CN109136231B

CN109136231B - A kind of Mandarin fish TLR3 gene and its application

Info

Publication number: CN109136231B
Application number: CN201811076527.7A
Authority: CN
Inventors: 黄鹤忠; 路瑶; 叶金明; 肖攀; 李泽; 金锐铭; 董同瑚
Original assignee: Suzhou University
Current assignee: Suzhou University
Priority date: 2018-09-14
Filing date: 2018-09-14
Publication date: 2019-08-30
Anticipated expiration: 2038-09-14
Also published as: CN109136231A

Abstract

The invention discloses a kind of Mandarin fish TLR3 gene and its applications.The cDNA sequence nucleotide sequence of the TLR3 gene is as shown in SEQ ID NO:1, and the gDNA nucleotide sequence of the TLR3 gene is as shown in SEQ ID NO:2, and the amino acid sequence of the TLR3 gene is as shown in SEQID NO:3.TLR3 gene of the present invention can be respectively used to the detection of Mandarin fish pathogen infection initial stage, and the early diagnosis for Mandarin fish by virus or bacterium infection provides new approaches, is conducive to the early prevention and treatment of fish diseases, improve mandarin fish economic benefit of aquaculture；In addition, providing new approaches in terms of TLR3 gene of the present invention can also be used in the breeding of Mandarin fish Resistant gerplasm for the breeding work of Mandarin fish, being conducive to the genetic breeding process for promoting Mandarin fish, improve mandarin fish economic benefit of aquaculture.

Description

A kind of Mandarin fish TLR3 gene and its application

Technical field

The invention belongs to aquaculture, field of biotechnology more particularly to a kind of Mandarin fish TLR3 gene and its sticking up mouth Mandarin fish is by the application in terms of the detection at pathogen infection initial stage and Mandarin fish Resistant gerplasm breeding.

Background technique

Mandarin fish (Siniperca chuatsi), belongs to Perciformes (Perciformes), mandarin fish subfamily (Sinipercinae), mandarin fish category (Siniperca), be China rare economic fish and important freshwater aquiculture kind.However with Propagate the continuous expansion of scale artificially in recent years, phenomena such as germplasm of Mandarin fish degenerates, disease resistance decline, is commonplace, leads The exposure hair of the diseases such as toxicity of causing a disease is becoming increasingly rampant, and does not have highly effective control method so far, all causes every year serious Economic loss seriously constrains the sustainable development of its aquaculture.Therefore, Mandarin fish is examined by the early detection of pathogen infection Disconnected and Resistant gerplasm breeding is the important means for preventing and treating its disease and exposing hair.

The checkout and diagnosis of the infected virus of existing fish or bacteria pathogeny is tentatively sentenced according to the disease symptom of fish Disconnected, then solution takes disease sample tissue extraction cause of disease, then progress living body challenge viral dosage after purify, being identified, can just make a definite diagnosis whether It is morbidity cause of disease, and due to may be disease caused by a variety of cause of diseases or unknown pathogen, it is difficult to judge.It is not only time-consuming to take Power, operating difficulties, and since infected virus or the fish at bacteria pathogeny initial stage are without any disease symptom, existing skill Art can not make correct detection to it by virus or bacteria pathogeny initial infection in fish, when having missed best disease control Machine causes disease-controlling effect undesirable.

Carry out and cloned with the cDNA full length sequence of disease-resistant related gene, and utilizes Real-Time Fluorescent Quantitative PCR Technique (qPCR) Qualitative and quantitative detection disease-resistant related gene expression can activate in vivo according to infected virus or the fish at bacteria pathogeny initial stage The principle of disease-resistant related gene (molecular labeling) great expression, by detecting and analyzing the variation of disease-resistant related gene expression quantity, It can be used as the early stage auxiliary diagnosis foundation that Mandarin fish is infected cause of disease, be the effective means for improving Mandarin fish disease-controlling effect. Wherein, qPCR technology is to analyze a kind of common method and technology of gene expression profile, which be added in PCR reaction system Fluorophor, using the entire PCR process of the circulative accumulation real-time monitoring of fluorescence signal in the amplification reaction, eventually by certain number It learns principle and quantitative and qualitative analysis is carried out to unknown template, have the characteristics that sensitivity height, high specificity, quick and precisely, it can be with Gene expression difference etc. of the specific gene between different times or different disposal sample is analyzed, is a kind of strong detection gene The method of expression.

Existing fish breeding technique is to carry out breeding to fish according to the fish Apparent character that is observed visually, can not from The closely related gene of Apparent character (genetic molecule) difference angle carries out correct breeding to fish, does not simply fail to carry out early stage Breeding, offspring character be difficult to ensure that and the blindness of breeding is big, time-consuming and laborious.

Carry out and cloned with the gDNA full length sequence of disease-resistant related gene, and detects or screen disease-resistant using SNP marker Mandarin fish germ plasm resource, and then select disease-resistant population.Wherein, SNPs (single nucleotide polymorphism) refers to gene (gDNA) piece Single base in section changes, transversion, insertion or missing, SNP can be made to show polymorphism, also result in bion Between disease resistance isophenous there is difference.Have the characteristics that sensitivity height, high specificity, quick and precisely, is that improve fish excellent The effective means of character Breeding Efficiency.

In disease-resistant related gene, TLRs (Toll-like receptor) be the pattern-recognition that generates of single, non-catalytic, film by Body (PRRs), the associated molecular pattern (PAMP) of the energy various microorganisms of specific recognition (pathogen) are simultaneously activated and are expressed, And then active cell innate immunity signal path.TLR3 is most important one kind in TLRs, is positioned in the endosome of cell, It is to identify viral double-stranded RNA (dsRNA) and G in fish⁺Bacterium, G^-The receptor of bacterium, and participate in the disease-resistant former immune response of fish. For example, grass carp TLR3 can effectively participate in antiviral and body defenses process, in confrontation grass carp viral disease and adjust immune There is important role in protection.In addition, TLR3 has also assisted in the defence being infected by bacterial, and such as: after mouse is injected LPS, Internal TLR3 is significantly raised.But shortage is also compared in the current correlative study in relation to fish TLR3 gene cloning and function.

Summary of the invention

The primary purpose of the present invention is that a kind of Mandarin fish disease-resistant gene TLR3 (Toll-like receptor -3) full length sequence is provided, Including TLR3 cDNA and TLR3 gDNA.TLR3 is one of most important member in TLR family, and fish TLR3 is that identification virus is double Chain RNA (dsRNA) and G⁺Bacterium, G^-The receptor of bacterium, and the disease-resistant former immune response of fish is participated in, and related fish TLR3 gene Also seldom, important economic fish Mandarin fish TLR3 full length gene sequence is cloned, for the anti-of further researching fish TLR system Sick molecular mechanism and its application have important value.

A further object of the present invention is to provide above-mentioned TLR3 cDNA sequences in the detection of Mandarin fish pathogen infection initial stage Using the application is infected the aided diagnosis technique of cause of disease based on the expression of TLR3 gene mRNA come early detection Mandarin fish, leads to It crosses on the basis of Mandarin fish TLR3 cDNA clone of the present invention, it is infected viral or bacterium in Mandarin fish using qPCR technology In a few hours to a couple of days, by detecting the expression quantity of TLR3 in head-kidney in fish body, can tentative diagnosis Mandarin fish whether by disease Poison or bacterium infection provide more reliable foundation for the early prevention and treatment of fish diseases, and then increase the economic effect of fish culture Benefit.

Another object of the present invention is to provide application of the above-mentioned TLR3 gDNA in terms of Mandarin fish Resistant gerplasm breeding, The application is based on the Mandarin fish TLR3 gDNA that the present invention is had found, by its gene mononucleotide polymorphism (SNPs) and fish Class Apparent character combines, and with the SNP marker (or mutational site) of disease-resistant or non-disease-resistant fish TLR3 for foundation, can select Disease-resistant fish population improves the working efficiency of excellent kind of breeding, reduces the morbidity and mortality of breeding fish, this selects fish The technological progress educated has very important significance.

The invention is realized in this way a kind of Mandarin fish TLR3 gene, the cDNA sequence nucleotide sequence such as SEQ of the gene Shown in ID NO:1.

Preferably, the gDNA nucleotide sequence of the gene is as shown in SEQ ID NO:2.

The present invention further discloses a kind of Mandarin fish TLR3 albumen, the amino acid sequence of the albumen such as SEQID NO:3 institutes Show.

The present invention further discloses application of the above-mentioned Mandarin fish TLR3 gene in the detection of Mandarin fish pathogen infection initial stage.

Preferably, the application specifically includes the following steps:

(1) drawn according to TLR3-TRIF dependent form resistance signal's passageway related genes design specific amplification in Mandarin fish body Object, wherein TLR3-TRIF dependent form resistance signal's passageway related genes include TLR3, TRAF6, TAK1 and ikk β gene CDNA sequence；

(2) at Mandarin fish virus infection or bacterium initial stage, using qPCR detection method to the disease-resistant letter of TLR3-TRIF dependent form The significant responsing reaction of number passageway related genes mrna expression amount is detected and analyzed, and it is viral as fish body to will test result Or the auxiliary characteristics at bacterium infection initial stage.

The present invention further discloses application of the above-mentioned Mandarin fish TLR3 gene in terms of Mandarin fish Resistant gerplasm breeding.

Preferably, the application specifically includes the following steps:

(1) the gDNA sequence of TLR3 gene is cloned according to the cDNA sequence of TLR3 gene；

(2) it is used to expand the primer of disease-resistant SNP site according to the gDNA sequence design, amplification Mandarin fish TLR3 gene obtains Amplified production；

(3) amplified production is sequenced and finds out the doubtful site SNPs relevant to virus disease resistance, according to the peak DNA Shape figure determines SNP site, using determining SNP site as the molecular labeling of Mandarin fish Resistant gerplasm breeding.

Compared with the prior art the shortcomings that and deficiency, the invention has the following advantages:

(1) present invention has cloned Mandarin fish TLR3 cDNA full length sequence, TLR3 gDNA full length sequence for the first time, is fish The work such as disease-resistant breeding provide research and development basis；

(2) present invention establishes the qPCR detection technique of Mandarin fish TLR3 gene, based on the Mandarin fish of discovery by virus or The rule that TLR3 gene mRNA expression amount extremely significant (P < 0.01) changes in internal head-kidney in a few hours to a couple of days of bacterium infection, As Mandarin fish by the aided diagnosis technique of cause of disease early infection, the early diagnosis for Mandarin fish by virus or bacterium infection is mentioned For new approaches, be conducive to the early prevention and treatment of fish diseases, improve mandarin fish economic benefit of aquaculture；

(3) the invention detects that mandarin fish TLR3 gDNA gene SNP site relevant to virus disease resistance, to stick up mouth The breeding work of mandarin fish provides new approaches, is conducive to the genetic breeding process for promoting Mandarin fish, improves mandarin fish economic benefit of aquaculture.

Detailed description of the invention

Fig. 1 is the gel electrophoresis result after each stage amplification of Mandarin fish TLR3 gene；Wherein, Fig. 1 (A) is Mandarin fish TLR3 Gene cDNA 5 ' holds RACE second to take turns PCR agarose gel electrophoresis results, and swimming lane 1 is purpose segment；Fig. 1 (B) Mandarin fish TLR3 Gene cDNA 3 ' holds RACE second to take turns PCR agarose gel electrophoresis results, and swimming lane 1 is purpose segment；

Fig. 2 is that primer used in introne is added to carry out the gel electrophoresis result after the amplification of Mandarin fish TLR3 gene PCR；Its In, 26,27,30 in figure refer respectively to the DNA amplified with introne primer TLR3-26, TLR3-27, TLR3-30；It is used Marker is 5000bp；

Fig. 3 is the mRNA expression of TLR3 and TRIF dependent form passageway related genes in Mandarin fish head-kidney after virus infection Amount variation；Wherein, it is as a result shown in the form of means ± SEM.* indicate have significant difference (P < 0.05) with control group, * * table Showing has extremely significant sex differernce (P < 0.01) with control group；

Fig. 4 is 4 genes in TLR3 and TRIF dependent form signal path in Mandarin fish head-kidney after bacterium infection Mrna expression amount variation；Wherein, it is as a result shown in the form of means ± SEM.* indicate with control group have significant difference (P < 0.05), * * indicates there is extremely significant sex differernce (P < 0.01) with control group；

Fig. 5 is the screenshot of the DNAMA sequence alignment result after the PCR product sequencing of Mandarin fish TLR3-27 primer；Wherein, Base C of the H4 sample in the position 416bp sports base T；

Fig. 6 is that the chromas software after the PCR product sequencing of Mandarin fish TLR3-27 primer analyzes DNA peak shape generated Scheme, the TLR3 gDNA base C homozygote of Mandarin fish sample is unmutated in the figure；

Fig. 7 is that the chromas software after the PCR product sequencing of Mandarin fish TLR3-27 primer analyzes DNA peak shape generated Scheme, the TLR3 gDNA base mutation of Mandarin fish sample is T homozygote in the figure.

Specific embodiment

In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to the accompanying drawings and embodiments, right The present invention is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, and It is not used in the restriction present invention.

Embodiment

One, the clone of Mandarin fish TLR3 cDNA

TLR3 gene cDNA expands the primer, as shown in table 1 below:

The sequence of 1 TLR3 gene cDNA of table amplification the primer

Primer	Primer sequence (5 ' -3 ')	Purpose
			GSP-TLR3-1	GCAGGAGACCTTCTTC	TLR3 5’
GSP-TLR3-2	CGGTCCCGTCATAAAATAAC	TLR3 5’
			GSP-TLR3-3	CGGGAGGAGAAGGGAACG	TLR3 5’
3’CDS Primer A	AAGCAGTGGTATCAACGCAGACTAC	TLR3 3’
			GSP-TLR3-4	TATCTCGCTCACTCTTCCTCCGCAG	TLR3 3’
GSP-TLR3-5	GCCTGTCCATAAGGAGAGGGTGCC	TLR3 3’
			AUAP	GGCCACGCGTCGACTAGTAC	General 5 '-Race
AAP	GGCCACGCGTCGACTAGTAC(G)16	General 5 '-Race
			UPM	CTAATACGACTCACTATAGGGC	General 3 '-Race

1, the amplification of 5 ' terminal sequence of Mandarin fish TLR3

(1) synthesis, purifying and the tailing of the first chain of cDNA

TLR3 first is carried out to extracted total serum IgE with SUPERSCRIPT II RT enzyme, primer GSP-TLR3-1 (table 1) The synthesis of chain cDNA.RNA is carried out using cDNA of the RNase Mix to synthesis to handle.Wherein, reverse transcription system are as follows:

70 DEG C be incubated for 10 minutes, be placed at once on ice 1 minute to open RNA secondary structure, it is of short duration that liquid is collected by centrifugation, press Book continues to add following system as directed:

It is centrifuged after mixing gently, 42 DEG C are incubated for 1 minute, then add 1 μ l SUPERSCRIPT II RT, incubate for 42 DEG C after mixing After educating 50 minutes, 70 DEG C, the reaction of stopping in 15 minutes, centrifugation is placed on 37 DEG C, adds 1 μ l of RNase mix, reacts 30 minutes, right It is carried out after purification, and using TdT enzyme and dCTP to the end cDNA after purification plus after poly (c), cryo-conservation is spare.

(2) 5 ' end rapid amplifying of cDNA

Bridging rivet primer AAP (table 1) using band in primer GSP-TLR3-2 and kit is to having added dC tail CDNA carries out the amplification of the PCR first round and adds 5 '-RACE reaction systems in the following order according to specification:

PCR response procedures are as follows: 94 DEG C of initial denaturation 2min, 94 DEG C of denaturation 30s, 55 DEG C are reanalysed annealing 30s, 72 DEG C of extensions 1min, 30 circulations, last 72 DEG C extend 7min eventually.

Nest-type PRC is carried out using the bridging universal amplification primer AUAP (table 1) of band in primer GSP-TLR3-3 and kit Second wheel amplification, system are as follows:

PCR response procedures are as follows: 94 DEG C of initial denaturation 2min, 94 DEG C of denaturation 30s, 59 DEG C are reanalysed annealing 30s, 72 DEG C of extensions 1min, 32 circulations, last 72 DEG C extend 7min eventually.

Second wheel PCR product is subjected to Ago-Gel (1.2%) electrophoresis, is used in plastic recovery kit (raw work, Shanghai) Gel extraction is carried out to purpose band (Fig. 1-A).PCR product after recovery purifying is cloned on pMD18-T carrier (TaKaRa), picking positive colony send sequencing, obtains effective target fragment.

2, the amplification of 3 ' terminal sequence of Mandarin fish TLR3

(1) synthesis, purifying of the first chain of cDNA

With SUPERSCRIPT II RT enzyme, 3 ' CDS primer A (SMARTer of primer^TM RACE cDNA Amplification Kit, Clontech) the total serum IgE progress reverse transcription of (table 1) to extraction, 3 ' CDS of the primer Primer A, other compositions hold amplification identical with condition 5 '.

(2) end cDNA rapid amplifying

Using primer GSP-TLR3-4 and UPM (table 1), the amplification of the PCR first round is carried out as template using the cDNA synthesized before, According to specification, 3 '-RACE reaction systems (response procedures are with 5 ' amplification programs) are added in the following order:

The PCR product of first round amplification is diluted 50 times, the second wheel PCR amplification is carried out, removes primer GSP-TLR3-4 and UPM Outside, other systems are identical with first round amplification, and response procedures are the same as 5 ' amplification programs.It is solidifying that agarose is carried out to the second wheel PCR product Glue (1.2%) electrophoresis is cloned on pMD18-T carrier (TaKaRa) purpose band (Fig. 1-B) gel extraction, and picking is positive Clone, send sequencing.It is completely serial to obtain Mandarin fish TLR3 cDNA, as shown in SEQ ID NO:1, Mandarin fish TLR3 cDNA's Encoding amino acid sequence is as shown in SEQ ID NO:3.

Two, the acquisition of Mandarin fish TLR3 gDNA sequence

The TLR3 gDNA structure referring to known to other fish includes the design amplification of Mandarin fish TLR3 cDNA complete segment The specific primer of son, as shown in table 2 below:

2 TLR3 gDNA complete sequence introne of table segmentation amplification the primer

Primer	Primer sequence (5 ' -3 ')	Purpose
			TLR3-30F	TGTGCTCCTCGTTCCCTT	TLR3-Intron1
TLR3-30R	GGTTGAGGACATGTAGAAAGG	TLR3-Intron1
			TLR3-24F	AGCCTGAAGTTTCTTGATGTT	TLR3-Intron2
TLR3-24R	TTTCAGACTTTTGAGTCCCTG	TLR3-Intron2
			TLR3-27F	GTCATGGATTTTGACACCCTC	TLR3-Intron3
TLR3-27R	TTATTGGAATTTTGGCTGATG	TLR3-Intron3

Using Mandarin fish genomic DNA as template, fragment section PCR amplification, amplification program are carried out to the gene are as follows: 94 DEG C of pre- changes Property 5min, 94 DEG C of denaturation 30s, 52 DEG C of annealing 30s, 72 DEG C of extension 1min, 30 circulation, it is last 72 DEG C eventually extend 10min.Design The segment of amplification will contain overlapping region, be convenient for subsequent sequence assembly；Agarose gel electrophoresis band is selected after verifying repeatedly The segment that single and length meets is connected into pUmc-T carrier, 10 μ using carrier T PCR product Cloning Kit (TAKARA) L system (table 3), 4 DEG C overnight.Wherein, the amount (ng) of PCR fragment=[be added carrier amount (ng) × Insert Fragment size (kb)/ Carrier size (kb)] × Insert Fragment and carrier molar ratio.Picking positive colony, sequencing.Using artificial comparison and DNAMAN Software splices sequence obtained, Mandarin fish TLR3 gDNA complete genome sequence is obtained, as shown in SEQ ID NO:2.

Target fragment is cloned into the reaction system on pUmc-T carrier by table 3

Three, Mandarin fish TLR3 and TLR3-TRIF dependent form resistance signal's passageway related genes (TRAF6, TAK1 and ikk β) the qPCR detection method of mrna expression amount

1, gene used and design of primers

The Mandarin fish obtained according to above-mentioned resulting Mandarin fish TLR3 cDNA sequence and access GenBank database TRAF6, TAK1, ikk β gene cDNA sequence, design the qPCR primer of each gene, and β-actin is qPCR reference gene.It is each Gene primer is as shown in table 4.

Gene used in 4 qPCR of table and primer sequence information

2, the extraction and quality testing of sample total serum IgE

Take Mandarin fish respectively organize to exist side by side it is quick-frozen i.e. in liquid nitrogen, grind respectively it is each tissue to be homogenized, it is total using AxyPrep RNA Miniprep Kit (AXYGEN, the U.S.) extracts total serum IgE, and the specific method is as follows:

(1) it takes 20~40mg to organize, is transferred in the mortar of pre-cooling, liquid feeding nitrogen grind into powder.RNA tissue abundant (such as liver) is no more than 30mg；The low tissue of rna content (such as muscle) is no more than 100mg；

(2) 400 μ l Buffer R- I are added, are aspirated repeatedly 8~10 times with the syringe equipped with 21~No. 25 syringe needles, turn Enter in 1.5ml centrifuge tube.

(3) 150 μ l Buffer R- II are added, vortex oscillation 15~30s, 12,000 × g are centrifuged 5min (it is recommended that at 4 DEG C Lower centrifugation).

(4) it takes supernatant into 1.5ml centrifuge tube, 250 μ l isopropanols is added, are mixed evenly；

(5) pipe will be prepared to be placed in 2ml centrifuge tube (providing in kit), the mixed liquor in transfer step 4 is managed to preparation In, 6,000 × g is centrifuged 1min (it is recommended that being centrifuged at 4 DEG C).

(6) filtrate is abandoned, pipe will be prepared and put back into 2ml centrifuge tube, prepares and 500 μ l Buffer W1A is added in pipe, 12, 000 × g centrifugation 1min (pressed the volume specified on reagent bottle in Buffer W1A concentrate and anhydrous second be added by confirmation Alcohol).

(7) filtrate is abandoned, pipe will be prepared and put back into 2ml centrifuge tube, prepares and 700 μ l Buffer W2 is added in pipe, 12, 000 × g is centrifuged 1min；It washed once and (confirm in Buffer W2 with 700 μ l Buffer W2 again in the same way The volume specified on reagent bottle has been pressed in concentrate, dehydrated alcohol is added).

(8) filtrate is abandoned, pipe will be prepared and put back into 2ml centrifuge tube, 12,000 × g is centrifuged 1min.

(9) pipe will be prepared to be put into a clean 1.5ml centrifuge tube (providing in kit), adds 70 preparing periosteum center ~100 μ l Buffer TE or RNase-free water.

(10) it is stored at room temperature 1min, 12,000 × g is centrifuged 1min, elutes to obtain RNA.

After being detected to mentioned RNA mass and concentration, chooses and reaches -80 DEG C of RNA sample of quality requirement and save backup, For subsequent experimental.

3, RNA quality inspection

Using the quality and concentration of the mentioned RNA product of 2000 ultramicron UV spectrophotometer measuring of NANODROP, go forward side by side Row agarose electrophoresis checks its integrality.This step is repeated if the RNA quality dissatisfaction extracted to be extracted again until obtaining Up-to-standard RNA sample.

4, the synthesis of the first chain of cDNA

(1) synthesis, purifying and the tailing of the first chain of cDNA

5, the identification preliminary experiment of primer specificity and amplification efficiency

Before formally carrying out qPCR experiment, the production of progress substrate diluted concentration and standard curve first determines all draw The specificity and amplification efficiency of object, to ensure the accuracy of experimental result.Therefore, regular-PCR expansion has been carried out before upper machine analysis Increase and drafting of cloning and sequencing, melt curve analysis and standard curve etc. operates, it is ensured that the specificity and amplification efficiency of the primer pair Meet upper confidential the asking of real time fluorescent quantitative experiment.

6, the qPCR detection of target gene

By the RNA of extraction and the cDNA of reverse transcription dilutes in proportion, is expanded with above-mentioned each pair of primer, and detection dissolution is bent After line and amplification curve and determining optimum reaction condition, use2×GreenStarTM qPCR PreMix (Bioneer, South Korea) kit carries out qPCR detection, reaction condition are as follows: 95 DEG C of initial denaturations on fluorescence quantitative PCR instrument 10min, then 95 DEG C of 15s, 60 DEG C of 30s, 40 circulations.

7, data process&analysis

The mrna expression amount of target gene uses 2^-ΔΔCtMethod carries out processing analysis to experimental data using Excel 2007, Wherein Δ Δ Ct=[(Ct_{Target gene (experimental group)}- Ct_{β-actin (experimental group)})-(Ct_{Target gene (control group)}- Ct_{β-actin (control group)})], it uses SPSS17.0 carries out variance analysis to the data obtained and detects its otherness, and P < 0.05 shows there is significant difference, and P < 0.01 shows There is extremely significant sex differernce.

Four, the disease-resistant SNP marker detection of Mandarin fish

(1) according to the sequence of Mandarin fish TLR3 gDNA, design primer (table 5), PCR reaction system is as shown in table 6.

Table 5 expands Mandarin fish TLR3 gene and obtains primer sequence used in disease-resistant SNP site

Primer	Primer sequence (5 ' -3 ')
		TLR3-27F	GTCATGGATTTTGACACCCTC
TLR3-27R	TTATTGGAATTTTGGCTGATG

Table 6 expands the PCR reaction system that Mandarin fish TLR3 gene obtains disease-resistant SNP site

Ingredient	Volume (μ l)
		Template DNA	2
Primer R (10 μ l)	1
		Primers F (10 μ l)	1
2×Easy Taq PCR Super Mix	25
		ddH₂O	21
It is total	50

The step of above-mentioned PCR amplification: (1) 94 DEG C initial denaturation 5 minutes；(2) 94 DEG C are denaturalized 30 seconds；(3) 51 DEG C are annealed 30 seconds； (4) 72 DEG C extend 1 minute, and totally 32 recycle；(5) 72 DEG C extend 10 minutes；(6) 4 DEG C of reactions terminate.

(2) 1.5% agarose gel electrophoresis of PCR product obtains single, bright, without hangover and not no miscellaneous band Pcr amplification product after rubber tapping, is sequenced immediately.

(3) Multiple Sequence Alignment is done to sequencing result using DNAMAN software, found out relevant to virus disease resistance doubtful Then the site SNPs checks DNA peak shape figure according to Chromas software, judges whether it is set peak, so that it is determined that SNP site out.

Effect example 1 is judged based on the changing rule of TLR3 gene mRNA expression amount in Mandarin fish body by cause of disease (disease Poison or bacterium) infection aided detection method

In order to obtain TLR3 gene in Mandarin fish respectively by Different Kinds of Pathogens (virus or bacterium) metainfective answer-mode And TLR3-TRIF dependent form resistance signal passageway related genes (TLR3, TRAF6, TAK1 and ikk β) response pattern, sticking up mouth Mandarin fish respectively by Different Kinds of Pathogens (virus or bacterium) infection after, detected and analyzed using the method for qPCR Mandarin fish TLR3, The mrna expression amount of TRAF6, TAK1 and ikk β gene changes.The result shows that after a few hours to a couple of days of cause of disease invasion fish body, TLR3-TRIF dependent form resistance signal passageway related genes (TLR3, TRAF6, TAK1 and ikk β) show significant molecule Responsing reaction.Wherein, TLR3 is guide's gene, and the response of its mrna expression amount is the strongest, thus can be used for Mandarin fish and be The no auxiliary diagnostic index by virus or bacterium infection, this is provided for Mandarin fish by viral or bacterium infection early diagnosis New approaches, are conducive to the early prevention and treatment of fish diseases.

Infectious spleen and kidney necrosis virus (ISKNV) and Aeromonas hydrophila (Aeromonas hydrophila) are that mandarin fish is supported The virus and bacteria pathogeny for endangering most serious in production are grown, is tested to the cause of disease (infectious spleen for causing the death of Mandarin fish fulminant Dirty and kidney necrosis virus and Aeromonas hydrophila) exposure experiment has been carried out, real-time detection Mandarin fish TLR3 gene is not respectively by The metainfective answer-mode of same cause of disease (virus or bacterium) and TLR3-TRIF dependent form resistance signal's passageway related genes (TLR3, TRAF6, TAK1 and ikk β) response pattern.

Experimental method: one shares the Mandarin fish of 100 tails health, and average weight 42.63g is placed on the water of flow promoter system Start to test after having carried out adaptation in two weeks in race's case, cultivating condition is uninterrupted inflation, and 26 DEG C of water temperature, daily feeding is three times. Before infection experiment, 10 tail fishes of random selection check internal infectious spleen and kidney necrosis virus (ISKNV) and Aeromonas hydrophila Etc. common cause of disease, it is ensured that there is no after cause of disease, experiment fish is randomly divided into 3 groups of (infection group and viral infection group, bacterial infections, controls Group), every group of 20 tails.Experiment fish is injected intraperitoneally using asepsis injector, infection group and viral infection group injects 6 × 10 respectively⁶GE/mL ISKNV solution (0.3ml/ tail), bacterial infections inject 1.0 × 10 respectively⁵CFU/mL Aeromonas hydrophila solution (0.3mL/ Tail), separately to inject isometric PBS buffer solution as a control group.Respectively 3h, 6h after injection, 12h, for 24 hours, 48h and 72h Afterwards, each group Mandarin fish spleen and head-kidney are acquired, in the EP pipe after being put into label, Liquid nitrogen storage simultaneously is used to extract RNA.According to described " Mandarin fish TLR3 and TLR3-TRIF dependent form resistance signal passageway related genes (TRAF6, TAK1 and ikk β) in embodiment The qPCR detection method of mrna expression amount ", the expression result of variations for obtaining the related genes such as Mandarin fish TLR3 are as follows:

(1) expression of TLR3 and TRIF dependent form passageway related genes changes under virus infection

Respectively to Mandarin fish be injected intraperitoneally ISKNV after 3h, 6h, 12h, for 24 hours, after 48h, 72h, in correct nephridial tissue TLR3, TRAF, TAK1 and ikk beta gene expression situation are measured.And it is compared with the control group of injection PBS buffer solution, institute The opposite mrna expression amount of different time points in each gene different tissues obtained.

In head-kidney, for TLR3 in 3h by extremely significant induction, mrna expression amount has reached 150 times (P < 0.01) of control group, Although its expression quantity is fallen after rise later, its expression quantity is extremely significant in 72h is higher than control group (P < 0.01).TRAF6 base Because the expression rule in head-kidney in 48h is consistent with TLR3 gene, there is the extremely significant expression higher than control group and respond. TAK1 its expression quantity in 72h is extremely significant to be higher than control group (P < 0.01).Ikk β is in 72h except 12h to remaining in addition to for 24 hours The mrna expression amount of various time points is extremely significant to be higher than control group (P < 0.01) (Fig. 3).Therefore, after virus infection Mandarin fish 72h in TRAF6, TAK1 and ikk β gene mRNA expression amount on TLR3 gene and this access in its head-kidney show Extremely significant increase can be used as auxiliary diagnosis skill of the Mandarin fish by virus causing disease early infection by the detection of this qPCR method Art provides new approaches for the detection that Mandarin fish is caught an illness.

(2) expression of 4 related genes changes in the Mandarin fish TRIF dependent form access under bacterium infection

To Mandarin fish be injected intraperitoneally Aeromonas hydrophila after 3h, 6h, 12h, for 24 hours, after 48h, 72h, to its head-kidney group TLR3, TRAF6, TAK1 and ikk beta gene expression situation in knitting is measured.And it is carried out with the control group of injection PBS buffer solution Compare, resulting each gene after bacterium infection respectively tissue in 72h mrna expression amount variation, as shown in Figure 4.

In head-kidney, mrna expression amount of the TLR3 in 3h, 6h and 72h is extremely significant to be higher than control group (P < 0.01), wherein It is higher than 17.40 times (P < 0.01) of control group in the expression quantity of 6h, its expression quantity maintains 1.1~2.0 times of control group later Between, occur second expression peak value (P < 0.01) again in 72h.After the expression trend of TRAF6 and TAK1 all presents first raising Reduce last raised changing rule.And ikk β is adjusted to 8.76 times (P < 0.01) (Fig. 4) of control group on 72h is extremely significant.Cause This, TRAF6 the and TAK1 gene on the TLR3 and this access in its head-kidney of 3h, 6h and 72h after bacterium infection Mandarin fish Mrna expression amount shows extremely significant increase, by the detection of this qPCR method, can be used as Mandarin fish by bacteria pathogeny early stage The aided diagnosis technique of infection provides new approaches for the detection that Mandarin fish is caught an illness.

Disease-resistant SNP marker testing result of the effect example 2 based on Mandarin fish TLR3 gene

The Mandarin fish of the same group is cultivated according to same rearing conditions, cultivation two months or so after, from support 50 tails are selected in the group grown at random, weight average 46.83g carries out challenge test, and the every tail fish of each group is passed by intraperitoneal injection Metachromia spleen and kidney necrosis virus (ISKNV) injection 3 × 10⁸GE/mL ISKNV solution (0.3ml/ tail), is observed continuously 10 days, observation Identical as ISKNV disease symptom is infected under natural environment to its disease symptom, morbidity fish slowly or even directly floats in water surface travelling It bubbles through the water column, for body surface without breakage, body colour is partially white, and whitening for ischemic shape is presented in the fish gill, and dissection discovery: there are more ascites, liver in abdominal cavity Dirty, stomach wall, intestinal wall are congested, have yellow hydrops in enteron aisle；Occur disease symptom before 7th day is considered as severe morbidity fish；8th day Occurred that being considered as disease symptom be light, moderate morbidity fish to the 10th day；Do not occur within 10th day disease symptom yet is considered as disease-resistant fish. PCR detection morbidity Mandarin fish head-kidney is the ISKNV positive, shows that its pathogenic factor is due to caused by infection ISKNV.

It chooses 4 tail of disease-resistant fish therein (labeled as H1~H4), light, moderate morbidity 4 tail of fish (being labeled as H5~H8), severe It falls ill 11 tail of fish (be labeled as B1~B11), cuts a small amount of tail fin of fish respectively and be put into dehydrated alcohol at 4 DEG C and carry out low temperature It saves.By the disease-resistant SNP marker detection method recorded in above-described embodiment, pcr amplification product is obtained, as shown in Fig. 2, rubber tapping Afterwards, it is sequenced, carries out Multiple Sequence Alignment with DNAMAN software, found out and virus disease at the 416bp that TLR3 gDNA segmentation is sequenced The relevant doubtful SNP site of resistance, as shown in Figure 5.

Check that the base of doubtful mutation in above-mentioned sequence is segmented the 416bp's of sequencing in TLR3 gDNA with Chromas software Peak shape figure, as shown in fig. 7, base is mutated really, is converted to T by C at the 416bp of TLR3 gDNA segmentation sequencing. For TLR3 gDNA full length sequence, this mutation occurs on the introne of DNA, positioned at the 3586bp of TLR3 gDNA sequence Place, 1 sample (H4) that base morphs is disease-resistant Mandarin fish；And the base for the position fish TLR3 gDNA of falling ill is C, Base mutation (Fig. 6) does not occur.Therefore, the TLR3 gene SNP site of disease-resistant Mandarin fish is C3586T, is the base at 3586bp The mutation for being converted to T by C has occurred, the Mandarin fish of antiviral Mandarin fish and susceptible virus can be identified by the method.

The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.

Sequence table

<110>University Of Suzhou

<120>a kind of Mandarin fish TLR3 gene and its application

<141> 2018-09-04

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3180

<212> DNA

<213> Siniperca chuatsi

<400> 1

tcggagttgg cgggtgcgcg gtggtttggg tcggggtgca tcaggggtgg tccatgtctt 60

cgttatttta tgacgggacc gaggcggccg ggaccgaggg ggggatctcg gggtgcgggg 120

cgggcgcagt gggtccgggc tcagagaggg cgggctgcac ggtgggagat aatatgcaaa 180

ggcaaaatct ggtctttgga attatgtgtg ctcctcgttc ccttctcctc ccggccgtga 240

tcatcgtatg ttattttatg acgggaccgt acaattgcgt gggcgccctg aagaaggtct 300

cctgcgatgt gcaagatggc cgagctgact gcagccacct cagcctcagt gcagtccctc 360

caaaccttcc caggaacatc accacactgg atatgtctca caaccgattg aaggggattc 420

ctcctgtgtc actaatccca tacccaggcc tcctccacct tgatgtcagt tacaacagta 480

tcagcaagct ggacaagggt ttgtgccaga cactgtctct gctgcagaca ctgaatatgg 540

aacacaatca agtgcttttg ctgaagaagg aggacgtgag ccattgcacc aatctaacac 600

ggttgattct ggctagtaat aggctaaagc tacaaggaga gcccttctct gcactacaga 660

gcctgaagtt tcttgatgtt tccataaaca aactgcagtc agccaagctc ggctctcagc 720

ctcaactgcc cagcctggtg aacctcaatc tggcattcaa tgagttcacc accctgaaga 780

aagatgactt ttccttcctt aaccattcat cctttctaca tgtcctcaac ctgtcatccg 840

tgtctctaaa aacattggag gctggttgct ttaagcccat ttcaagccta catactttaa 900

tcatggatgg gagcaatatg ggcactctgg gtatttctaa actctgttca gagctgtcag 960

ggacagccat tgatgccctg tctcttcgga atatgaagct ggtcacactc acaaaaccaa 1020

ccttcaaagg gctacagaaa acaaatctaa cctttctgga tctgtcccat aatggcatgg 1080

gtaaaattga agaaggctca tttcagtggc tgtccacact tcagactcta attttggcag 1140

acaacaacat taagcacctg accaaggaca catttcaggg actcaaaagt ctgaaaaaac 1200

tccagttgac aaaagctctg gtgaaaagta aaacctctgc cactccaatt attgatgatt 1260

tctccttcca accattaagt accctggaga gtttgatatt acagagaact gcaattcggg 1320

aaattacgga gcacacgttt acaggcttga caagtcttaa agaacttgat atgagctgga 1380

gtcattatac ctcactcaga aacatcacca acaagacctt agtctcactt gcgggatcac 1440

ctctcagaaa gctaaatctg acaggaacag atataacaca gattaatcct ggaagcttct 1500

ccgttttgaa aaacctcacc actcttcttc tagattttaa ctttatcaaa caaactctca 1560

ctggcaaaga gtttgaaggc ctggataaag ttcaagagat tcgcatgtcc aataaccacc 1620

agactgtcaa tctaagctcc atgtcgtttg ctaatgtgcc caatcttagg atcctgactt 1680

tgggaaaaag tcttaaagcc acagccttga acctggatcc ctctccattc agtctcctga 1740

ccaacctcac cttcctggat ctcagcaaca acaacattgc taacatcaaa gagaatatgg 1800

tggaggggct tgtgaacctg aaggtgctga agctccaaca caataactta gcccgttttt 1860

ggaagagtgc caacctaggt gggccggtgt tgtttctcaa aggggcacag agcttgataa 1920

gcttacagct ggatagtaac gggctggatg agatcccagc agaggctctg agagggttga 1980

gtaaccttcg tgagctaagc ctggccaaca atctccttaa tagtcttaag gactcaattt 2040

ttgatgatct gaactcactg cgggctttat atttacagaa gaatctgatc acaactgtga 2100

ggcccgaagt gttcaaaact cctatgagca acctcagcct gcttgtcatg ggcaaaaatc 2160

catttgactg cacatgtgag agcatcctgt ggtttgtgac atggttgaat agcacaaata 2220

tgagcagtgt gccaggtctc agggagcagt atatgtgcaa cactccacta gcttacttta 2280

accactctgt catggatttt gacaccctct cttgcaaaga tatgacccca tttcaggctc 2340

tttacatact gagcagcaca gctgttatca tgctgacagt aactgcactt ctggtgcggt 2400

tccatggctg gaggattcag ttctattgga acatactgat caatcggaca ttaggattta 2460

gtgacgccaa agttgaagag ggcagggaat ttgagtatga tgcttacatc atacatgcag 2520

aggaagacag caactgggtg gagagaaggt tggtcccttt agagaaggga aagtgccagt 2580

tttgtttgga ggatcgagat ttcgtccctg gcacgtcaaa gcttgaaagc attgtgcata 2640

atatgagaag gtccagaaaa atcttgtttg tcgtcactga aattcttctc aacgatccct 2700

ggtgtagacg atttaaagcc catcatgcac ttcatcaggt cattgaagcc agcagggacg 2760

ctgtggttct ggtattcctg caggatgttc acgactacaa gttatctcgc tcactcttcc 2820

tccgcagggg catgttgcgt tcatgctgca tcctggactg gcctgtccat aaggagaggg 2880

tgccggcctt tcaccagaag ctcctcatag cacttggcat gactaatcga ttgcaggagt 2940

gactgtattc cactggtaat aatggaaaat tccctttgta ataataatta cctatgtaag 3000

ttaaattatt acgaattgct gccaattgct tattgtttta ccctctgtgt gaatattgta 3060

cttatatatg tactgcactc tgtatcatgt gtcgtattta cattgcattg cagctttaca 3120

tcagccaaaa ttccaataaa acacaagtat tccaaaaaaa aaaaaaaaaa aaaaaaaaaa 3180

<210> 2

<211> 4251

<212> DNA

<213> Siniperca chuatsi

<400> 2

tcggagttgg cgggtgcgcg gtggtttggg tcggggtgca tcaggggtgg tccatgtctt 60

cgttatttta tgacgggacc gaggcggccg ggaccgaggg ggggatctcg gggtgcgggg 120

cgggcgcagt gggtccgggc tcagagaggg cgggctgcac ggtgggagat aatatgcaaa 180

ggcaaaatct ggtctttgga attatgtgtg ctcctcgttc ccttctcctc ccggccgtga 240

tcatcgtatg ttattttatg acgggaccgt acaattgcgt gggcgccctg aagaaggtct 300

cctgcgatgt gcaagatggc cgagctgact gcagccacct cagcctcagt gcagtccctc 360

caaaccttcc caggaacatc accacactgg atatgtctca caaccgattg aaggggattc 420

ctcctgtgtc actaatccca tacccaggcc tcctccacct tgatgtcagt tacaacagta 480

tcagcaagct ggacaagggt ttgtgccaga cactgtctct gctgcagaca ctgaatatgg 540

aacacaatca agtgcttttg ctgaagaagg aggacgtgag ccattgcacc aatctaacac 600

ggttgattct ggctagtaat aggctaaagc tacaaggaga gcccttctct gcactacagg 660

tacagatgtc agttacactg atgagttgga tcagtaatag ctggagagaa actgactgag 720

ctagggtgca ataatggtga tgatgacaga aatgaaacaa tgaaatcata gtgaatagta 780

atttttagat tatttttttt ccccccgata agctaaccgc ctgctggctc ctgcaacatg 840

tgacggttta tgtaacacgt aagctaataa aacattagaa caaaaaagca tgcagcaaca 900

gaaaagaaga gaatagaaga aaaagagagt actaaaatca gcagagaggc aaaaaatcaa 960

tacataagga cagtatcgat tatgatacag atgaattact ttatgagaaa gctaaactat 1020

aattaaaaca aagaggtgct tttaaatcaa tctgtgtagg tgcggctcaa caggaatgct 1080

gcttatgcta taggtaaata aatgttgagt gctatctcac cagatgtgga ggaagctgta 1140

gggacatgga gggaggagtc ttgtgaccgg agagagctgc tgcatttttt aattgagatc 1200

atgtctgaag tatgctgtgg agcatggcat caagaggttt atacaccaaa agtaggaaca 1260

atgtcacttt tgggggttag attgtttgat aatgcctcac atgcattgca ttaaataaca 1320

ctttattttg tgtttattct cctttcataa ttcacagagc ctgaagtttc ttgatgtttc 1380

cataaacaaa ctgcagtcag ccaagctcgg ctctcagcct caactgccca gcctggtgaa 1440

cctcaatctg gcattcaatg agttcaccac cctgaagaaa gatgactttt ccttccttaa 1500

ccattcatcc tttctacatg tcctcaacct gtcatccgtg tctctaaaaa cagtaagaaa 1560

cctacctaga aaggggaaat gaaatggtgt tgtcaaaatt ttaaccagtc gtagaaagtc 1620

gagttattgt gatacctggc tttcagttgt ctgttttgtt tcgtttccct tttttgtctc 1680

actgcaagat ctctttgtta tgttttgttg cagttggagg ctggttgctt taagcccatt 1740

tcaagcctac atactttaat catggatggg agcaatatgg gcactctggg tatttctaaa 1800

ctctgttcag agctgtcagg gacagccatt gatgccctgt ctcttcggaa tatgaagctg 1860

gtcacactca caaaaccaac cttcaaaggg ctacagaaaa caaatctaac ctttctggat 1920

ctgtcccata atggcatggg taaaattgaa gaaggctcat ttcagtggct gtccacactt 1980

cagactctaa ttttggcaga caacaacatt aagcacctga ccaaggacac atttcaggga 2040

ctcaaaagtc tgaaaaaact ccagttgaca aaagctctgg tgaaaagtaa aacctctgcc 2100

actccaatta ttgatgattt ctccttccaa ccattaagta ccctggagag tttgatatta 2160

cagagaactg caattcggga aattacggag cacacgttta caggcttgac aagtcttaaa 2220

gaacttgata tgagctggag tcattatacc tcactcagaa acatcaccaa caagacctta 2280

gtctcacttg cgggatcacc tctcagaaag ctaaatctga caggaacaga tataacacag 2340

attaatcctg gaagcttctc cgttttgaaa aacctcacca ctcttcttct agattttaac 2400

tttatcaaac aaactctcac tggcaaagag tttgaaggcc tggataaagt tcaagagatt 2460

cgcatgtcca ataaccacca gactgtcaat ctaagctcca tgtcgtttgc taatgtgccc 2520

aatcttagga tcctgacttt gggaaaaagt cttaaagcca cagccttgaa cctggatccc 2580

tctccattca gtctcctgac caacctcacc ttcctggatc tcagcaacaa caacattgct 2640

aacatcaaag agaatatggt ggaggggctt gtgaacctga aggtgctgaa gctccaacac 2700

aataacttag cccgtttttg gaagagtgcc aacctaggtg ggccggtgtt gtttctcaaa 2760

ggggcacaga gcttgataag cttacagctg gatagtaacg ggctggatga gatcccagca 2820

gaggctctga gagggttgag taaccttcgt gagctaagcc tggccaacaa tctccttaat 2880

agtcttaagg actcaatttt tgatgatctg aactcactgc gggctttata tttacagaag 2940

aatctgatca caactgtgag gcccgaagtg ttcaaaactc ctatgagcaa cctcagcctg 3000

cttgtcatgg gcaaaaatcc atttgactgc acatgtgaga gcatcctgtg gtttgtgaca 3060

tggttgaata gcacaaatat gagcagtgtg ccaggtctca gggagcagta tatgtgcaac 3120

actccactag cttactttaa ccactctgtc atggattttg acaccctctc ttgcaaagat 3180

atgaccccat ttcaggctct ttacatactg agcagcacag ctgttatcat gctgacagta 3240

actgcacttc tggtgcggtt ccatggctgg aggattcagt tctattggaa catactgatc 3300

aatcggacat taggatttag tgacgccaaa gttgaagagg gcagggaatt tgagtatgat 3360

gcttacatca tacatgcaga ggaagacagc aactgggtgg agagaaggtt ggtcccttta 3420

gagaagggaa agtgccagtt ttgtttggag gatcgagatt tcgtccctgg cacgtcaaag 3480

cttgaaagca ttgtgcataa tatgagaagg tccagaaaaa tcttgtttgt cgtcactgaa 3540

attcttctca acgatccctg gtgtagacgg taaatcaaac atacactgcg tagatttata 3600

cattattata gattatacat catgttaaag ccaagtaaaa atctaactat gtgaattaga 3660

attttgtgat gtgcagtaca ctttctctgg gttacattgg tatttgtgtt atatatttgt 3720

gataaagtga gttctcaaag ttgtctctct gccctcctac cccgtgtctt tccttatcca 3780

atttaaagcc catcatgcac ttcatcaggt cattgaagcc agcagggacg ctgtggttct 3840

ggtattcctg caggatgttc acgactacaa gttatctcgc tcactcttcc tccgcagggg 3900

catgttgcgt tcatgctgca tcctggactg gcctgtccat aaggagaggg tgccggcctt 3960

tcaccagaag ctcctcatag cacttggcat gactaatcga ttgcaggagt gactgtattc 4020

cactggtaat aatggaaaat tccctttgta ataataatta cctatgtaag ttaaattatt 4080

acgaattgct gccaattgct tattgtttta ccctctgtgt gaatattgta cttatatatg 4140

tactgcactc tgtatcatgt gtcgtattta cattgcattg cagctttaca tcagccaaaa 4200

ttccaataaa acacaagtat tccaaaaaaa aaaaaaaaaa aaaaaaaaaa a 4251

<210> 3

<211> 922

<212> PRT

<213> Siniperca chuatsi

<400> 3

Met Gln Arg Gln Asn Leu Val Phe Gly Ile Met Cys Ala Pro Arg Ser

1 5 10 15

Leu Leu Leu Pro Ala Val Ile Ile Val Cys Tyr Phe Met Thr Gly Pro

20 25 30

Tyr Asn Cys Val Gly Ala Leu Lys Lys Val Ser Cys Asp Val Gln Asp

35 40 45

Gly Arg Ala Asp Cys Ser His Leu Ser Leu Ser Ala Val Pro Pro Asn

50 55 60

Leu Pro Arg Asn Ile Thr Thr Leu Asp Met Ser His Asn Arg Leu Lys

65 70 75 80

Gly Ile Pro Pro Val Ser Leu Ile Pro Tyr Pro Gly Leu Leu His Leu

85 90 95

Asp Val Ser Tyr Asn Ser Ile Ser Lys Leu Asp Lys Gly Leu Cys Gln

100 105 110

Thr Leu Ser Leu Leu Gln Thr Leu Asn Met Glu His Asn Gln Val Leu

115 120 125

Leu Leu Lys Lys Glu Asp Val Ser His Cys Thr Asn Leu Thr Arg Leu

130 135 140

Ile Leu Ala Ser Asn Arg Leu Lys Leu Gln Gly Glu Pro Phe Ser Ala

145 150 155 160

Leu Gln Ser Leu Lys Phe Leu Asp Val Ser Ile Asn Lys Leu Gln Ser

165 170 175

Ala Lys Leu Gly Ser Gln Pro Gln Leu Pro Ser Leu Val Asn Leu Asn

180 185 190

Leu Ala Phe Asn Glu Phe Thr Thr Leu Lys Lys Asp Asp Phe Ser Phe

195 200 205

Leu Asn His Ser Ser Phe Leu His Val Leu Asn Leu Ser Ser Val Ser

210 215 220

Leu Lys Thr Leu Glu Ala Gly Cys Phe Lys Pro Ile Ser Ser Leu His

225 230 235 240

Thr Leu Ile Met Asp Gly Ser Asn Met Gly Thr Leu Gly Ile Ser Lys

245 250 255

Leu Cys Ser Glu Leu Ser Gly Thr Ala Ile Asp Ala Leu Ser Leu Arg

260 265 270

Asn Met Lys Leu Val Thr Leu Thr Lys Pro Thr Phe Lys Gly Leu Gln

275 280 285

Lys Thr Asn Leu Thr Phe Leu Asp Leu Ser His Asn Gly Met Gly Lys

290 295 300

Ile Glu Glu Gly Ser Phe Gln Trp Leu Ser Thr Leu Gln Thr Leu Ile

305 310 315 320

Leu Ala Asp Asn Asn Ile Lys His Leu Thr Lys Asp Thr Phe Gln Gly

325 330 335

Leu Lys Ser Leu Lys Lys Leu Gln Leu Thr Lys Ala Leu Val Lys Ser

340 345 350

Lys Thr Ser Ala Thr Pro Ile Ile Asp Asp Phe Ser Phe Gln Pro Leu

355 360 365

Ser Thr Leu Glu Ser Leu Ile Leu Gln Arg Thr Ala Ile Arg Glu Ile

370 375 380

Thr Glu His Thr Phe Thr Gly Leu Thr Ser Leu Lys Glu Leu Asp Met

385 390 395 400

Ser Trp Ser His Tyr Thr Ser Leu Arg Asn Ile Thr Asn Lys Thr Leu

405 410 415

Val Ser Leu Ala Gly Ser Pro Leu Arg Lys Leu Asn Leu Thr Gly Thr

420 425 430

Asp Ile Thr Gln Ile Asn Pro Gly Ser Phe Ser Val Leu Lys Asn Leu

435 440 445

Thr Thr Leu Leu Leu Asp Phe Asn Phe Ile Lys Gln Thr Leu Thr Gly

450 455 460

Lys Glu Phe Glu Gly Leu Asp Lys Val Gln Glu Ile Arg Met Ser Asn

465 470 475 480

Asn His Gln Thr Val Asn Leu Ser Ser Met Ser Phe Ala Asn Val Pro

485 490 495

Asn Leu Arg Ile Leu Thr Leu Gly Lys Ser Leu Lys Ala Thr Ala Leu

500 505 510

Asn Leu Asp Pro Ser Pro Phe Ser Leu Leu Thr Asn Leu Thr Phe Leu

515 520 525

Asp Leu Ser Asn Asn Asn Ile Ala Asn Ile Lys Glu Asn Met Val Glu

530 535 540

Gly Leu Val Asn Leu Lys Val Leu Lys Leu Gln His Asn Asn Leu Ala

545 550 555 560

Arg Phe Trp Lys Ser Ala Asn Leu Gly Gly Pro Val Leu Phe Leu Lys

565 570 575

Gly Ala Gln Ser Leu Ile Ser Leu Gln Leu Asp Ser Asn Gly Leu Asp

580 585 590

Glu Ile Pro Ala Glu Ala Leu Arg Gly Leu Ser Asn Leu Arg Glu Leu

595 600 605

Ser Leu Ala Asn Asn Leu Leu Asn Ser Leu Lys Asp Ser Ile Phe Asp

610 615 620

Asp Leu Asn Ser Leu Arg Ala Leu Tyr Leu Gln Lys Asn Leu Ile Thr

625 630 635 640

Thr Val Arg Pro Glu Val Phe Lys Thr Pro Met Ser Asn Leu Ser Leu

645 650 655

Leu Val Met Gly Lys Asn Pro Phe Asp Cys Thr Cys Glu Ser Ile Leu

660 665 670

Trp Phe Val Thr Trp Leu Asn Ser Thr Asn Met Ser Ser Val Pro Gly

675 680 685

Leu Arg Glu Gln Tyr Met Cys Asn Thr Pro Leu Ala Tyr Phe Asn His

690 695 700

Ser Val Met Asp Phe Asp Thr Leu Ser Cys Lys Asp Met Thr Pro Phe

705 710 715 720

Gln Ala Leu Tyr Ile Leu Ser Ser Thr Ala Val Ile Met Leu Thr Val

725 730 735

Thr Ala Leu Leu Val Arg Phe His Gly Trp Arg Ile Gln Phe Tyr Trp

740 745 750

Asn Ile Leu Ile Asn Arg Thr Leu Gly Phe Ser Asp Ala Lys Val Glu

755 760 765

Glu Gly Arg Glu Phe Glu Tyr Asp Ala Tyr Ile Ile His Ala Glu Glu

770 775 780

Asp Ser Asn Trp Val Glu Arg Arg Leu Val Pro Leu Glu Lys Gly Lys

785 790 795 800

Cys Gln Phe Cys Leu Glu Asp Arg Asp Phe Val Pro Gly Thr Ser Lys

805 810 815

Leu Glu Ser Ile Val His Asn Met Arg Arg Ser Arg Lys Ile Leu Phe

820 825 830

Val Val Thr Glu Ile Leu Leu Asn Asp Pro Trp Cys Arg Arg Phe Lys

835 840 845

Ala His His Ala Leu His Gln Val Ile Glu Ala Ser Arg Asp Ala Val

850 855 860

Val Leu Val Phe Leu Gln Asp Val His Asp Tyr Lys Leu Ser Arg Ser

865 870 875 880

Leu Phe Leu Arg Arg Gly Met Leu Arg Ser Cys Cys Ile Leu Asp Trp

885 890 895

Pro Val His Lys Glu Arg Val Pro Ala Phe His Gln Lys Leu Leu Ile

900 905 910

Ala Leu Gly Met Thr Asn Arg Leu Gln Glu

915 920

<210> 4

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 4

gcaggagacc ttcttc 16

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

cggtcccgtc ataaaataac 20

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 6

cgggaggaga agggaacg 18

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 7

aagcagtggt atcaacgcag actac 25

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 8

tatctcgctc actcttcctc cgcag 25

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 9

gcctgtccat aaggagaggg tgcc 24

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

ggccacgcgt cgactagtac 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

ggccacgcgt cgactagtac 20

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 12

ctaatacgac tcactatagg gc 22

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 13

tgtgctcctc gttccctt 18

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 14

ggttgaggac atgtagaaag g 21

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 15

agcctgaagt ttcttgatgt t 21

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 16

tttcagactt ttgagtccct g 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 17

gtcatggatt ttgacaccct c 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 18

ttattggaat tttggctgat g 21

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 19

tgaggcccga agtgttcaaa 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 20

gacctggcac actgctcata 20

<210> 21

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 21

gagttcttgc gtagccttag cc 22

<210> 22

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 22

aaacagaagg tcctagcgtc cac 23

<210> 23

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 23

gcctctcgct ccctgtcc 18

<210> 24

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 24

gtgttctgct ggtccttctc atc 23

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 25

gacctggcac actgctcata 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 26

ggctatgacc gcctgtactc 20

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 27

gacttcgagc aggagatggg 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 28

cgaggaagga aggctggaag 20

Claims

1. a kind of SNP marker relevant to virus resistance is in preparation for the purposes in the antiviral Mandarin fish reagent of breeding, spy Sign is that the SNP marker is located at the 3586bp of nucleotide sequence gDNA sequence as shown in SEQ ID NO:2 of Mandarin fish Place, wherein base is C at the 3586bp of susceptible virus Mandarin fish, the base at the 3586bp of antiviral Mandarin fish For T；The virus is infectious spleen and kidney necrosis virus.