CN109125741B

CN109125741B - Self-assembled ternary complex preparation of hyaluronic acid/DOTAP/survivin coding gene and preparation method thereof

Info

Publication number: CN109125741B
Application number: CN201810914532.4A
Authority: CN
Inventors: 魏霞蔚; 魏于全
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2018-08-13
Filing date: 2018-08-13
Publication date: 2022-02-11
Anticipated expiration: 2038-08-13
Also published as: CN109125741A

Abstract

The invention relates to a self-assembled ternary complex preparation of hyaluronic acid/DOTAP/survivin coding genes and a preparation method thereof, belonging to the field of medicines. The invention aims to solve the problems of complex operation, easy generation of chemical residues, low safety and unsatisfactory activity of the existing method for modifying the liposome by using hyaluronic acid, and the technical scheme provides a self-assembled ternary complex preparation of hyaluronic acid/DOTAP/survivin coding genes, which is prepared from the following raw materials in parts by weight: 0.1-1 part of hyaluronic acid, 5-10 parts of liposome and 1 part of recombinant expression vector loaded with survivin coding gene, wherein the liposome comprises the following components in parts by weight: DOTAP: DOPE: 1: 0.5-1. The ternary complex preparation is prepared in a self-assembly mode, a chemical coupling method is not needed, and the operation is very convenient.

Description

Self-assembled ternary complex preparation of hyaluronic acid/DOTAP/survivin coding gene and preparation method thereof

Technical Field

The invention relates to a self-assembled ternary complex preparation of hyaluronic acid/DOTAP/survivin coding genes and a preparation method thereof, belonging to the field of medicines.

Background

In recent years, a Drug Delivery System (DDS) based on nanocarriers has greatly affected clinical medicine such as cancer treatment, vaccine development, tissue repair and regeneration. In the research of nano-carriers, liposomes are applied to the targeted delivery of various small molecular drugs and biomacromolecules due to simple preparation process, various administration modes and potential targeting property, and have attracted much attention. Due to good biocompatibility and biodegradability, many cationic liposomes have been applied to gene therapy, and show significant effects both in vitro and in vivo.

Surface charge is considered to be one of the important characteristics of nanoparticles. For nucleic acid delivery, cationic liposomes, due to their positive charge on their surface, interact with negatively charged nucleic acids (DNA or siRNA) by charge to form lipid-nucleic acid complexes (lipoplex). Such lipoplexes can enter cells via endocytosis through negatively charged cell membranes. Thus, the liposome surface charge is of great significance to cellular uptake and cytotoxicity of the particles. Although the advantages of using cationic liposomes in gene therapy have been noted, the low efficacy and toxic side effects of cationic liposomes that are ubiquitous have kept the use of cationic liposomes limited. In clinical trials, cationic liposomes have also been affected by adverse events associated with inflammatory toxicity, such as fever, fatigue and chills. Therefore, there is a great deal of interest in the search and development of effective and safe targeted cationic liposomes.

Hyaluronic Acid (HA) is reported to be one of the major components of the extracellular matrix, consisting of the repeating units disaccharide ((1-3) -and (1-4) -linked b-d-uronic acid and n-acetylglucosamine monomer). HA, as a water-soluble, biodegradable material with good biocompatibility, HAs been widely used in the fields of bioengineering and drug delivery systems. HA HAs been used in some tumor-targeted therapies as a ligand specifically targeting the CD44 receptor to increase tumor cell uptake efficiency. As an anionic polysaccharide, the HA with negative charge can counteract the positive charge of the liposome, reduce nonspecific interaction with tissues in a physiological environment and reduce toxic and side effects. Currently, there are reports of delivery of chemotherapeutic or genetic drugs to tumor tissues using HA-modified liposomes. However, the existing modification methods mainly link HA to liposome through covalent bond, for example, the carboxyl group of HA forms amide bond with liposome phospholipid amine group under the catalysis of EDC, or the reducing end of HA is linked with phospholipid amine group in reductive amination mode. The method prepares the nano-carrier by chemically coupling hyaluronic acid and liposome, and has complex operation, easy generation of chemical residue and safety problem.

Survivin protein mutant Survivin-T34A can induce spontaneous apoptosis of tumor cells by interfering endogenous Survivin phosphorylation, and can play a remarkable anti-tumor role. At present, no report related to the preparation of nanoparticle preparations by self-assembly of hyaluronic acid, liposomes and survivin-T34A encoding genes is found.

Disclosure of Invention

The invention aims to provide a novel hyaluronic acid/DOTAP/survivin coding gene self-assembled ternary complex preparation and a preparation method thereof, and aims to solve the problems of complex operation, easy generation of chemical residues, low safety and undesirable activity of the conventional method for modifying a liposome by using hyaluronic acid.

The invention provides a self-assembled ternary complex preparation of hyaluronic acid/DOTAP/survivin coding genes, which is prepared from the following raw materials in parts by weight: 0.1-1 part of hyaluronic acid, 5-10 parts of liposome and 1 part of recombinant expression vector loaded with survivin coding gene, wherein the liposome comprises the following components in parts by weight: DOTAP: DOPE: 1: 0.5-1.

Further, the feed additive is prepared from the following raw materials in parts by weight: hyaluronic acid 0.6 parts, liposome 6 parts, and recombinant expression vector loaded with survivin coding gene 1 part.

Further, the liposome comprises the following components in parts by weight: DOTAP: DOPE: 1.

Further, the recombinant expression vector loaded with the survivin coding gene is a plasmid vector.

Preferably, the plasmid vector is a pVAX plasmid vector.

Further, the survivin coding gene is a coding gene of survivin mutant survivin-T34A.

Further, the nucleotide sequence of the survivin coding gene is shown as SEQ ID No. 1.

Further, the molecular weight of the hyaluronic acid is 10kDa to 100 kDa.

The invention provides a preparation method of the ternary complex preparation, which comprises the following steps: preparing liposome from DOTAP and DOPE in each weight ratio, adding a recombinant expression vector containing a survivin coding gene for incubation, and adding hyaluronic acid for incubation to obtain the liposome.

Further, the liposome is prepared by a film dispersion method.

Further, the preparation method of the liposome comprises the following steps: dissolving DOTAP and DOPE in organic solvent, removing organic solvent to form film, and hydrating to obtain liposome.

Further, the organic solvent is chloroform.

Further, the preparation method of the liposome comprises the following steps: dissolving DOTAP and DOPE in chloroform according to the mass ratio, evaporating on a rotary evaporator to remove the organic solvent, and further drying the formed film for 4 hours under the vacuum condition; subsequently hydrating the dried lipid film in physiological saline; then, the liposome is further dispersed by probe ultrasound until a semitransparent liposome solution is obtained, and the solution is filtered through a 0.22 micron microporous membrane and stored at 4 ℃ for later use.

Further, the incubation time for adding the recombinant expression vector loaded with the survivin-encoding gene was 30 minutes.

Further, the incubation time with the addition of hyaluronic acid was 30 minutes.

Further, the concentration of hyaluronic acid is 1 mg/ml.

The invention also provides application of the ternary complex preparation in preparing a tumor-targeted medicament.

The invention prepares the liposome formed by DOTAP and DOPE, hyaluronic acid and the recombinant vector containing the survivin coding gene into the nano-particles in a self-assembly mode, does not need to adopt a chemical coupling method, and has very convenient operation. The examination results of the in vivo and in vitro transfection toxicity and efficiency of the nanoparticle of the invention show that the negative charge hyaluronic acid can partially block the cationic surface charge of the liposome and reduce the in vivo and in vitro toxicity, and the reduction of the toxicity is probably due to the reduction of the necrosis of primary cells in the lung of a mouse and the reduction of the release of mitochondria. In addition, the nanoparticle preparation shows specific targeting in a CT26 colon cancer tumor model with high expression of CD44, remarkably improves the anti-tumor effect of the cationic liposome carrying survivin gene, prolongs the survival period of mice, is an anti-tumor preparation which can hardly meet the requirements of safe medication and has excellent treatment effect, and has wide clinical application prospect.

Drawings

FIG. 1 is a graph showing the results of examining the physicochemical properties of liposomes in example 1;

FIG. 2 is a graph showing the results of evaluation of cytotoxicity of liposomes in example 2;

FIG. 3 is a graph showing the results of the toxicity evaluation in vivo of the HALP in example 3;

FIG. 4 is a graph of histological staining of vital organs of mice after injection of HALP in example 3;

FIG. 5 is a graph showing the results of in vivo toxicity evaluation of HALP/pVAX in example 3;

FIG. 6 is a graph of histological staining of vital organs of mice after injection of HALP/pVAX in example 3;

FIG. 7 is a graph showing the results of conventional and biochemical analyses of blood in example 3;

FIG. 8 is a graph showing the results of transfection and antitumor of the liposomes in examples 4 and 5.

Detailed Description

The raw materials and equipment used in the embodiment of the present invention are known products and obtained by purchasing commercially available products.

The invention provides a self-assembled ternary complex preparation of hyaluronic acid/DOTAP/survivin coding genes, which is prepared from the following raw materials in parts by weight: 0.1-1 part of hyaluronic acid, 5-10 parts of liposome and 1 part of recombinant vector containing survivin coding gene, wherein the liposome comprises the following components in parts by weight: DOTAP: DOPE ═ 1: (0.5 to 1).

In the prior art, when hyaluronic acid is used for modifying the cationic liposome, a chemical coupling mode is mostly adopted, and the hyaluronic acid and the cationic liposome are connected through chemical bonds to form a stable compound. Such methods are not only complicated to operate, but also prone to chemical residue and cause safety problems.

According to the invention, specific raw materials of DOTAP and DOPE are selected to prepare liposome, and the liposome is mixed with hyaluronic acid and a recombinant vector pVAX containing a survivin coding gene in a mass ratio of 5-10: 0.1-1: 1, the complex can be self-assembled to form a stable ternary complex, coupling is not needed through chemical bonds, operation is greatly simplified, and the obtained ternary complex has the advantages of small particle size, high encapsulation rate, good stability and low toxicity. In addition, the ternary complex shows specific targeting in a CT26 tumor model with high expression of CD44, can play a remarkable anti-tumor role, and is an anti-tumor preparation which hardly meets the safety requirement and has an excellent treatment effect.

The present invention will be further described with reference to the following examples. In the examples, some experimental starting materials and preparation methods used were as follows:

1. material

(2, 3-dioleoyl-propyl) trimethylammonium chloride (DOTAP) and dioleoyl phosphatidylethanolamine (DOPE) were obtained from Avanti corporation (Alabaster, AL, USA). Hyaluronic acid (10 kDa-100 kDa) was purchased from R & D Systems (Abingdon, United Kingdom). Plasmid pORF9-hSurvivinT34A was purchased from InvivoGen (San Diego, CA). The fragment containing Survivin cDNA was cut and inserted into pVAX vector (Invitrogen, Carlsbad, CA, USA) as an experimental group plasmid, and plasmid pVAX was used as a negative control. Green fluorescent protein plasmid (pGFP) was used for in vitro transfection experiments. All plasmid DNA was extracted according to the EndoFree plasmid purification Manual (QIAGEN, Hilden, Germany).

Specifically, the embodiment of the invention uses a recombinant plasmid constructed by using pVAX plasmid and capable of expressing Survivin mutant Survivin-T34A (abbreviated as S-T34A). Survivin-T34A is a Survivin mutant, namely threonine 34 of Survivin is mutated into alanine (Thr34 → Ala), and the mutant S-T34A has the effect of inducing tumor cell apoptosis. Primers can be designed to amplify the gene sequence of interest from a recombinant plasmid encoding survivin-T34A gene.

Wherein, the survivin-T34A coding nucleotide sequence is as follows (SEQ ID No. 1):

ATGGGAGCTCCGGCGCTGCCCCAGATCTGGCAGCTGTACCTCAAGAACTACCGCATCGCCACCTTCAAGAACTGGCCCTTCCTGGAGGACTGCGCCTGCGCACCAGAGCGAATGGCGGAGGCTGGCTTCATCCACTGCCCTACCGAGAACGAGCCTGATTTGGCCCAGTGTTTTTTCTGCTTTAAGGAATTGGAAGGCTGGGAACCCGATGACAACCCGATAGAGGAGCATAGAAAGCACTCCCCTGGCTGCGCCTTCCTCACTGTCAAGAAGCAGATGGAAGAACTAACCGTCAGTGAATTCTTGAAACTGGACAGACAGAGAGCCAAGAACAAAATTGCAAAGGAGACCAACAACAAGCAAAAAGAGTTTGAAGAGACTGCAAAGACTACCCGTCAGTCAATTGAGCAGCTGGCTGCCTAA。

the primers used were as follows:

upstream primer (SEQ ID No. 2):

5-CCCAAGCTTAAGATGGGAGCTCCGGCGCTGC-3(HindIII cleavage site);

downstream primer (SEQ ID No. 3):

5-GCTCTAGATTAGGCAGCCAGCTGCTCAATT-3(XbaI cleavage site).

The amplified target fragment was then digested with HindIII and XbaI and ligated into pVAX plasmid to obtain pVAX-S-T34A recombinant expression plasmid, and pVAX containing no S-T34A gene was used as a control (pVAX-null). pVAX-S-T34A and pVAX-null were transferred to E.coli, cultured in LB medium containing ampicillin at a concentration of 100. mu.g/ml, and plasmid DNA was extracted in large amounts using the Endofree plasmid giga kit from Qiagen, according to the manual of the kit, and OD of the extracted plasmid DNA was determined_260/280The ratio is 1.8-2.0, and the concentration of plasmid DNA is determined by ultraviolet spectrophotometer, and the extracted plasmid DNA is stored at-20 deg.C for use.

2. Animals and cell lines

Female BALB mice purchased from Vital River, Beijing, China were housed in an SPF-rated environment, with room temperature and humidity maintained constant. Animal experiments were conducted according to the guidelines of the animal care and use committee of university of Sichuan (Chengdu, Sichuan, China), approved by the animal Association.

The mouse colon cancer cell line CT26 and the human embryonic kidney 293 cell line were purchased from ATCC in the united states. Cell culture was performed with RPMI-1640 medium (CT26 cells) or DMEM medium (293 cells) (Gibco, Invitrogen, Calsbarda, Calif.) with 10% fetal bovine serum, penicillin (100 units/ml) and streptomycin (100. mu.g/ml) at 37 ℃ in 5% CO 2.

Example 1 preparation and characterization of LP, HALP, LP/DNA Complex, HALP/DNA Complex 1, Experimental methods

Cationic liposomes (i.e., LP or Liposome) are prepared using a membrane dispersion method. The operation method comprises the following steps: DOTAP: DOPE is added according to the mass ratio of 1: 1 was dissolved in chloroform and evaporated on a rotary evaporator for 2 hours, the organic solvent was removed and the formed film was further dried under vacuum for 4 hours. The dried lipid film was then hydrated in physiological saline at a concentration of 5mg/ml (total lipid). The liposomes were further dispersed by probe sonication, adjusting their particle size until a translucent liposome solution was obtained, passed through a millipore 0.22 micron microporous membrane, and stored at 4 ℃ until use.

Preparation of cationic liposome/DNA complexes (i.e., LP/DNA complexes or Lipopolexes): according to the cationic liposome: pDNA (pVAX, pGFP or pVAX/Survivin) in a mass ratio of 6: 1 mixing the solution of liposomes with DNA and incubating for 30 minutes at room temperature to form LP/DNA complexes.

Preparation of HA-modified cationic liposomes (i.e. HALP) and HA-modified Lipoplexes (i.e. HALP/DNA): the HA solution was obtained overnight by dissolving Hyaluronic Acid (HA) in distilled water to a concentration of 1 mg/ml, followed by 0.22 micron microporous membrane, and stored at 4 ℃ until use. Adding HA with the quality equivalent to 0-20% of LP (namely DOTAP + DOPE) into the LP or LP/DNA solution, and incubating for 30 minutes to obtain the final product.

Average particle size and zeta potential of LP, HALP, Lipoplexes, HA-modified Lipoplexes (encapsulated pVAX) were measured with ZEN3600 (malvern instruments ltd, marvin, worsted county, uk). The average particle size was measured by dynamic light scattering at a fixed angle of 173 ℃. The zeta potential was determined after diluting the sample in distilled water to a concentration of 1 mg/ml at room temperature. The zeta potential is the electrophoretic mobility calculated automatically. All experiments were independently repeated three times.

The appearance of LP, HALP, LP/pVAX and HALP/pVAX liposome complexes was characterized by Transmission Electron Microscopy (TEM). The cationic liposomes and Lipoplexes were diluted with distilled water and placed on a copper grid containing nitrocellulose. The sample is negatively dyed by phosphotungstic acid, and is observed after being dried at room temperature.

The effective encapsulation of plasmid DNA in Lipoplexes was detected by agarose gel electrophoresis. Lipopoplexes were electrophoresed on a 1% agarose gel (Invitrogen, Calsbards, Calif.) in pH 7.4 buffer (40mM Tris/HCl, 1% acetic acid, 1mM EDTA). The Gel was run at constant voltage of 120 volts for 15 minutes at room temperature, and then examined with a Gel imaging system (Gel Doc 1000, Bio-Rad Laboratories, Hercules, CA, USA).

2. Results of the experiment

As can be seen from FIG. 1a, the particle size of LP is about 100nm, the particle size of Lipopolexes is slightly larger, and the particle size is slightly increased after HA modification, wherein the particle size of LP and Lipopolexes added with 20% of HA is about 180nm, which is probably due to the charge effect of HA and the surface of the cationic liposome. Only a slight increase in particle size indicated that addition of HA did not induce aggregation or fusion of LP, Lipoplexes.

As shown in FIG. 1b, the zeta potential of LP is about +55mv, which is remarkably reduced to +35mv after being compounded with negative plasmid DNA, and further modified by HA with negative charge, cationic liposomes with lower zeta potential, such as LP + 1% HA, LP + 2% HA, LP + 5% HA, LP + 10% HA, LP + 20% HA, and the like, are obtained. When the HA concentration reaches 20%, the surface charge of the liposome becomes negative, which may not be suitable for gene delivery.

The interaction of cationic liposomes with pDNA is mainly electrostatic interaction between negatively charged DNA and positively charged liposomes. Considering that negatively charged HA can also bind to cationic liposomes by electrostatic interactions, possibly interfering with the binding of liposomes to DNA, the DNA encapsulation efficiency of the different liposomes was characterized by agarose gel electrophoresis, and the resulting gel image is shown in fig. 1c, where the bright bands indicate free DNA. As can be seen from the figure, there is no free DNA in Lipoplexes (total free DNA content below detection limit), even in Lipoplexes that are negative in surface charge (i.e. 20% HA complexed). These results demonstrate that the binding of DNA to cationic liposomes is not affected by the addition of HA.

Meanwhile, the morphologies of LP, HALP, LP/pVAX and HALP/pVAX were observed by Transmission Electron Microscopy (TEM) to be spherical in shape and uniform in size, as shown in FIG. 1 d.

Example 2 in vitro cytotoxicity evaluation of HALP

1. Experimental methods

The MTT method measures the cytotoxicity of LP, HALP in 293T cell line. The operation method comprises the following steps: cells were seeded in 96-well plates (corning, ny, usa) at a density of 3000 cells/well in 100ul DMEM. After overnight attachment, the cells were incubated with 80. mu.g/ml liposomes, with varying HA incorporation from 2% to 10% (referring to the incorporation of LP, i.e., DOTAP + DOPE, infra), 100. mu.l serum-free medium per well. In addition, cells were also incubated with LP and HALP at concentrations of 10-160. mu.g/ml, after 4 hours of incubation, 20. mu.l of MTT solution (5mg/ml physiological saline) was added to each well, and further incubation was performed at 37 ℃ for 4 hours. Finally, the medium was removed by pipetting, 150ul of DMSO was added to each well, and the absorbance at 570 nm was measured per well.

2. Results of the experiment

As can be seen from FIG. 2a, HA can reduce LP cytotoxicity, with the reduction in toxicity being dependent on the amount of HA complexed. Since the surface charge of LP + 20% HA liposomes became negative when HA incorporation reached 20% (see FIG. 1b of example 1), which may lead to liposome instability, cytotoxicity of LP and LP + 10% HA was examined at varying liposome concentrations of 10-160. mu.g/mL, respectively, by MTT method, and the results are shown in FIG. 2 b. As can be seen from the figure, the cytotoxicity of liposomes is concentration dependent.

Example 3 in vivo toxicity evaluation of HALP/pVAX

1. Experimental methods

To detect in vivo cell necrosis, mice were injected with liposomes for 4 hours prior to bronchoalveolar lavage with fluid CytoTox

Non-Radioactive cytoxicity assay (G1780, Promega, USA) detected cell necrosis. Meanwhile, the concentration of mitochondrial DNA was detected in the plasma of mice.

To detect mitochondrial release by cationic liposomes, mouse primary lung cells were seeded on sterile cover glass (WHB-24-CS, diameter: 14 mm). At night, the cell mitochondria were labeled with a Mito-Tracker Red (Beyotime Institute of Biotechnology, Nantong, China) probe at a final concentration of 100nM, while the nuclei were labeled with Hoechst 33342 (20. mu.g/ml, Sigma) for a staining time of 30 minutes. After the cells were incubated with HA (5mg/mL), LP (50mg/mL), HALP (50mg/mL), pVAX (5mg/mL), LP/pVAX (50mg/mL), HALP/pVAX (50mg/mL) for 30min under serum-free conditions, they were observed under a Schlsm 880 confocal microscope.

Mitochondrial concentration was detected by real-time quantitative PCR: mitochondria in plasma were concentrated and purified using QIAamp DNA Blood Mini Kit (Qiagen), and the resulting product was assayed using TaqMan probe. The invention designs a primer and a probe for detecting free mitochondria in mouse plasma. The sequence is as follows:

upstream primer Forward (5'→ 3'): ACCTACCCTATCACTCACACTAGCA (SEQ ID No. 4);

downstream primer Reverse (5'→ 3'): GAGGCTCATCCTGATCATAGAATG (SEQ ID No. 5); probe Probe: ATGAGTTCCCCTACCAATACCACACCC (SEQ ID No. 6).

Plasmids containing the mitochondrial targeting sequence (J01420, position 2891-3173) were constructed and standard curves were established by dilution of plasmids at different concentrations.

Detection of lung inflammation in vivo: neutrophils (CD45+, CD11b +, Ly6G +) were detected by flow cytometry. Systemic administration was carried out by tail vein injection of cationic liposomes, 24h later, the mouse lung tissue was cut into small pieces, mixed with 1 mg/ml collagenase type I (RPMI 1640 base) and incubated at 37 ℃ for 2 hours. The tissue suspension was then filtered through a 70 micron nylon mesh and treated with red blood cell lysis buffer. After rinsing twice with phosphate, fine rinsingCell counts in pbs at 1X 10⁶Cells/ml were dispersed and incubated with antibody at 4 ℃ for 30 minutes. After washing twice with PBS, the cells were flow tested. Data were collected with a NovoCyte flow cytometer and analyzed with NovoExpress software. Mouse lung tissue was prepared as paraffin sections to detect neutrophils infiltrated in the lung, which were stained for elastase using the NaphtholAS D Chloroacetate Kit (st louis, sigma chemical ltd., usa). After development, the number of cells positive for elastase in a random 10 high power field was counted under a high power microscope.

Biochemical analysis and histopathological staining: after injection of NS, HA (2.5mg/kg), pVAX (4 mg/kg), liposomes (25mg/kg) or Lipoplexes (25mg/kg) into mice for twenty-four hours, mouse sera were separated by centrifugation for routine and biochemical analysis of blood using an utomatic analyzer (hitachi high tech, tokyo, japan). All animal experiments were approved by the institutional animal care and use committee. Tissues were paraffin-wrapped and prepared into sections (3-4 microns), each section was washed sequentially by deparaffinization (twice), 100% ethanol (twice), 95% ethanol, 85% ethanol, 75% ethanol, and water. After hydration of these sections, the sections were used for HE staining and histopathological morphology was observed.

In vivo toxicity and mouse survival observations: BALB mice were injected with 100 μ L of NS, HA (10mg/kg), LP (100mg/kg), HALP (100mg/kg), or pVAX (5 mg/kg), HA (10mg/kg), LP (100mg/kg), or HALP (100mg/kg), and the tail vein was taken every 24 hours for 10 consecutive days, and mouse survival was recorded every 24 hours.

In this example, HALP and HALP/pVAX were combined with 10% HA, and the preparation method was the same as in example 1.

2. Results of the experiment

2.1 in vivo toxicity of HALP

The results are shown in FIG. 3. 3a shows the necrosis of cells in the bronchoalveolar lavage fluid (BAL) of mice after the mice are injected with NS, HA (2.5mg/kg), LP (25mg/kg) or HALP (25mg/kg) saline for 4 hours through the tail vein. It was reported that LP and PEI immediately accumulated in the mouse lung after intravenous injection, and therefore, the pulmonary cytotoxicity of LP was examined by analysis of lactate dehydrogenase (LDH release). As can be seen from the figure, intravenous administration of LP induces LDH release in bronchoalveolar lavage fluid, indicating that LP injection can induce lung tissue damage; the LDH concentration of the HALP group was significantly reduced after HA modification of the liposomes.

3b shows survival assay in BALB/c mice injected daily (24h) with 100. mu.L of saline NS, HA (10mg/kg), LP (100mg/kg) or HALP (100mg/kg) via the tail vein and mice survival was recorded daily. The survival assay lasted for 10 days, with 10 mice per group. The survival of mice in the LP group was significantly different from those in the HALP group by Log-rank (Mantel-Cox) analysis, with P <0.0001. As can be seen from the figure, the addition of HA helps to improve the survival of mice injected with lethal doses of LP.

3c shows the release of cellular mitochondria after treatment of mouse lung primary cells pre-stained with Mito-tracker (mitochondrial staining, red) and Hoechst 33342 (nuclear staining, blue) with HA (5mg/mL), LP (50mg/mL) or HALP (50mg/mL) for 30 min. The arrows indicate mitochondria released from the cells, and the scale in the figure is 20 μm.

3d indicates that 100. mu.L of physiological saline NS, HA (2.5mg/kg), LP (25mg/kg) or HALP (25mg/kg) was systemically administered to the mice via the tail vein, and the mtDNA content in the plasma of the mice was measured by the qPCR method 4 hours after administration. Cationic liposomes have been reported to induce necrosis and mitochondrial leakage of primary cells in the lungs of mice. As can be seen from the figure, with the increase of HA, mitochondrial leakage of primary lung cells (fig. 3c) and a significant decrease in plasma mitochondrial concentration (fig. 3d) was caused by LP.

3e-f shows the number of neutrophils infiltrated in lung tissue (CD11b + LY-6G +) using flow cytometry.

3g represents a lung tissue section of a mouse 24 hours after systemic administration, and cells stained positive for the specific esterase were considered to be neutrophils.

3h represents the number of neutrophils in lung tissue, counted as the mean of ten high power field counts, with a scale of 20 μm in the figure. The LP experimental group had significant differences compared to the NS group using Student's t assay analysis (× P <0.001, × P < 0.01); the LP experimental group had significant differences (ξ ξ P <0.001, ξ P <0.01) error as shown by SEM compared to the HALP group; the number of experimental samples was 3 or 5. Liposome-induced lung inflammation was characterized by neutrophil infiltration, and the experiments described above tested CD45, CD11b, and Ly6G by flow cytometry (fig. 3e and f) and characterized by esterase staining (fig. 3g and h). The results show that 24 hours after administration of LP, neutrophils were recruited abundantly in the lung; however, HALP can successfully protect lung tissue from inflammation after modification of liposomes with HA.

The above results were also supported in other important histological staining of organs (see fig. 4, wherein the control group was injected with the same amount of solvent in normal saline): compared to normal BALB/c mice, mice injected with LP showed inflammatory responses in the lung, liver, and spleen, with massive lymphocytic infiltration in the lung and simultaneous failure of the hepatosplenic structures observed. However, all of these important organ lesions can be alleviated by modifying LP with HA. These data indicate that modification of liposomes with HA can reduce organ inflammation and damage caused by cationic liposomes, suggesting that HALP is a better cationic liposome and less toxic.

2.2 in vivo cytotoxicity of HALP/pVAX

Mice were treated with LP/pVAX and HPLP/pVAX for 0.5 hours in situ and mitochondrial leakage was observed. After LP/pVAX treatment, the primary lung cells of the mice were ruptured and mitochondrial leakage was observed. However, modification of LP by HA can reduce mitochondrial leakage caused by LP/pVAX and improve survival of mice injected with lethal doses of LP/pVAX (see fig. 5a, 5 b).

Furthermore, lung inflammation caused by intravenous LP/pVAX and HALP/pVAX was characterized by neutrophil infiltration as measured by flow cytometry (fig. 5c and 5d) and esterase staining (fig. 5e and 5 f). After 24 hours of in vivo LP/pVAX injection in mice, neutrophil recruitment was observed in the lung, which was alleviated in the HALP/pVAX group, indicating that the HALP/pVAX formed after modification with HA could provide a safer vector for gene delivery.

At the same time, the histopathological results (see fig. 6, in which the control group was injected with the same amount of saline) also support the above conclusion. As shown by HE staining, in the intravenously administered LP/pVAX group, organ toxicity of lung, liver and spleen was observed, severe lymphocyte infiltration into lung and structural failure of liver and spleen tissues and cell necrosis were observed, while in the HALP/pVAX group, the above tissue toxicity was reduced.

2.3 evaluation of the safety of HALP/pVAX

To further investigate the safety of HALP/pVAX, Blood routine and biochemical analyses were performed and the results are shown in FIG. 7 (where ALT, Alanine transferase; AST, Aspartate aminotransferase; LDH, Lactate dehydrogenase; BUN Blood reagent; ALP, Alkaline phosphatase; CHOL, Cholesterol, ((p < 0.05); p < 0.01); p <0.001,; p <0.0001.by study's t-test. mean. + -. SD, n ═ 5.) biochemical indices show that vital organs such as the liver of mice injected intravenously with LP and LP/VApX are severely impaired, and that this impairment can be alleviated by modification with HA in accordance with the previous HE staining results.

The results of the above experiments show that the addition of HA can reduce tissue toxicity and inflammation caused by LP and LP/pVAX treatment, and the damage of important organ functions of mice, and suggest that the cationic liposome with the addition of HA is a safer gene therapy vector dosage form.

Example 4 transfection assay of HALP/GFP

The ideal gene vector should have high transfection efficiency and low toxicity. The purpose of this experiment was to evaluate the transfection effect of HALP/GFP complexes in vivo and in vitro. In this example, HALP and HALP/GFP were combined with 10% HA and prepared as described in example 1.

1. Experimental methods

In vitro transfection experiments: CT26 cells were plated on 6-well plates to 40-50% of the plate bottom area, the old solution was discarded from the cells, and the cells were washed once with serum-free medium, 1 ml of HALP/GFP complex (containing 12. mu.g of LP, 2. mu.g of plasmid DNA and 10% HA at the final concentration) or 1 ml of LP/GFP complex (containing 12. mu.g of LP, 2. mu.g of plasmid DNA GFP, without HA) was added to each well, and cultured at 37 ℃ for 4-24 hours. And (4) sucking out the serum-free transfection solution, and replacing the serum-free transfection solution with a normal culture solution for continuous culture. Transfection efficiency was observed under an inverted fluorescence microscope and detected by flow cytometry.

In vivo transfection experiments: 1X 10⁶CT26 tumor cells were inoculated subcutaneously into mice, and approximately 3-5 days later, tumor diameters reached 3-5.5 mm, and lipoplexes containing 20. mu.g of pGFP plasmid, including Hyaluronic Acid (HALP) -containing and non-hyaluronic acid (LP) -containing groups, were injected via tail vein of mice, and after 72 hours, the mice were treated, and tumor tissues were prepared as frozen sections and observed under a fluorescent microscope.

2. Results of the experiment

Since the modification of HA was mainly used for the targeted delivery of CD44, to confirm that HALP could improve transfection efficiency in CT26 cells, the expression of CD44 on CT26 cells was first examined. As can be seen from fig. 8a, CD44 is highly expressed in CT26 cells, which makes CT26 a target cell for HALP.

Then, the efficiency of targeted transfection of HALP in CT26 cells was determined by flow cytometry (FIG. 8b) and fluorescence microscopy (FIG. 8 c). Compared with LP, the HALP can significantly increase the expression of reporter Gene (GFP) in CT26 cells, suggesting that the HALP is more suitable for the delivery of CT26 cell-targeted genes.

The above results are further supported in vivo transfection assays: HALP/GFP or LP/GFP was injected intravenously in tumor-bearing mice (CT26 subcutaneous tumors) and HALP/GFP or LP/GFP transfection efficiency was subsequently examined in CT26 tumor tissues. Mouse tumor tissues were removed and frozen sections were prepared for fluorescence detection. As can be seen in FIG. 8d, the pGFP plasmid was successfully delivered to the tumor tissue by tail vein injection of HALP/GFP, whereas LP transfection was inefficient.

Combining the above experimental results, it is demonstrated that HALP is a cationic liposome capable of targeting CT26 cells with high expression of CD 44.

Example 5 in vivo antitumor Effect of HALP/survivin

The plasmid survivin T34A encodes mutant survivin protein, and has the capacity of interfering endogenous survivin phosphorylation and inducing spontaneous apoptosis of tumor cells. This experiment constructed a survivin plasmid, delivering survivin t34A plasmid (either HALP/survivin or LP/survivin) as a HALP or LP to study the effect of HALP/survivin in the mouse CT26 peritoneal tumor model. In this example, HALP/survivin were combined with 10% HA and prepared as in example 1.

1. Experimental methods

Intraperitoneal (ip) injection of CT26 cells (1X 10)⁶Cells/0.2 ml serum-free RIPM1640) a mouse peritoneal CT26 tumor model was established. Mice were randomly assigned to five groups. Three days after CT26 inoculation, administration mode: pVAX, HALP/pVAX, LP/survivin and HALP/survivin, wherein 30 micrograms of liposomes containing 5 micrograms of DNA are dispersed in 200ul of physiological saline and injected into the abdominal cavity once every three days with 10 injections as a treatment cycle. This model demonstrates peritoneal tumor growth of colon cancer and intraperitoneal injection with lipoplexes according to a rational strategy for colon cancer chemotherapy. Mice were monitored daily to treat adverse reactions and were sacrificed after the tenth injection of lipoplexes. At sacrifice, tumor tissue and vital organs of the mice were harvested for further characterization and tumor weights were recorded.

2. Results of the experiment

As can be seen from FIGS. 8e and 8f, intraperitoneal administration of HALP/survivin or LP/survivin significantly reduced tumor weight and induced apoptosis in tumor cells compared to NS group. Meanwhile, compared with LP/survivin, HALP/survivin can target CT26 more effectively, generate stronger anticancer effect and have the application as a better medicine for resisting colon cancer.

Sequence listing

<110> Sichuan university

<120> hyaluronic acid/DOTAP/survivin coding gene self-assembled ternary complex preparation and preparation method thereof

<130> A180576K

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 423

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgggagctc cggcgctgcc ccagatctgg cagctgtacc tcaagaacta ccgcatcgcc 60

accttcaaga actggccctt cctggaggac tgcgcctgcg caccagagcg aatggcggag 120

gctggcttca tccactgccc taccgagaac gagcctgatt tggcccagtg ttttttctgc 180

tttaaggaat tggaaggctg ggaacccgat gacaacccga tagaggagca tagaaagcac 240

tcccctggct gcgccttcct cactgtcaag aagcagatgg aagaactaac cgtcagtgaa 300

ttcttgaaac tggacagaca gagagccaag aacaaaattg caaaggagac caacaacaag 360

caaaaagagt ttgaagagac tgcaaagact acccgtcagt caattgagca gctggctgcc 420

taa 423

<210> 2

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cccaagctta agatgggagc tccggcgctg c 31

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctctagatt aggcagccag ctgctcaatt 30

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acctacccta tcactcacac tagca 25

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaggctcatc ctgatcatag aatg 24

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgagttccc ctaccaatac cacaccc 27

Claims

1. A ternary complex formulation characterized by: the material is prepared from the following raw materials in parts by weight: 0.1-1 part of hyaluronic acid, 5-10 parts of liposome and 1 part of recombinant expression vector loaded with survivin coding gene, wherein the liposome comprises the following components in parts by weight: DOTAP: DOPE = 1: 0.5-1; the recombinant expression vector loaded with the survivin coding gene is a pVAX plasmid vector.

2. The ternary complex formulation according to claim 1, characterized in that: the material is prepared from the following raw materials in parts by weight: hyaluronic acid 0.6 parts, liposome 6 parts, and recombinant expression vector loaded with survivin coding gene 1 part.

3. The ternary complex formulation according to claim 1 or 2, characterized in that: the liposome consists of the following components in parts by weight: DOTAP: DOPE = 1: 1.

4. The ternary complex formulation according to claim 1 or 2, characterized in that: the survivin coding gene is a coding gene of survivin mutant survivin-T34A.

5. The ternary complex formulation according to claim 3, characterized in that: the survivin coding gene is a coding gene of survivin mutant survivin-T34A.

6. The ternary complex formulation according to any one of claims 1, 2 or 5, characterized in that: the nucleotide sequence of the survivin coding gene is shown as SEQ ID No. 1.

7. The ternary complex formulation according to claim 3, characterized in that: the nucleotide sequence of the survivin coding gene is shown as SEQ ID No. 1.

8. The ternary complex formulation according to claim 4, characterized in that: the nucleotide sequence of the survivin coding gene is shown as SEQ ID No. 1.

9. The ternary complex formulation according to any one of claims 1 to 2, 5 or 7 to 8, wherein: the molecular weight of the hyaluronic acid is 10-100 kDa.

10. The ternary complex formulation according to claim 3, characterized in that: the molecular weight of the hyaluronic acid is 10-100 kDa.

11. The ternary complex formulation according to claim 4, characterized in that: the molecular weight of the hyaluronic acid is 10-100 kDa.

12. The ternary complex formulation according to claim 6, characterized in that: the molecular weight of the hyaluronic acid is 10-100 kDa.

13. A method for preparing the ternary complex formulation of any one of claims 1 to 12, characterized in that: the method comprises the following steps: preparing liposome from DOTAP and DOPE in each weight ratio, adding a recombinant expression vector containing a survivin coding gene for incubation, and adding hyaluronic acid for incubation to obtain the liposome.

14. The method of claim 13, wherein: the liposome is prepared by a film dispersion method.

15. The method of claim 13, wherein: the preparation method of the liposome comprises the following steps: dissolving DOTAP and DOPE in organic solvent, removing organic solvent to form film, and hydrating to obtain liposome.

16. The method of claim 14, wherein: the preparation method of the liposome comprises the following steps: dissolving DOTAP and DOPE in organic solvent, removing organic solvent to form film, and hydrating to obtain liposome.

17. The method according to any one of claims 15 or 16, wherein: the organic solvent is chloroform.

18. The method of claim 13, wherein: the preparation method of the liposome comprises the following steps: dissolving DOTAP and DOPE in chloroform according to the mass ratio, evaporating on a rotary evaporator to remove the organic solvent, and further drying the formed film for 4 hours under the vacuum condition; subsequently hydrating the dried lipid film in physiological saline; then, the liposome is further dispersed by probe ultrasound until a semitransparent liposome solution is obtained, and the solution is filtered through a 0.22 micron microporous membrane and stored at 4 ℃ for later use.

19. The method according to any one of claims 14 to 16, wherein: the preparation method of the liposome comprises the following steps: dissolving DOTAP and DOPE in chloroform according to the mass ratio, evaporating on a rotary evaporator to remove the organic solvent, and further drying the formed film for 4 hours under the vacuum condition; subsequently hydrating the dried lipid film in physiological saline; then, the liposome is further dispersed by probe ultrasound until a semitransparent liposome solution is obtained, and the solution is filtered through a 0.22 micron microporous membrane and stored at 4 ℃ for later use.

20. The method of claim 17, wherein: the preparation method of the liposome comprises the following steps: dissolving DOTAP and DOPE in chloroform according to the mass ratio, evaporating on a rotary evaporator to remove the organic solvent, and further drying the formed film for 4 hours under the vacuum condition; subsequently hydrating the dried lipid film in physiological saline; then, the liposome is further dispersed by probe ultrasound until a semitransparent liposome solution is obtained, and the solution is filtered through a 0.22 micron microporous membrane and stored at 4 ℃ for later use.

21. The method of claim 13, wherein: at least one of the following is satisfied:

the incubation time for adding the recombinant expression vector loaded with the survivin coding gene is 30 minutes;

the incubation time with the addition of hyaluronic acid was 30 minutes;

the concentration of hyaluronic acid is 1 mg/ml.

22. Use of the ternary complex formulation of any one of claims 1 to 12 in the preparation of an anti-tumor medicament.