plus 1ml75% ethyl alcohol is washed one time, and 4 DEG C, 8000r/min is centrifuged 10min, and all supernatants are carefully sucked with rifle, Drying at room temperature 5min;
7,25ul DEPC is added and handles water, carry out PT-PCR amplification immediately.
(3) RT-PCR amplification Nigera75/1 vaccine virus V gene
Template is done with the 2.5uLRNA solution of extraction, is loaded according to RT-PCR kit of precious biotech firm, is applied P1 and M2, P2 and M1 are that primer carries out RT-PCR amplification.Reaction system: 2 × Buffer 25uL, each 1uL of upstream and downstream primer, RNA template 2.5uL, enzyme 1uL, water 19.5uL, total system 50uL.Response procedures are as follows: 50 DEG C of 30min, 94 DEG C of 2min, 94 DEG C 45s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min.RT-PCR product is carried out with 1% agarose gel electrophoresis Analysis.The clip size of P1 and M2 primer amplification is 705bp, is named as N1;The clip size of P2 and M1 primer amplification is 220bp is named as N2.As shown in Figure 1, correctly expanding N1 and N2.
(4) fusion DNA vaccine expands
Using P1 and P2 as primer, N1 and N2 are that template carries out PCR amplification.Reaction system: 10 × Buffer 5uL, upstream and downstream Primer each 0.35uL of each 1uL, template N1 and N2, Ex Taq enzyme 0.3uL, dNTP4uL, water 38uL, total system 50uL.Response procedures Are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min.With 1% agarose gel electrophoresis Carry out PCR product analysis.Target fragment V gene size 924bp, amplification is correct, as shown in Figure 2.
(5) recycling of PCR product glue and purifying
Using the glue recovery purifying kit of Shanghai bioengineering Co., Ltd, the V gene of recycling and purifying PCR amplification.
(6) difference single endonuclease digestion V gene and -1 vector plasmid of pGEX -4T
30 DEG C of SmaI overnight -1 vector plasmid of digestion V gene and pGEX -4T (laboratory preservation), it is shown in Table 1.EcoR I 37 DEG C -1 vector plasmid of 3 hours digestion V genes and pGEX -4T, is shown in Table 2.
Table 1:SmaI single endonuclease digestion
Table 2:EcoR I single endonuclease digestion
(7) the V gene after double digestion and the recycling of -1 vector plasmid glue of pGEX -4T and purifying
V gene using the glue recovery purifying kit of Shanghai bioengineering Co., Ltd, after recycling and purifying double digestion With -1 vector plasmid of pGEX -4T, -20 DEG C are saved backup.
(8) connection and conversion of -1 carrier of V gene and pGEX -4T (in DH5 α).
1, the V gene after double digestion and -1 vector plasmid of pGEX -4T are attached (16 DEG C overnight) and conversion, are shown in Table 3.
Table 3: target fragment is connected with carrier
2, connection product converts.
It is thin that whole connection products and -1 vector plasmid of 0.5uL pGEX -4T is added separately to 50uL E. coli competent Born of the same parents DH5 α (being purchased from Tiangeng company) crosses 4 μ L) in;After ice bath 30min, 42 DEG C of heat shock 90s, ice bath 2min;Add 900uL non-resistant LB culture medium shakes shaken cultivation 60min in 37 DEG C of shaking tables slowly;50-100uL is taken to be coated in containing ampicillin (100 μ after centrifugation G/mL on LB solid medium), 37 DEG C of inversion overnight incubations.
(9) extraction and identification of recombinant plasmid pGEX -4T-V (in DH5 α)
1, the extraction and identification of recombinant plasmid pGEX -4T-V
7 single colonies in picking agar plate are inoculated into the LB liquid medium containing ampicillin (100 μ g/mL) In, 37 DEG C are shaken bacterium overnight.Second day extraction plasmid, according to the plasmid extraction kit of Shanghai bioengineering Co., Ltd illustrate into The extraction of row recombinant plasmid pGEX -4T-V.Recombinant plasmid agarose gel electrophoresis figure is shown in that Fig. 3, the swimming lane of Preliminary Identification 1 and 2 are sun Property recombinant plasmid, name plasmid 1 and plasmid 2 respectively.PCR and double digestion identification are carried out in next step.
2, recombinant plasmid pGEX -4T-V PCR is identified
PCR reaction system: 10 × Buffer 5uL, P1 and P2 each 1uL of upstream and downstream primer, template 0.5uL, Ex Taq enzyme 0.5uL, dNTP4uL, water 38uL, total system 50uL.Response procedures are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C 1min, 35 circulations, 72 DEG C of 10min.PCR product analysis is carried out with 1% agarose gel electrophoresis.We choose 1 He of plasmid Plasmid 2 is expanded, V genetic fragment size about 900bp or so, and amplification is correct, as shown in Figure 4.
3, recombinant plasmid pGEX -4T-V double digestion is identified
Plasmid 1 and plasmid 2 carry out double digestion identification respectively, and size is completed correct.Specific digestion program is shown in Table 4, digestion knot Fruit sees Fig. 5.
Table 4: double digestion identification
37 DEG C 3 hours
10×H Buffer 1uL
Plasmid 2uL
EcoR I enzyme 1uL
SmaI enzyme 1uL
H2O 5uL
It amounts to 10uL
4, recombinant plasmid pGEX -4T-V is sequenced
Plasmid 1 and plasmid 2 serve the raw work in sea and carry out sequencing strain sequencing, and sequencing result is correct, overall length 924bp (V gene+ HA sequence), as follows:
ATGGCAGAAGAACAAGCATACCATGTCAACAAGGGACTGGAATGTATCAAGTCTCTCAAAGCCTCTC CCCCGGATCTATCCACCATCAAAGATGCCCTTGAGAGCTGGAGAGAGGGGCTTAGCCCCTCAGGCCG TGCAACAC CGAACCCTGATACGTCCGAGGGAGACCATCAGAATATCAACCAATCATGCTCACCAGCA ATCGGATCAGACAAAG TCGACATGTCTCCTGAAGATAATCTCGGATTTAGAGAGATCACTTGTAATGA CAGTGAGGCTGGGCTCGGAGGAG TTCTGGATAAAGGATCCAACTCTCAAGTACAGCGTTACTATGTT TATAGCCACGGGGGTGAAGAGATTGAAGGAC TCGAGGATGCTGACTCTCTCGTGGTTCAAGCAAAT CCTCCAGTTACTGACACCTTCAATGGAGGAGAGGATGGAT CTGACGACAGCGATGTGGACTCTGGC CCAGATGATCCCGGCAGAGATCCTCTATATGACCGGGGATCTGCTGCCG GCAATGATGTCTCTAGGTC AACAGATGTCGAAAAATTAGAAGGAGATGACATTCAAGAAGTTCTTAACTCCCAGA AGAGTAAAGG AGGAAGATTCCAAGGCGGGAAAATCTTGCGGGTCCCGGAAATACCCGATGTCAAGAACTCTAGACC ATCAGCCCAATCAATTAAAAAGGGGCACAGACGGGAACTCAGTCTTATCTGGAACGGTGACGGAGT GTTCATCGA TAAGTGGTGCAACCCAAGCTGTGCCAGAGTCCAAATGGGAGTCATCAGAGCGAAATG CGTCTGTGGGGAGTGTCC CCAAATCTGCGAGGGGTGCAAAGACGATCCAGGGGTTGACACAAGAAT CTGGTACCATAGCATCACTGACTCAGC CTACCCATACGACGTCCCAGACTACGCTTAA
(10) vector plasmid pGEX -4T -1 and positive recombinant plasmid pGEX -4T-V is transformed into the Escherichia coli impression of expression In state cell BL21 (DE3)
It converts, choose bacterium, plasmid extracts foregoing method.
(11) pGEX -4T-V protein SDS-PAGE identification is recombinated
Positive restructuring bacterium is inoculated into LB liquid medium of the 5mL containing ampicillin (100 μ g/mL) according to 1%, 37 DEG C, 250rpm/min shake bacterium stay overnight.In second day preservation strain to 50% glycerol, 10mL LB liquid is inoculated into according to 2% Culture medium shakes 2 hours of bacterium and surveys bacterium solution OD values between 0.6~0.8 plus 1mM/mLIPTG induction expression protein, add inducer it Before take 1mL bacterium solution to do negative control.It after inducing expression 4 hours, takes in bacterium solution to 10mL centrifuge tube, centrifugation discards supernatant, uses PBS It washed once.It is dissolved with the PBS of 2mL, ultrasonication, ultrasonic 4s, is spaced 5s, ultrasound 25 times.12000rpm/min centrifugation 10min, packing supernatant is dissolved with 500uLPBS to be precipitated.(PBS dissolution) is precipitated after taking induction and each 60ul of supernatant is dissolved in 4 times Sample-loading buffer in, while take induction after carrier precipitation and supernatant do negative control, 5min, loading 10ul are boiled in boiling water Carry out SDS-PAGE.As shown in fig. 6, showing albumen successful expression.
(12) western-blot identification
1 piece of glue carries out transferring film after SDS-PAGE, using pvdf membrane, shift liquid shift to an earlier date 2 hours and be put into -20 DEG C of preservations it is standby With.The glue taken out is rinsed with deionized water, is put into transfer liquid;6 layers of the filter paper bigger than protein adhesive is cut, is put into and turns In liquid relief;In the sponge to transfer liquid for impregnating black, then it is put into transferring film Cao;The filter paper of immersion is put on sponge;Protein adhesive is put On filter paper, it is immersed in film in methanol and is placed on glue;The other 3 layers of filter paper impregnated is placed on film;It drives extra bubble away, is put into The Black Sea impregnated is continuous;Overall clamping is put into transferring film Cao, is poured into transfer liquid and is put ice bag, and 100V 1 hour.
The film shifted is taken out, PBST is washed 3 times, each 3min;It is stayed overnight with 5% 4 DEG C of skimmed milk power closings;PBST Washing 3 times, adds monoclonal antibody (purchased from Shanghai bioengineering Co., Ltd) 1:150 of anti-HA label, and room temperature shaker is incubated for 2 hours; PBST is washed 3 times, adds the secondary antibody 1:2500 of anti-mouse, and room temperature shaker is incubated for 2 hours;PBST is washed 3 times, colour developing;Develop the color formula of liquid: 1ml deionized water, 0.01 gram of nickel chloride, the This-HCl of 9ml 20mM pH7.6,0.006 gram of DAB, 10ul30% hydrogen peroxide; Observation is dried after colour developing as a result, seeing Fig. 7, shows that the albumen of expression has good reactionogenicity.
(13) pGEX -4T-V protein purifying
Inducing expression 300ml pGEX -4T-V recombinant bacterium;Centrifugation, precipitating are washed 1 time with PBS;It is dissolved and is precipitated with 6mlPBS, Ultrasonic 4s is spaced 5s, ultrasound 30 times;12000rpm/min is centrifuged 15min, and supernatant 2ml/ pipe is dispensed into EP pipe;Use GE public affairs The GST gravity column of department to specifications the step of carry out purifying expression albumen.As a result see that Fig. 8, albumen are successfully purified, to exempt from Epidemic disease mouse is prepared.
(14) determination of protein concentration purified
Using the BCA method determination of protein concentration kit of Shanghai bioengineering Co., Ltd, the albumen for measuring purifying is dense Then Balb/c mouse is immunized in degree.
(15) mouse immune
The albumen 3.00mg/mL of purifying, is mixed in equal volume with 0.1mg/mL and Freund's complete adjuvant, selects 7 week old Balb/ 0.2mL is injected intraperitoneally in c female mice;It is (immune with incomplete Freund's adjuvant emulsification antigen booster immunization respectively in the 14th, 28d Position and method are exempted from head), dock in 42d and take a blood sample, separates serum;Antibody level detection is carried out with indirect ELISA method, it is right Immune effect is preferably and antibody titer measures higher mouse peritoneal and injects 0.1mL albumen, 45d is sterile take mouse boosting cell into Row fusion.
The preparation of (16) Nigero75/1 virus
Vero cell is saved by this laboratory.Expand the Vero cell of culture in 225cm2It is passed in cell bottle, together Step connects Nigero75/1 virus, 37 DEG C, saturated humidity, 5%CO according to 2%2It is cultivated in incubator.Observation cell state daily, Third day cytopathy is obvious, and 20 DEG C of ﹣ preservations, multigelation carries out viral concentration afterwards three times.
The venom 10000rpm centrifugation 30min of 500ml removes cell fragment;Centrifuge tube 6000rpm is concentrated by ultrafiltration with 100KD It is centrifuged 15min;V-type liquid in pipe is drawn, the liquid in centrifuge tube is abandoned it.It is centrifuged repeatedly repeatedly, the virus liquid being finally concentrated 100ml.The venom of concentration is dispensed into 2ml centrifuge tube, 70 DEG C of ﹣ freeze it is spare.
The foundation of (17) indirect ELISA monoclonal antibody selective mechanisms method
It is dense to determine that antigen (Nigero75/1 virus) is most preferably coated with using square matrix method for routinely indirect ELISA operating procedure Degree, antibody best effort concentration and betray and calibrate standard.According to the OD value of positive blood borehole cleaning close to 1.0, value < 0.2 negative serum OD, P/N > 2.1 are the positive, while setting up blank control and the control of SP2/0 supernatant.
The Nigero75/1 virus of purifying is as antigen coat, and be measured using square matrix test: virus is made of coating buffer 1:1,1:2,1:4,1:8 dilution, are added ELISA Plate, 100 holes μ L/, and flick or oscillating flat plate is so that Antigen distribution is uniform.It will Coated ELISA Plate is sealed with lid, and 4 DEG C overnight, discard liquid in elisa plate, and cleaning solution is added with multichannel pipettor, and (PBST is molten Liquid) 200 holes μ L/, 3min is slightly shaken at room temperature, is gently patted dry on cloth, and repeated washing is three times.It is closed with 5% skimmed milk power 250 hole μ L/ of liquid, 37 DEG C of closing 60min, same washing three times, pat dry.The extension rate of the mouse positive and negative serum is 1: 100,1:200,1:400,1:800,1:1600,1:3200 are added in ELISA Plate, 100 holes μ L/, while setting blank control, and 37 DEG C 45min is acted on, washing three times, pats dry.The diluted rabbit anti-mouse igg of 1:10000,100 holes μ L/ is added, 25 DEG C of effect 45min are washed It washs three times, pats dry.Add TMB developing solution, 100 holes μ L/, 25 DEG C with 3-5min, are added terminate liquid (2M H2SO4Solution), 100 μ L/ OD450nm light absorption value is read in hole in microplate reader.With the OD value of positive blood borehole cleaning close to 1.0, P/N > 2.1 antigen serum most Big dilution is as antigen and the most suitable working concentration of control serum.Finishing screen selects the Nigero75/1 virus of purifying as anti- Primordial covering optium concentration is 1:8, antibody dilution 1:800.
(18) cell fusion
1, the preparation of feeder cells
1 day before fusion, select 1 cervical dislocation of Balb/c female mice of 7 week old lethal, 75% alcohol soaking disinfection 5 min, are fixed on shelf, move into super-clean bench, lift mouse part skin with tweezers, sterile abdominal cut skin (pays attention to not Peritonaeum can be damaged), peritonaeum is exposed sufficiently through tweezers removing.Basic culture solution 10mL injection is drawn with disposable sterilized injector Mouse peritoneal, the fixed syringe of the right hand remain stationary, and left hand clamps cotton ball soaked in alcohol with tweezers and gently rubs mouse web portion 2-3 Min, then be sucked out intraperitoneal culture solution (including macrophage) with syringe, it injects in sterilizing plates.Draw 20% training completely Nutrient solution 50mL (contain HAT), is added in 5 piece of 96 porocyte culture plates, 100 holes μ L/ with multichannel pipettor, 37 DEG C, saturated humidity, 5%CO2It is cultivated in incubator.Cell growth state is observed after 18-24h, cell is in pleomorphism, and it is adherent close, when refractivity is good It can use.
2, the preparation of SP2/0 cell
Myeloma SP2/0 cell returns purifying through 8-AG selection culture and Balb/c female mice abdominal cavity respectively.It is merging First 30 days or so, cell recovery, with the DMEM complete culture solution selection culture three generations of 8-AG (20 μ g/mL) or more is added, to protect Hold HGPRT-deficiency.The cell for taking growth conditions good to handle through 8-AG, centrifugation, PBS buffer solution washed once, and platform is expected Cell, is diluted to 10 by blue stain living cells numeration6A/mL, through incomplete Freund's adjuvant is injected intraperitoneally before being inoculated into one week The Balb/c female mice that (0.5mL/ is only) stimulated is intraperitoneal.Pay attention to observing mouse state, (one week when mouse peritoneal expands Left and right), aseptic collection ascites adjusts cell density, 37 DEG C, saturated humidity, 5%CO with complete culture solution2It is passed in incubator Culture, freezes spare.
3, the preparation of splenocyte
The Balb/c mouse of booster immunization is taken, eyeball excise bloodletting separates serum for positive antibody;Mouse cervical vertebra is taken off Mortar is put to death, 75% alcohol disinfecting 5min, is moved into superclean bench, is fixed on shelf, is cut off respectively with sterilizing scissors, tweezers Skin and film abdomen, sterile taking-up spleen put people and have filled clear Xian in the sterilized petri dishes of basic culture solution, remove the connective on envelope Tissue.Spleen is moved into the plate that another fills 10mL basic culture solution and 0.22um copper mesh, is existed with syringe needle tube Spleen to be ground on copper mesh, and splenocyte suspension in plate is transferred in 50mL centrifuge tube, piping and druming mixes 1000rpm and is centrifuged 5min, It is resuspended and is mixed with 10mL basic culture solution.
4, cell fusion
It merges according to a conventional method, immune mouse spleen cell is taken to mix with myeloma cell SP2/0 by cell quantity 5:1, be added In the sterile centrifugation tube of 50mL, 1000rpm is centrifuged 5min, and abandoning supernatant mixes well two kinds of cells with finger attack tube bottom, Until at paste;Centrifuge tube is placed in the beaker of 37 DEG C of water, draws the 50%PEG solution 1mL of 37 DEG C of preheatings in 45sec It being slowly dropped into, centrifuge tube is rotated in drop, static 1min is slowly dropped into 1 mL of basic culture solution of 37 DEG C of preheatings in 45sec, Centrifuge tube is rotated in drop, stands 15sec;Basic culture solution 2mL is instilled in 45sec, it is same to rotate centrifuge tube in drop;Then 4mL basic culture solution is added in 3min, finally adding basic culture solution and being gently agitated for centrifuge tube to 30mL keeps PEG thoroughly dilute It releases and loses fusion.800rpm is centrifuged 8min, abandons supernatant, and cell precipitation is gently suspended to 50mL containing 20% fetal calf serum In the HAT selection culture solution of preheating, it is uniformly mixed, is added to the 96 hole cell culture added with feeder cells with multichannel pipettor In plate, culture plate is moved to 37 DEG C, 5%CO by every 100 μ L of hole2, cultivate in saturated humidity incubator.
The screening of (19), positive hybridoma cell
Fused cell 5d replaces culture solution, using partly changing liquid mode.Culture solution used presses incubation time not It is same and different, HAT culture solution is used in fusion 10d;HT culture solution is used after 10d, is used after three time clonings common complete Culture solution.Hybridoma it is long to 15d when, i.e., desirable 100 μ L of cells and supernatant is coated indirectly with Nigero75/1 virus ELISA method carries out the detection of specific antibody, while making negative control with SP2/0 cell culture supernatant.
The clone of (20), hybridoma freezes and recovers
1, it clones and expands (limiting dilution assay)
The hybridoma colonies being detected as in the positive particular bore of secretion are blown afloat into mixing, cell Trypan Blue It counts, takes above-mentioned cell suspension, be diluted to 10/mL cell with the HT culture solution containing 20% fetal calf serum, it is thin by what is diluted 100 μ L of born of the same parents' suspension, which is added in 96 porocyte culture plates added with feeder cells in advance, to be cultivated.After clone under the 10th day microscope Observation monoclonal hole simultaneously marks.It is operated by 3 time cloningizations, until when all cloning cell hole Positive rates are 100%, It can determine the hybridoma cell strain for having obtained secrete monoclonal antibody.One plant of monoclonal antibody is filtered out, 3E6 is named as.
2, cell cryopreservation
By Cryopreservation of Hybridoma Cells before each cloning, the hybridoma cell strain of secrete monoclonal antibody has in addition been obtained 3E6's freezes.The good 3E6 cell centrifugation to be frozen of vigorous, form will be grown, with cells frozen storing liquid (containing 10%DMSO, 90% fetal calf serum) cell is adjusted to 3-5 × 106A/mL is added in 1.8mL cell cryopreservation tube, marks, and then will Cryopreservation tube is put into freezing storing box, in -70 DEG C of low temperature refrigerators overnight, in second day investment liquid nitrogen container, and is made a record.
3, cell recovery
A 3E6 cell cryopreservation tube is taken out at interval from liquid nitrogen container after one month, be put into the burning for filling 37 DEG C of water rapidly In cup, being kept stirred melts it rapidly, moves to superclean bench, and cell suspension is suspended in basis by sterile unlatching cryopreservation tube In culture solution, 1000rpm is centrifuged 5min washing, and cell precipitation is resuspended with 5mL complete culture solution, moves into Tissue Culture Flask, sets 5%CO2, 37 DEG C, cultivate in saturated humidity incubator.Whether verifying cell freezes.There is no problem for cell cryopreservation, raw after recovery Length is vigorous.
The preparation of (21), monoclonal antibody ascites
1 week before the hybridoma of inoculation secrete monoclonal antibody, 8 week old female BAl BIcs/every abdominal cavity of c mouse is first given Inject 0.5mL norphytane.The hybridoma of culture is rinsed from Tissue Culture Flask, 1000rpm is centrifuged 5min, then uses PBS buffer solution (PH7.2) suspended centrifugal washs 1 time, and Trypan Blue labors after cell count cell density number being adjusted to 2 × 106A/mL, every mouse peritoneal injects 0.5mL cell suspension, containing about 1 × 106A cell.Observation mouse shape is paid attention to after inoculation State is obviously expanded (7~12d) to mouse web portion, when handicapped, after sterilizing lower abdomen skin with cotton ball soaked in alcohol, can use No. 12 Syringe needle is pierced into abdominal cavity, it is seen that has ascites to ooze, is collected with sterile centrifugation tube, 4 DEG C stand overnight, and 5000rpm is centrifuged 5min, supernatant As ascites, packing, label, -70 DEG C of preservations;Interval 2-3 days takes, a mouse is general again after ascites regeneration accumulation with method It can extract 2-3 times.
The Peptide systhesis of 1 one segment (known array) of peste des petits ruminants V gene of embodiment prepares monoclonal antibody
Detailed step is as follows:
(1), the sequence and concentration of polypeptide
Polypeptide sequence: GGATCAGACAAAGTCGACATGTCTCCTGAAGATAATCTCGGATTT is located at V gene Between 207bp-252bp;The amino acid of coding: GSDKVDMSPEDNLGF.Polypeptide inspires confidence in biotechnology Limited Liability public affairs by Guangzhou Lip river Department's synthesis, and it is coupled-KLH, the concentration of synthesis is 1mg/ml.
(2), mouse immune
Polypeptide is mixed in equal volume with 0.1mg/mL and Freund's complete adjuvant, selects 7 week old Balb/c female mices, abdominal cavity note Penetrate 0.2mL;Respectively in the 14th, 28d, with incomplete Freund's adjuvant emulsification antigen booster immunization, (immune position and method are the same as first Exempt from), dock in 42d and take a blood sample, separates serum;Carry out antibody level detection with indirect ELISA method, to immune effect preferably and Antibody titer measures higher mouse peritoneal and injects 0.1mL albumen, and 45d is sterile to take mouse boosting cell to be merged.
(3), the foundation of indirect ELISA monoclonal antibody selective mechanisms method
It is dense to determine that antigen (pGEX -4T-V protein) is most preferably coated with using square matrix method for routinely indirect ELISA operating procedure Degree, antibody best effort concentration and betray and calibrate standard.According to the OD value of positive blood borehole cleaning close to 1.0, value < 0.2 negative serum OD, P/N > 2.1 are the positive, while setting up blank control and the control of SP2/0 supernatant.Specific method is as previously described.Finishing screen selects V egg White coating optium concentration is 1:200, and antibody (serum of immune mouse) dilution is 1:800.
(4), cell fusion
The preparation of feeder cells, the preparation of SP2/0 cell, the preparation of splenocyte, the method for cell fusion are as previously described.
(5), the screening of positive hybridoma cell
Method is named as 4F2 and 4F11 as previously mentioned, finishing screen selects 2 plants of monoclonal antibodies.
(6), the clone of hybridoma, freeze and recover
Clone and amplification (limiting dilution assay), cell cryopreservation, cell recovery
(7), the preparation of monoclonal antibody ascites
Method is as previously described.
2 eukaryotic expression peste des petits ruminants V protein of embodiment
(1), design of primers
According to carrier for expression of eukaryon pFastBacTMRestriction enzyme site on Dual (preservation of this laboratory) and apply DNAStar Software analyze V gene sequence restriction enzyme site, devise upstream and downstream primer restriction enzyme site be respectively EcoRI and HindIII.Downstream primer adds HA label, HA sequence are as follows: TACCCATACGACGTCCCAGACTACGCT, HA label reverse transcription sequence Column: AGC GTA GTC TGG GAC GTC GTA TGG GTA.Upstream primer
P1:AACCGAATTCATGGCAGAAGAACAAGCATACCAT;Downstream primer adds HA label as follows,
B2:ATTTAAGCTTTTAAGCGTAGTCTGGGACGTCGTATGGGTAGGCTGAGTCAGTGATGC。
Mutant primer M1:
Mutant primer M2: Base in box is the catastrophe point of V gene.Primer is synthesized by Shanghai bioengineering Co., Ltd.
(2), RT-PCR amplification Nigera75/1 vaccine virus V gene
Template is done with the 2.5uLRNA solution of extraction, is that primer carries out RT-PCR amplification using P1 and M2, B2 and M1.Specifically Step and method are as previously mentioned, result is as shown in Figure 9.The clip size of Successful amplification P1 and M2 primer amplification is 705bp, life Entitled N1;The clip size of B2 and M1 primer amplification is 220bp, is named as N3.As shown in figure 9, correctly amplifying N1 and N3.
(3) fusion DNA vaccine expands
Using P1 and B2 as primer, N1 and N3 are that template carries out PCR amplification, and specific steps and method are as previously mentioned, successfully expand Increase target fragment V gene size 924bp, as shown in Figure 10.
(4) recycling of V gene PCR product glue and purifying
Using the glue recovery purifying kit of Shanghai bioengineering Co., Ltd, the V gene of recycling and purifying PCR amplification, Method is as previously described.
(5) difference double digestion V gene and pFastBacTMDual vector plasmid
Double digestion V gene and pFastBacTMDual vector plasmid, is shown in Table 5.
Table 5:V gene double digestion
Table 6:pFastBacTMDual carrier double digestion
(6) V gene and pFastBac after double digestionTMThe recycling of Dual vector plasmid glue and purifying
V gene using the glue recovery purifying kit of Shanghai bioengineering Co., Ltd, after recycling and purifying double digestion And pFastBacTMDual vector plasmid, -20 DEG C save backup.
(7) V gene and pFastBacTMThe connection and conversion of Dual carrier (in DH5 α).
1, the V gene and pFastBac after double digestionTMDual vector plasmid is attached (16 DEG C overnight), is shown in Table 7.
Table 7: target fragment is connected with carrier
2, connection product converts.
Whole connection products and 0.5uL pFastBacTMDual vector plasmid is added separately to the impression of 50uL Escherichia coli In state cell DH5 α (being purchased from Tiangeng company);After ice bath 30min, 42 DEG C of heat shock 90s, ice bath 2min;Respectively plus 900uL nonreactive Property LB culture medium, shakes shaken cultivation 60min in 37 DEG C of shaking tables slowly;50-100uL is taken to be coated in containing ampicillin (100 after centrifugation μ g/mL) LB solid medium on, 37 DEG C of inversion overnight incubations.
(8) recombinant plasmid pFastBacTMThe extraction and identification of Dual-V (in DH5 α)
10 single colonies in picking agar plate are inoculated into the LB liquid medium containing ampicillin (100 μ g/mL) In, 37 DEG C are shaken bacterium overnight.Second day extraction plasmid, according to the plasmid extraction kit of Shanghai bioengineering Co., Ltd illustrate into The extraction of row recombinant plasmid.Recombinant plasmid agarose gel electrophoresis figure is shown in Figure 11, tentatively judges 2 positive recombinant plasmids, respectively For plasmid 7 and plasmid 10, plasmid serves the raw work in sea and carries out sequencing strain sequencing, and sequencing result is correct, overall length 924bp (V gene+ HA sequence), as follows:
ATGGCAGAAGAACAAGCATACCATGTCAACAAGGGACTGGAATGTATCAAGTCTCTCAAAGCCTCTC CCCCGGATCTATCCACCATCAAAGATGCCCTTGAGAGCTGGAGAGAGGGGCTTAGCCCCTCAGGCCG TGCAACAC CGAACCCTGATACGTCCGAGGGAGACCATCAGAATATCAACCAATCATGCTCACCAGCA ATCGGATCAGACAAAG TCGACATGTCTCCTGAAGATAATCTCGGATTTAGAGAGATCACTTGTAATGA CAGTGAGGCTGGGCTCGGAGGAG TTCTGGATAAAGGATCCAACTCTCAAGTACAGCGTTACTATGTT TATAGCCACGGGGGTGAAGAGATTGAAGGAC TCGAGGATGCTGACTCTCTCGTGGTTCAAGCAAAT CCTCCAGTTACTGACACCTTCAATGGAGGAGAGGATGGAT CTGACGACAGCGATGTGGACTCTGGC CCAGATGATCCCGGCAGAGATCCTCTATATGACCGGGGATCTGCTGCCG GCAATGATGTCTCTAGGTC AACAGATGTCGAAAAATTAGAAGGAGATGACATTCAAGAAGTTCTTAACTCCCAGA AGAGTAAAGG AGGAAGATTCCAAGGCGGGAAAATCTTGCGGGTCCCGGAAATACCCGATGTCAAGAACTCTAGACC ATCAGCCCAATCAATTAAAAAGGGGCACAGACGGGAACTCAGTCTTATCTGGAACGGTGACGGAGT GTTCATCGA TAAGTGGTGCAACCCAAGCTGTGCCAGAGTCCAAATGGGAGTCATCAGAGCGAAATG CGTCTGTGGGGAGTGTCC CCAAATCTGCGAGGGGTGCAAAGACGATCCAGGGGTTGACACAAGAAT CTGGTACCATAGCATCACTGACTCAGC CTACCCATACGACGTCCCAGACTACGCTTAA
Recombinant plasmid PCR identification.PCR reaction system: 10 × Buffer 5uL, P1 and B2 each 1.5uL of upstream and downstream primer, mould Plate 0.2uL, Ex Taq enzyme 0.3uL, dNTP4uL, water 37.5uL, total system 50uL.Response procedures are as follows: 94 DEG C of 5min, 94 DEG C 45s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min.PCR product analysis is carried out with 1% agarose gel electrophoresis. The V genetic fragment size of amplification is 924bp, as shown in figure 12.
The identification of recombinant plasmid double digestion.It is shown in Table 8 and Figure 13.
Table 8: double digestion identification
37 DEG C 3 hours
10×MBuffer 2uL
Plasmid 3uL
EcoRI 1uL
HindIII 1uL
H2O 5uL
It amounts to 10uL
(9) vector plasmid pFastBacTMDual and positive recombinant plasmid pFastBacTMDual-V is transformed into DH10BacTM (it is transformed into rod granule) in competent escherichia coli cell
1,2 pipe DH10Bac are takenTMCompetent cell thaws on ice.
2, by 8ul vector plasmid pFastBacTMDual and 8ul recombinant plasmid pFastBacTMDual-V is added separately to DH10BacTMIn competent cell, it is gently mixed.Pressure-vaccum mixing, competent cell ice face must not be left up and down.
3, it fosters on ice 30 minutes;42 DEG C of heat shocks45s;2min on ice immediately, remain stationary.
4,37 DEG C 225 revs/min of the SOC culture medium (purchased from the raw work in Shanghai) of 900ul room temperature is added shake culture 4 hours.
5, cultivate after the completion of, without centrifugation, with SOC culture medium (Room temperature) 10 times, 100 times and 1000 times of dilutions it is above two Converted product, each dilution 100ul spread a LB plate, and plate includes 50ug/ml Kan, 7ug/ml Gentamicin, 10ug/ml tetracycline, 100ug/ml X-gal, 40ug/ml IPTG, for carrying out DH10BacTMThe sieve of transformant Choosing.
6, it fosters for 37 DEG C48 hours.Note: not recommending to choose monoclonal earlier than 48 hours, because may be difficult to distinguish in this way Blue hickie.
(10) identification (DH10Bac of carrier rod granule and restructuring rod granule DNATMIn competent escherichia coli cell)
1,8 carrier rod granule pFastBac have been chosenTMDual clone bacterium (white) and 16 restructuring rod granules
pFastBacTMDual-V clone bacterium (white) is seeded to containing 50ug/ml Kan, 7ug/ml Gentamicin, In the liquid of 10ug/ml tetracycline LB, 37 DEG C 225 revs/min are incubated overnight.13 plants of bacterium, carrier bacterium 4 are finally shaken Strain,
9 plants of recombinant plasmid bacterial strain.
2, the extraction of bacmid dna:
(1) 2ml centrifuge tube collects 3ml bacterium solution, and 12000rpm is centrifuged 1min.
(2) supernatant is discarded, adds 0.3ml Buffer P1 (the raw working medium grain extraction agent box in Shanghai) that precipitating, gently earthquake is resuspended It swings and mixes.
(3) plus the Buffer P2 of 0.3ml is mixed gently, and is incubated at room temperature 5min.
(4) it is slowly added to 0.3ml Buffer P3, is mixed gently in adition process.Albumen will form white precipitate, on ice Place 5-10min.
(5) 12000rpm is centrifuged 10min.
(6) gently supernatant is transferred in the centrifuge tube containing 0.8ml isopropanol.It is not drawn onto white precipitate, overturned mixed It is even, 5-10min on ice.
(7) room temperature 12000rpm is centrifuged 15min.
(8) carefully discard supernatant, not float precipitating, the ethyl alcohol of 0.5ml70% is added.Reverse centrifuge tube cleans heavy for several times It forms sediment.
(9) room temperature 12000rpm is centrifuged 5min.
(10) removal supernatant as much as possible, not stir precipitating.Room temperature 5-10min air-dries precipitating, should not overdrying.
(11) precipitated with the TE dissolving DNA of 40ul pH8.0.In order to avoid shearing, gravity treatment DNA that should not be mechanical makes solution suitable Pipe gently flows down dissolving DNA, 4 DEG C of storages.
3, PCR identifies bacmid dna
M13F (upstream primer): GTTTTCCCAGTCACGAC;M13R (downstream primer): CAGGAAACAGCTATGAC.This Test application is pFastBacTMDual carrier, target fragment size 924bp.Carrier rod granule and recombination are identified using M13 primer The size of bacmid dna is 2560bp and 3484bp respectively, sees Figure 14, successfully takes restructuring rod granule.It is identified using P1 and B2 primer Restructuring rod granule DNA, purpose V gene are successfully plugged into carrier pFastBacTMIn Dual, Figure 15 is seen.
(1) carrier rod granule PCR is identified.
PCR reaction system: 10 × Buffer 5uL, M13F and M13R each 1.5uL of upstream and downstream primer, template 0.2uL, Ex Taq enzyme 0.3uL, dNTP5uL, water 36.5uL, total system 50uL.Response procedures are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 3min, 35 circulations, 72 DEG C of 10min.The genetic fragment size of amplification is 2560bp or so (being shown in Table 9), as shown in figure 14.
Table 9:M13 primer identifies restructuring rod granule target fragment size
Sample The size of PCR product amplification
The plasmid (rod granule) of Baculovirus Gene group ~300bp
Recombinate pFastBacTM1 rod granule ~2300bp+ target gene
Recombinate pFastBacTM1-Gus rod granule ~4200bp
Recombinate pFastBacTMHT rod granule ~2430bp+ target gene
Recombinate pFastBacTMHT-CAT rod granule ~3075bp
Recombinate pFastBacTMDual rod granule ~2560bp+ target gene
Recombinate pFastBacTMDual-Gus/CAT rod granule ~5430bp
(2) restructuring rod granule (pFastBacTMDual+V) DNAPCR is identified.
PCR reaction system one: 10 × Buffer 5uL, each 1.5uL of primer M13F and M13R upstream and downstream primer, template 0.2uL, Ex Taq enzyme 0.3uL, dNTP5uL, water 36.5uL, total system 50uL.Response procedures are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 4min, 35 circulations, 72 DEG C of 10min.The genetic fragment size of amplification is 3484bp or so, such as Figure 14 institute Show.
PCR reaction system two: 10 × Buffer 5uL, each 1.5uL of primer P1 and PB upstream and downstream primer, template 0.2uL, Ex Taq enzyme 0.3uL, dNTP4uL, water 37.5uL, total system 50uL.Response procedures are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min.The genetic fragment size of amplification is 900bp or so, as shown in figure 15.
The above test proves to contain target gene V in restructuring rod granule, carries out the transfection of insect cell in next step, generate recombination Baculoviral.
The culture of (11), Sf9 cell
Sf9 cell is given by Tian Kang Bioisystech Co., Ltd, and Grace`s InsectMedium and fetal calf serum are The production of Gibco company.25cm2After Sf9 cell covers with, culture solution is discarded, the fetal calf serum being added in cell bottle containing 10% is trained Nutrient solution 2ml beats cell bottle bottom with palm, makes cell detachment, and one passes three, is put into 27 DEG C of incubator cultures, the training of passage in 3-4 days It supports.
(12) it transfects
The transfection reagent box used is shown in Figure 16, and specific step is as follows for transfection.
(1) 1 bottle of 25cm2Sf9 cell covers in passage to 4 holes in 6 orifice plates, and the hole 2ml/ is transfected for second day.
(2) bacterium 15ml is shaken, is averagely dispensed into 4 EP pipes and extracts restructuring rod granule, specific method is as previously described.The weight of extracting Group rod granule carries out DNA concentration measurement.V1=5738ng/ul, and A260/A280=1.756 are measured, shows the rod granule that this pipe extracts DNA is polluted without RNA, protein and phenol etc., and it is spare to place 4 DEG C of transfections.
(3) the bacmid dna of 1ug is diluted into the Grace culture medium of 100ul serum-free, is mixed gently.
Overturn 5-10 time completely mix Cellfectin reagent, suction 6ul Cellfectin reagent enter 100ul without The Grace culture medium of serum.
(5) will be (3) together with (4) above two liquid be gently mixed, total volume about 210ul, room temperature is fostered 30 minutes.
(6) 6 orifice plates cell is taken out from incubator, discards culture medium, is cleaned 2 times, was cleaned with serum-free Grace culture medium Cell detachment is avoided in journey.
(7) the Grace culture medium of 0.8ml serum-free is added into pipe (5), mixes gently, is added in cell hole, 27 DEG C culture 5 hours.It stays a cell hole to compare, bacmid dna carrier is added, is transfected according to the method described above.
(8) the transfection reagent in cell is discarded, the culture medium that 2ml contains 10% fetal calf serum is added into cell hole, 27 DEG C incubate After educating 96 hours, cell has the phenomenon that virus infection.
(9) above-mentioned 4 DEG C of baculoviral P1 generation (without multigelation) is collected to save.
P1 for 500g be centrifuged 5min, in addition the clear hole 300ul/ be inoculated into cell (6 orifice plates) continue blind passage to P3 for into Row identification.
(13) SDS-PAGE identification
Baculoviral P3 is centrifuged 5min for 1ml 500g, abandons supernatant precipitating and is dissolved with PBS, 60ul sample is taken to add 4 times of loadings Buffer (purchased from the raw work in Shanghai) 20ul is mixed, and boils 5min.Sf9 cell controls (bacmid dna carrier) precipitating is dissolved with PBS, Sample is handled according to the method described above.Every hole loading 10ul carries out SDS-PAGE.As shown in figure 17, the rod-shaped disease of recombination is successfully taken Poison, purpose V gene successful expression.
(14) western-blot identification
1 piece of glue carries out transferring film after SDS-PAGE, and using pvdf membrane, specific transferring film step is carried out according to previous method. The film shifted is taken out, PBST is washed 3 times, each 3min;It is stayed overnight with 5% 4 DEG C of skimmed milk power closings;PBST is washed 3 times, Add monoclonal antibody (purchased from Shanghai bioengineering Co., Ltd) 1:150 of anti-HA label, room temperature shaker is incubated for 2 hours;PBST washing 3 It is secondary, add the secondary antibody 1:2500 of anti-mouse, room temperature shaker is incubated for 2 hours;PBST is washed 3 times, colour developing;Develop the color formula of liquid: 1ml deionization Water, 0.01 gram of nickel chloride, the This-HCl of 9ml 20mM pH7.6,0.006 gram of DAB, 10ul30% hydrogen peroxide;It is dried after colour developing Observation is as a result, be shown in Figure 18.The albumen of expression has preferable reactionogenicity.
(15) pFastBacTMThe acquisition of Dual+V baculoviral strain
By above-mentioned experiment, V protein success is expressed in baculoviral strain.It is immune that the subsequent albumen cut glue The antibody titer of Balb/c mouse, generation is low, does not carry out monoclonal antibody preparation with the albumen.
3 three plants of monoclonal antibody indirect immunofluorescences of embodiment and antibody typing test
(1) Sf9 cell expresses V protein indirect immunofluorescence assay
(1) 1 bottle of 25cm covered with2Sf9 cell 1 passes in 4 to 96 orifice plates, meets within second day malicious 400ul, 10% culture solution after Continuous culture 3 days.
(2) connect poison and discard cell supernatant after 3 days, every hole gently adds PBS to wash 2 times, cell is avoided to be suspended.
(3) the liquid in cell hole is removed as far as possible, and every hole adds 4 DEG C of dehydrated alcohol 100ul to fix 2 hours.
(4) fixer is discarded, the ascites 1:200 of three plants of monoclonal antibodies 3E6,4F2 and 4F11 are added after dry, adds HA monoclonal antibody 1:200, Add SP2/0 cell conditioned medium to compare, 37 DEG C 1 hour.
(5) 3 times are washed with PBS, gently clappers drying liquid, add the anti-mouse fluorescence antibody 1:100 of Sigma company, 37 DEG C 1 hour.
(6) washed 3 times with PBS, gently clappers drying liquid, fluorescence microscopy under the microscope, are shown in Figure 19.The result shows that three Strain monoclonal antibody 3E6,4F2 and 4F11 reactionogenicity is preferable;HA monoclonal antibody also has preferably with the V protein of baculovirus expression (adding HA label) Reactionogenicity;Negative control is set up.
(2) indirect immunofluorescence assay of vero cell inoculation PPR virus Nigera75/1
(1) 1 bottle of 25cm covered with2Vero cell, 1 passes in 20 to 96 orifice plates, synchronizes and meets malicious 300ul, 5% culture solution after Continuous culture 3 days.
(2) connect poison and discard cell supernatant after 3 days, every hole gently adds PBS to wash 2 times, cell is avoided to be suspended.
(3) the liquid in cell hole is removed as far as possible, and every hole adds 4 DEG C of dehydrated alcohol 100ul to fix 2 hours.
(4) fixer is discarded, the ascites 1:200 of three plants of monoclonal antibodies 3E6,4F2 and 4F11 are added after dry, adds SP2/0 cell conditioned medium Compare, 37 DEG C 1 hour.
(5) 3 times are washed with PBS, gently clappers drying liquid, add the anti-mouse fluorescence antibody 1:100 of Sigma company, 37 DEG C 1 hour.
(6) washed 3 times with PBS, gently clappers dries liquid, fluorescence microscopy microscopic observation, See Figure 20.The result shows that Three plants of monoclonal antibodies 3E6,4F2 and 4F11 have preferable reactionogenicity.
(3) three plants of antibody mab blood groupings
Purchased from the antibody typing kit of Thermo company, operated to specifications, three plants of monoclonal antibodies 3E6,4F2 and 4F11 Antibody types are IgM λ type, IgM λ type and IgM κ type respectively, as shown in figure 21.
The foregoing is only a preferred embodiment of the present invention, the scope of protection of the present invention is not limited to this, it is any ripe Know those skilled in the art within the technical scope of the present disclosure, the letter for the technical solution that can be become apparent to Altered or equivalence replacement are fallen within the protection scope of the present invention.
Sequence table
<110>Xinjiang herding academy of sciences veterinary institute (Xinjiang herding academy of sciences animal clinical medical research center)
<120>a kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tacccatacg acgtcccaga ctacgct 27
<210> 2
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
agcgtagtct gggacgtcgt atgggta 27
<210> 3
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
aaccgaattc atggcagaag aacaagcata ccat 34
<210> 4
<211> 57
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
atttcccggg ttaagcgtag tctgggacgt cgtatgggta ggctgagtca gtgatgc 57
<210> 5
<211> 43
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ccaatcaatt aaaaaggggc acagacggga actcagtctt atc 43
<210> 6
<211> 44
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
actgagttcc cgtctgtgcc cctttttaat tgattgggct gatg 44
<210> 7
<211> 924
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
atggcagaag aacaagcata ccatgtcaac aagggactgg aatgtatcaa gtctctcaaa 60
gcctctcccc cggatctatc caccatcaaa gatgcccttg agagctggag agaggggctt 120
agcccctcag gccgtgcaac accgaaccct gatacgtccg agggagacca tcagaatatc 180
aaccaatcat gctcaccagc aatcggatca gacaaagtcg acatgtctcc tgaagataat 240
ctcggattta gagagatcac ttgtaatgac agtgaggctg ggctcggagg agttctggat 300
aaaggatcca actctcaagt acagcgttac tatgtttata gccacggggg tgaagagatt 360
gaaggactcg aggatgctga ctctctcgtg gttcaagcaa atcctccagt tactgacacc 420
ttcaatggag gagaggatgg atctgacgac agcgatgtgg actctggccc agatgatccc 480
ggcagagatc ctctatatga ccggggatct gctgccggca atgatgtctc taggtcaaca 540
gatgtcgaaa aattagaagg agatgacatt caagaagttc ttaactccca gaagagtaaa 600
ggaggaagat tccaaggcgg gaaaatcttg cgggtcccgg aaatacccga tgtcaagaac 660
tctagaccat cagcccaatc aattaaaaag gggcacagac gggaactcag tcttatctgg 720
aacggtgacg gagtgttcat cgataagtgg tgcaacccaa gctgtgccag agtccaaatg 780
ggagtcatca gagcgaaatg cgtctgtggg gagtgtcccc aaatctgcga ggggtgcaaa 840
gacgatccag gggttgacac aagaatctgg taccatagca tcactgactc agcctaccca 900
tacgacgtcc cagactacgc ttaa 924

Claims (4)

1. a kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody, which is characterized in that including Following steps:
(1) design of primers of Nigera75/1 vaccine virus V gene:
According to NCBI serial number: X74443 downloads V gene sequence, 897bp;Using DNAStar software analyze, design upstream and The restriction enzyme site of downstream primer sequence;Upstream restriction enzyme site is EcoRI, and downstream restriction enzyme site is SmaI;Downstream primer adds HA to mark Label, HA sequence is as shown in SEQ:ID:NO:1, and HA label reverse transcription sequence is as shown in SEQ:ID:NO:2;
According to 7 software design V gene primer of Oligo, upstream primer P1: as shown in SEQ:ID:NO:3;Downstream primer adds HA such as Shown in SEQ:ID:NO:4, mutant primer M1 is as shown in SEQ:ID:NO:5, and mutant primer M2 is as shown in SEQ:ID:NO:6;
(2) extraction of Nigera75/1 vaccine virus RNA:
TRIzol LS extraction method: extract is cell culture fluid poison, and when extraction, all goods used were without RNA enzyme;
1, virus stock solution used 250ul is added in the eppendorf pipe of 1.5ml, adds TRIzol LS 750ul, mixes well, It is placed at room temperature for 5min;
2, the chloroform of 200ul is added, covers tightly centrifuge tube lid, firmly shakes centrifuge tube, solution is fully emulsified, at milky white shape, nothing point Phase phenomenon, is placed at room temperature for 3min;
3,4 DEG C, 12000r/min is centrifuged 15min, and upper phase is taken to move into another pipe);
4, isometric isopropanol is added, gently overturns centrifuge tube and mixes well liquid, be placed at room temperature for 10min;
5,4 DEG C, 12000r/min is centrifuged 10min, and all supernatants are carefully sucked with rifle;
6, plus 1ml75% ethyl alcohol is washed one time, and 4 DEG C, 8000r/min is centrifuged 10min, all supernatants is carefully sucked with rifle, in room temperature Dry 5min;
7,25ul DEPC is added and handles water, carry out PT-PCR amplification immediately;
(3) RT-PCR amplification Nigera75/1 vaccine virus V gene
Do template with the 2.5uLRNA solution of extraction, be loaded according to RT-PCR kit of precious biotech firm, using P1 and M2, P2 and M1 are that primer carries out RT-PCR amplification;Reaction system: 2 × Buffer 25uL, each 1uL of upstream and downstream primer, RNA template 2.5uL, enzyme 1uL, water 19.5uL, total system 50uL;Response procedures are as follows: 50 DEG C of 30min, 94 DEG C of 2min, 94 DEG C of 45s, 55 DEG C 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min;RT-PCR product analysis is carried out with 1% agarose gel electrophoresis;P1 and The clip size of M2 primer amplification is 705bp, is named as N1;The clip size of P2 and M1 primer amplification is 220bp, is named as N2;(4) fusion DNA vaccine expands
Using P1 and P2 as primer, N1 and N2 are that template carries out PCR amplification;Reaction system: 10 × Buffer 5uL, upstream and downstream primer Each 0.35uL of each 1uL, template N1 and N2, Ex Taq enzyme 0.3uL, dNTP4uL, water 38uL, total system 50uL;Response procedures are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min;With 1% agarose gel electrophoresis into The analysis of row PCR product;Target fragment V gene size 924bp;
(5) recycling of PCR product glue and purifying
Using the glue recovery purifying kit of Shanghai bioengineering Co., Ltd, the V gene of recycling and purifying PCR amplification;
(6) difference single endonuclease digestion V gene and -1 vector plasmid of pGEX -4T
30 DEG C of SmaI are stayed overnight -1 vector plasmids of digestion V gene and pGEX -4T, apply EcoRI37 DEG C of single endonuclease digestion V after recovery purifying - 1 vector plasmid of gene and pGEX -4T;
(7) the V gene after double digestion and the recycling of -1 vector plasmid glue of pGEX -4T and purifying
Using the glue recovery purifying kit of Shanghai bioengineering Co., Ltd, above-mentioned (six) V gene and pGEX-are recycled and purified 4T -1 vector plasmid, -20 DEG C save backup;
(8) connection and conversion of -1 carrier of V gene and pGEX -4T
1, the V gene after double digestion and -1 vector plasmid of pGEX -4T are attached and convert;
2, connection product converts;
Whole connection products and -1 vector plasmid of 0.5uL pGEX -4T are added separately to 50uL competent escherichia coli cell DH5 α crosses 4 μ L) in;After ice bath 30min, 42 DEG C of heat shock 90s, ice bath 2min;Add 900uL non-resistant LB culture medium, is shaken in 37 DEG C Bed shakes shaken cultivation 60min slowly;50-100uL is taken to be coated in the LB solid medium containing 100 μ g/mL of ampicillin after centrifugation On, 37 DEG C of inversion overnight incubations;
(9) extraction and identification of recombinant plasmid pGEX -4T-V
(10) vector plasmid pGEX -4T -1 and positive recombinant plasmid pGEX -4T-V be transformed into expression E. coli competent it is thin In born of the same parents BL21 (DE3)
It converts, choose the specific method of bacterium, plasmid extraction before as described in (eight) and (nine);
(11) pGEX -4T-V protein SDS-PAGE identification is recombinated
Positive restructuring bacterium is inoculated into the LB liquid medium of 5mL 100 μ g/mL containing ampicillin according to 1%, 37 DEG C, 250rpm/min shakes bacterium and stays overnight;In second day preservation strain to 50% glycerol, 10mL LB Liquid Culture is inoculated into according to 2% Base shakes 2 hours survey bacterium solution OD values of bacterium and adds 1mM/mLIPTG induction expression protein between 0.6~0.8, adds and take before inducer 1mL bacterium solution does negative control;It after inducing expression 4 hours, takes in bacterium solution to 10mL centrifuge tube, centrifugation discards supernatant, is washed with PBS Once;It is dissolved with the PBS of 2mL, ultrasonication, ultrasonic 4s, is spaced 5s, ultrasound 25 times;12000rpm/min is centrifuged 10min, point Cleer and peaceful dissolved with 500uLPBS is loaded onto precipitate;It is precipitated in the sample-loading buffer for being dissolved in 4 times with each 60ul of supernatant after taking induction, together When take the carrier precipitation after induction and supernatant to do negative control, boil 5min in boiling water, loading 10ul carries out SDS-PAGE;
(12) western-blot identification
1 piece of glue carries out transferring film after SDS-PAGE, using pvdf membrane, shifts liquid and shift to an earlier date 2 hours and be put into -20 DEG C saving backup; The glue taken out is rinsed with deionized water, is put into transfer liquid;6 layers of the filter paper bigger than protein adhesive is cut, transfer is put into In liquid;In the sponge to transfer liquid for impregnating black, then it is put into transferring film Cao;The filter paper of immersion is put on sponge;Protein adhesive is placed on On filter paper, it is immersed in film in methanol and is placed on glue;The other 3 layers of filter paper impregnated is placed on film;It drives extra bubble away, is put into leaching The Black Sea steeped is continuous;Overall clamping is put into transferring film Cao, is poured into transfer liquid and is put ice bag, and 100V 1 hour;
The film shifted is taken out, PBST is washed 3 times, each 3min;It is stayed overnight with 5% 4 DEG C of skimmed milk power closings;PBST washing 3 It is secondary, add the monoclonal antibody 1:150 of anti-HA label, room temperature shaker is incubated for 2 hours;PBST is washed 3 times, adds the secondary antibody 1:2500 of anti-mouse, room Warm shaking table is incubated for 2 hours;PBST is washed 3 times, colour developing;Develop the color formula of liquid: 1ml deionized water, 0.01 gram of nickel chloride, 9ml 20mM The This-HCl of pH7.6,0.006 gram of DAB, 10ul30% hydrogen peroxide;Observation result is dried after colour developing;
(13) pGEX -4T-V protein purifying
Inducing expression 300ml pGEX -4T-V recombinant bacterium;Centrifugation, precipitating are washed 1 time with PBS;It is dissolved and is precipitated with 6mlPBS, ultrasound 4s is spaced 5s, ultrasound 30 times;12000rpm/min is centrifuged 15min, and supernatant 2ml/ pipe is dispensed into EP pipe;Use GE company GST gravity column to specifications the step of to carry out the albumen of purifying expression be that immune mouse is prepared;
(14) determination of protein concentration purified
Using the BCA method determination of protein concentration kit of Shanghai bioengineering Co., Ltd, the protein concentration of purifying is measured, so Balb/c mouse is immunized afterwards;
(15) mouse immune
The albumen 3.00mg/mL of purifying, is mixed in equal volume with 0.1mg/mL and Freund's complete adjuvant, selects 7 week old Balb/c female Property mouse, be injected intraperitoneally 0.2mL;Respectively in the 14th, 28d, antigen booster immunization is emulsified with incomplete Freund's adjuvant, in 42d Docking blood sampling, separates serum;Antibody level detection is carried out with indirect ELISA method, and antibody titer preferable to immune effect is surveyed Fixed higher mouse peritoneal injects 0.1mL albumen, and 45d is sterile to take mouse boosting cell to be merged;
The preparation of (16) Nigero75/1 virus
Vero cell is saved by this laboratory;Expand the Vero cell of culture in 225cm2Passed in cell bottle, it is synchronous according to 2% connects Nigero75/1 virus, 37 DEG C, saturated humidity, 5%CO2It is cultivated in incubator;Observation cell state daily, third day Cytopathy is obvious, and multigelation 20 DEG C of preservations of rear ﹣ three times carry out viral concentration;
The venom 10000rpm centrifugation 30min of 500ml removes cell fragment;Centrifuge tube 6000rpm centrifugation is concentrated by ultrafiltration with 100KD 15min;V-type liquid in pipe is drawn, the liquid in centrifuge tube is abandoned it;It is centrifuged repeatedly repeatedly, the virus liquid being finally concentrated 100ml;The venom of concentration is dispensed into 2ml centrifuge tube, 70 DEG C of ﹣ freeze it is spare;
The foundation of (17) indirect ELISA monoclonal antibody selective mechanisms method
Routinely indirect ELISA operating procedure determines the best peridium concentration of antigen, the best effort concentration of antibody using square matrix method And it betrays and calibrates standard;According to the OD value of positive blood borehole cleaning close to 1.0, value<0.2, P/N>2.1 negative serum OD are the positive, are set simultaneously Vertical blank control and the control of SP2/0 supernatant;
The Nigero75/1 virus of purifying is measured as antigen coat using square matrix test: virus with coating buffer be 1:1, 1:2,1:4,1:8 dilution, are added ELISA Plate, 100 holes μ L/, and flick or oscillating flat plate is so that Antigen distribution is uniform;It will be coated ELISA Plate is sealed with lid, and 4 DEG C overnight, discard liquid in elisa plate, and cleaning solution (PBST solution) 200 μ are added with multichannel pipettor The hole L/ slightly shakes 3min at room temperature, gently pats dry on cloth, and repeated washing is three times;With 5% skimmed milk power confining liquid, 250 μ L/ Hole, 37 DEG C of closing 60min, same washing three times, pat dry;The extension rate of the mouse positive and negative serum be 1:100,1:200, 1:400,1:800,1:1600,1:3200 are added in ELISA Plate, 100 holes μ L/, while setting blank control, 37 DEG C of effect 45min, Washing three times, pats dry;The diluted rabbit anti-mouse igg of 1:10000,100 holes μ L/ is added, 25 DEG C of effect 45min are washed three times, clapped It is dry;Add TMB developing solution, 100 holes μ L/, terminate liquid (2M H is added in 25 DEG C of effect 3-5min2SO4Solution), 100 holes μ L/, in enzyme It marks and reads OD450nm light absorption value on instrument;With the OD value of positive blood borehole cleaning close to the antigen serum greatest dilution of 1.0, P/N > 2.1 As antigen and the most suitable working concentration of control serum;Finishing screen selects the Nigero75/1 virus of purifying as antigen coat most Good concentration is 1:8, antibody dilution 1:800;
(18) cell fusion
The screening of (19), positive hybridoma cell
Fused cell 5d replaces culture solution, using partly changing liquid mode;Culture solution used by incubation time difference and It is different, HAT culture solution is used in fusion 10d;HT culture solution is used after 10d, is cultivated completely after three time clonings with common Liquid;Hybridoma it is long to 15d when, that is, 100 μ L of cells and supernatant is taken, with the coated indirect ELISA of Nigero75/1 virus Method carries out the detection of specific antibody, while making negative control with SP2/0 cell culture supernatant;
The clone of (20), hybridoma freezes and recovers
The preparation of (21), monoclonal antibody ascites
1 week before the hybridoma of inoculation secrete monoclonal antibody, first to 8 week old female BAl BIcs/intraperitoneal injection of c mouse every 0.5mL norphytane;The hybridoma of culture is rinsed from Tissue Culture Flask, 1000rpm is centrifuged 5min, then uses PBS Buffer, PH7.2, suspended centrifugal wash 1 time, and Trypan Blue labors and cell density number is adjusted to 2 × 10 after cell count6 A/mL, every mouse peritoneal inject 0.5mL cell suspension, contain 1 × 106A cell;Observation mouse state is paid attention to after inoculation, to 7 ~12d mouse web portion obviously expands, and when handicapped, after sterilizing lower abdomen skin with cotton ball soaked in alcohol, is pierced into abdomen with No. 12 syringe needles Chamber, can see has ascites to ooze, and is collected with sterile centrifugation tube, and 4 DEG C stand overnight, and 5000rpm is centrifuged 5min, and supernatant is ascites, Packing, label, -70 DEG C of preservations;Interval 2-3 days takes after ascites regeneration accumulation with method again, and a mouse extracts 2-3 times.
2. the preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody according to claim 1, It is characterized in that, step (9) specifically:
The extraction of step 1, recombinant plasmid pGEX -4T-V
7 single colonies in picking agar plate are inoculated into the LB liquid medium containing 100 μ g/mL of ampicillin, and 37 DEG C Bacterium is shaken overnight;Second day extraction plasmid, illustrates to be recombinated according to the plasmid extraction kit of Shanghai bioengineering Co., Ltd The extraction of plasmid pGEX -4T-V;Recombinant plasmid agarose gel electrophoresis, the swimming lane of Preliminary Identification 1 and 2 are positive recombinant plasmid, point It Ming Ming not plasmid 1 and plasmid 2;PCR and double digestion identification are carried out in next step;
Step 2, recombinant plasmid pGEX -4T-V PCR identification
PCR reaction system: 10 × Buffer 5uL, P1 and P2 each 1uL of upstream and downstream primer, template 0.5uL, Ex Taq enzyme 0.5uL, DNTP4uL, water 38uL, total system 50uL;Response procedures are as follows: 94 DEG C of 5min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 1min, 35 are followed Ring, 72 DEG C of 10min;PCR product analysis is carried out with 1% agarose gel electrophoresis;We choose plasmid 1 and plasmid 2 expands Increase, V genetic fragment size 900bp, amplification is correct;
Step 3, the identification of recombinant plasmid pGEX -4T-V double digestion
Plasmid 1 and plasmid 2 carry out double digestion identification respectively, and size is completed correct;
Step 4, recombinant plasmid pGEX -4T-V sequencing
Plasmid 1 and plasmid 2 serve the raw work in sea and carry out sequencing strain sequencing, and sequencing result is correct, overall length 924bp (V gene+HA sequence Column), as shown in SEQ:ID:NO:7.
3. the preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody according to claim 1, It is characterized in that, step (18) specifically:
The preparation of step 1, feeder cells
1 day before fusion, select 1 cervical dislocation of Balb/c female mice of 7 week old lethal, 75% alcohol soaking disinfection 5min is fixed on shelf, is moved into super-clean bench, is lifted mouse part skin with tweezers, sterile abdominal cut skin is shelled through tweezers It is sufficiently exposed from peritonaeum is made;Basic culture solution 10mL, which is drawn, with disposable sterilized injector injects mouse peritoneal, the fixed note of the right hand Emitter remains stationary, and left hand clamps cotton ball soaked in alcohol with tweezers and gently rubs mouse web portion 2-3min, then abdominal cavity is sucked out with syringe Interior culture solution injects in sterilizing plates;20% complete culture solution 50mL is drawn containing HAT, is added to 5 piece 96 with multichannel pipettor In porocyte culture plates, 100 holes μ L/, 37 DEG C, saturated humidity, 5%CO2It is cultivated in incubator;Cell growth is observed after 18-24h State, cell are in pleomorphism, and adherent close, refractivity is used when good;
The preparation of step 2, SP2/0 cell
Myeloma SP2/0 cell returns purifying through 8-AG selection culture and Balb/c female mice abdominal cavity respectively;30 before fusion It, cell recovery, with the DMEM complete culture solution selection culture three generations of 8-AG (20 μ g/mL) or more is added, to keep HGPRT- Deficiency;The cell for taking growth conditions good to handle through 8-AG, centrifugation, PBS buffer solution washed once, and Trypan Blue is living thin Cell, is diluted to 10 by born of the same parents' numeration6A/mL, the Balb/ stimulated before being inoculated into one week through incomplete Freund's adjuvant is injected intraperitoneally C female mice is intraperitoneal;Pay attention to observing mouse state, when mouse peritoneal expands, aseptic collection ascites, with complete culture solution tune Whole cell density, 37 DEG C, saturated humidity, 5%CO2Secondary culture in incubator freezes spare;
The preparation of step 3, splenocyte
The Balb/c mouse of booster immunization is taken, eyeball excise bloodletting separates serum for positive antibody;At mouse cervical dislocation Extremely, 75% alcohol disinfecting 5min is moved into superclean bench, is fixed on shelf, cuts off skin respectively with sterilizing scissors, tweezers With film abdomen, sterile taking-up spleen puts people and has filled clear Xian in the sterilized petri dishes of basic culture solution, removes the connective group on envelope It knits;Spleen is moved into the plate that another fills 10mL basic culture solution and 0.22um copper mesh, with syringe needle tube in copper Online grinding spleen, splenocyte suspension in plate is transferred in 50mL centrifuge tube, and piping and druming mixes 1000rpm and is centrifuged 5min, uses 10mL basic culture solution, which is resuspended, to be mixed;
Step 4, cell fusion
It merges according to a conventional method, immune mouse spleen cell is taken to mix with myeloma cell SP2/0 by cell quantity 5:1,50mL is added Sterile centrifugation tube in, 1000rpm is centrifuged 5min, and abandoning supernatant with finger attack tube bottom mixes well two kinds of cells, until At paste;Centrifuge tube is placed in the beaker of 37 DEG C of water, the 50%PEG solution 1mL for drawing 37 DEG C of preheatings slowly drips in 45sec Enter, centrifuge tube is rotated in drop, static 1min is slowly dropped into the basic culture solution 1mL of 37 DEG C of preheatings in 45sec, in drop Centrifuge tube is rotated, 15sec is stood;Basic culture solution 2mL is instilled in 45sec, it is same to rotate centrifuge tube in drop;Then 4mL basic culture solution is added in 3min, finally add basic culture solution to 30mL be gently agitated for centrifuge tube make PEG thoroughly dilute and Lose fusion;800rpm is centrifuged 8min, abandons supernatant, and cell precipitation is gently suspended to preheating of the 50mL containing 20% fetal calf serum HAT is selected in culture solution, is uniformly mixed, is added in 96 porocyte culture plates added with feeder cells with multichannel pipettor, Every 100 μ L of hole, moves to 37 DEG C, 5%CO for culture plate2, cultivate in saturated humidity incubator.
4. the preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody according to claim 1, It is characterized in that, step (20) specifically:
Step 1, clone and amplification
The hybridoma colonies being detected as in the positive particular bore of secretion are blown afloat into mixing, cell Trypan Blue meter Number, takes above-mentioned cell suspension, is diluted to 10/mL cell, the cell that will have been diluted with the HT culture solution containing 20% fetal calf serum 100 μ L of suspension, which is added in 96 porocyte culture plates added with feeder cells in advance, to be cultivated;It is seen under microscope within the 10th day after clone It examines monoclonal hole and marks;It is operated by 3 time cloningizations, until when all cloning cell hole Positive rates are 100%, i.e., Determine the hybridoma cell strain for having obtained secrete monoclonal antibody;One plant of monoclonal antibody is filtered out, 3E6 is named as;
Step 2, cell cryopreservation
By Cryopreservation of Hybridoma Cells before each cloning, in addition obtain the hybridoma cell strain 3E6's of secrete monoclonal antibody It freezes;Vigorous, the good 3E6 cell centrifugation to be frozen of form will be grown, cell is adjusted to 3-5 × 10 with cells frozen storing liquid6 A/mL is added in 1.8mL cell cryopreservation tube, marks, then cryopreservation tube is put into freezing storing box, -70 DEG C of Low-temperature Ices In case overnight, it in second day investment liquid nitrogen container, and makes a record;
Step 3, cell recovery
A 3E6 cell cryopreservation tube is taken out at interval from liquid nitrogen container after one month, be put into rapidly in the beaker for filling 37 DEG C of water, Being kept stirred melts it rapidly, moves to superclean bench, and cell suspension is suspended in basic culture solution by sterile unlatching cryopreservation tube In, 1000rpm is centrifuged 5min washing, and cell precipitation is resuspended with 5mL complete culture solution, moves into Tissue Culture Flask, sets 5%CO2、 37 DEG C, cultivate in saturated humidity incubator;Whether verifying cell freezes;There is no problem for cell cryopreservation, grows after recovery vigorous.
CN201811046531.9A 2018-09-08 2018-09-08 A kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody Pending CN109136241A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811046531.9A CN109136241A (en) 2018-09-08 2018-09-08 A kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811046531.9A CN109136241A (en) 2018-09-08 2018-09-08 A kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody

Publications (1)

Publication Number Publication Date
CN109136241A true CN109136241A (en) 2019-01-04

Family

ID=64824065

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811046531.9A Pending CN109136241A (en) 2018-09-08 2018-09-08 A kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody

Country Status (1)

Country Link
CN (1) CN109136241A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110894215A (en) * 2019-12-16 2020-03-20 中国农业大学 Peste des petits ruminants virus antigen and colloidal gold immunochromatographic test paper card for detecting Peste des petits ruminants virus antibody
CN113308430A (en) * 2021-06-15 2021-08-27 广西大学 Dispersion culture method of banana colletotrichum gloeosporioides conidia
CN113391067A (en) * 2021-06-16 2021-09-14 军事科学院军事医学研究院军事兽医研究所 Indirect ELISA detection method of anti-nipah virus G protein antibody

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107586783A (en) * 2016-07-06 2018-01-16 华中农业大学 Anti- PPR virus N protein monoclonal antibody and its application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107586783A (en) * 2016-07-06 2018-01-16 华中农业大学 Anti- PPR virus N protein monoclonal antibody and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
严欢等: "小反刍兽疫病毒P 蛋白及非结构蛋白V表达特性研究", 《中国兽医杂志》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110894215A (en) * 2019-12-16 2020-03-20 中国农业大学 Peste des petits ruminants virus antigen and colloidal gold immunochromatographic test paper card for detecting Peste des petits ruminants virus antibody
CN113308430A (en) * 2021-06-15 2021-08-27 广西大学 Dispersion culture method of banana colletotrichum gloeosporioides conidia
CN113391067A (en) * 2021-06-16 2021-09-14 军事科学院军事医学研究院军事兽医研究所 Indirect ELISA detection method of anti-nipah virus G protein antibody
CN113391067B (en) * 2021-06-16 2023-07-25 军事科学院军事医学研究院军事兽医研究所 Indirect ELISA detection method for anti-Nipah virus G protein antibody

Similar Documents

Publication Publication Date Title
CN109136241A (en) A kind of preparation method of peste des petits ruminants V protein protokaryon and eukaryotic expression, purifying and monoclonal antibody
CN107815441A (en) A kind of II type Pseudorabies virus attenuated strain and its preparation method and application
JPH06506583A (en) Plant viruses modified as vectors
CN107841507A (en) A kind of porcine circovirus 2 type Cap cell-penetrating peptides antigen-4 fusion protein gene of high efficient expression and its application
CN103849632B (en) S1 gene of low virulent strain of infectious bronchitis and low virulent strain and application thereof
CN113061587B (en) Antigen spectrum expanded O-type foot-and-mouth disease virus strain and construction method and application thereof
CN107337718A (en) A kind of gene for encoding carrying Cap gene of porcine circovirus type 2 and its application
CN104195116B (en) A kind of recombinant Newcastle disease virus and its construction method for expressing goose parvovirus VP3 genes
CN110272473A (en) General virus-like particle of Flu-A and its preparation method and application
CN110368490B (en) Raccoon dog parvovirus enteritis and canine distemper bivalent inactivated vaccine and preparation method thereof
CN106636015B (en) Preparation method of chimeric newcastle disease virus-like particles
CN101441217B (en) Hog cholera antibody ELISA diagnosis reagent kit
CN107236039A (en) Recombinate Wzt albumen rabbit anteserum polyclonal antibodies and preparation method thereof
CN104725503B (en) A kind of Fugu rubripes nervous necrosis virus capsid protein Yolk antibody and its application
CN110042088A (en) A kind of bird flu H9N2 virus-like particle subunit vaccine
CN116926022B (en) PiNew castle disease virus mGZ of pigeon origin gene VI, application, preparation method, culture method and vaccine
CN107596361A (en) Subunit vaccine of bovine A-type clostridium perfringens and preparation method and application thereof
CN109207438A (en) Porcine pseudorabies virus velogen strain and its preparing the application in inactivated vaccine
CN111454989B (en) Chimeric gene type I encephalitis B virus-like particle vaccine and preparation method and application thereof
CN101322844B (en) Non-virus non-structural protein foot-and-mouth disease vaccine and preparation thereof
CN105974119B (en) G kinds enterovirus direct immunofluorescence reagent and its kit
CN108315335A (en) The drought-induced transcription factor PbrWRKY53 of pears and its application in terms of improving plant drought ability
CN107557391A (en) Based on the canine distemper sensitive cell line method for building up of Nectin4 acceptors and application
CN103336121B (en) Swine influenza virus H3 subtype colloidal gold detection kit as well as preparation method thereof
CN110331135A (en) The recombinant herpesvirus of turkeys candidate vaccine strain and preparation method of expressing gene VII type newcastle disease virus fusion protein

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190104