CN109112150A

CN109112150A - Application of the OsLUT2 gene in the protection of rice light

Info

Publication number: CN109112150A
Application number: CN201711302425.8A
Authority: CN
Inventors: 王功伟; 刘畅
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2017-12-11
Filing date: 2017-12-11
Publication date: 2019-01-01
Anticipated expiration: 2037-12-11
Also published as: CN109112150B

Abstract

The invention belongs to field of plant genetic project technology, and in particular to application of the OsLUT2 gene in the protection of rice light.The nucleotide sequence of OsLUT2 gene is as shown in sequence table SEQ ID NO:1.The present invention passes through CRISPR technology; have studied the phenotype of mutant after rice Os LUT2 gene function is lost; demonstrate the physiological function of the gene in rice, it was demonstrated that OsLUT2 gene controls Chinese NPQ phenotype in rice, and the light protection of OsLUT2 gene pairs rice has played important function.

Description

Application of the OsLUT2 gene in the protection of rice light

Technical field

The invention belongs to field of plant genetic project technology, and in particular to OsLUT2 gene is in the protection of adjusting and controlling rice light Using.The OsLUT2 gene is a kind of rice lycopene ε cyclase (lycopene epsilon cyclase) gene (number of logging in is Os01g0581300), the function and its application in the protection of rice light that the present invention verifies the gene, are rice Genetic improvement provide the application approach of new genetic resources.

Background technique

Light is necessary to photosynthesis of plant, and the luminous energy of Photosynthetic Apparatus in Plant Chloroplast pigment absorption passes through photochemistry Process is converted into stable chemical energy.However, the energy that in most cases plant receives will be more than the energy that it can be converted, If excessive luminous energy dissipates not in time, photosynthetic function can be reduced, and lead to photosynthetic Xanthophyll cycle, or even photooxidation occur Change, photo damage.When the environmental stress factors such as high temperature, low temperature, water deficit, subalimentation exist simultaneously, plant is to Xanthophyll cycle The sensibility of condition increases, and in, Xanthophyll cycle will occur under low light intensity.Plant forms a variety of protection machines during evolution System, wherein the heat dissipation dependent on Zeaxanthin cycle (Xanthophyll cycle) acts in recent years by common concern.It It plays an important role in the excitation energy that dissipates, it is considered to be the main path of light protection.However, in addition to Zeaxanthin cycle pigment Outside, lutern derived from alpha-carotene, as the structural constituent for catching light complex subunit, by the surplus for promoting plant absorption The dissipation protection plant of luminous energy avoids photo oxidative damage.In addition, many in vitro studies prove, the anti-oxidation function of lutern is main It is to protect Photosynthetic to avoid photo oxidative damage by singlet-oxygen quenching and scavenging activated oxygen.Lycopene ε in rice Cyclase (lycopene epsilon cyclase) is one of the important enzyme of lutern route of synthesis as coded by OsLUT2. Therefore, the relationship studied between OsLUT2 gene and Plant Light protection is of great significance.

When the luminous energy of plant absorption is more than that it is taken, superfluous luminous energy will lead to photoinhibition, to be substantially reduced Photosynthetic efficiency.Studies have shown that when the light quantum flux density for being radiated at blade reaches the 1/4 of maximum solar radiation intensity, leaf Piece photosynthetic rate A has tended to be saturated.It cannot be used for photochemical reaction, the excitation energy that can not be dissipated in the form of fluorescence and heat Oxygen molecule is transferred to, the active oxygen radical to Photosynthetic tool high-destruction is generated.Heat dissipation is to feed back deexcitation Mechanisms mediate carry out, can by measurement chlorophyll fluorescence it is non-it is photochemical be quenched (Non-photochemical quenching, NPQ) parameter is measured.It is non-it is photochemical be quenched adjust Photosystem I I energy conversion, protect the plants from or mitigate Xanthophyll cycle.It is non- Photochemical be quenched induces generation by high light intensity, the relaxation with closing high light intensity.According to its Relaxation Kinetics (Relaxation Kinetics) characteristic, non-photochemical be quenched can be divided at least three component: rely on energy be quenched qE, state conversion be quenched qT and QI is quenched in Xanthophyll cycle, and wherein qE is the main component in higher plant.To model plant arabidopsis studies have shown that thylakoid The luteole of dynamic accumulation, lightsystemⅡ PsbS albumen and its expression quantity are that control is non-in transmembrane pH gradient, Zeaxanthin cycle The photochemical important factor that generation is quenched and determines qE and entire NPQ amount of capacity.Think that the binding mode of qE is as follows at this stage: When the chemical energy that light reaction generates in photosynthesis has been more than anabolic reaction such as CO₂When fixed ability, chloroplast thylakoids chamber Interior acidity gradually increases.PH value, which constantly declines, has activated viomellein decylization oxygenase (Violaxanthin de-epoxidase), The enzymatic is changed into luteole into viomellein under strong light.Luteole has dual function, on the one hand it takes part in non-photochemical quench In addition the formation gone out also has the function of direct antioxidant.The decline of chloroplast thylakoids chamber pH value further promotes lightsystemⅡ The protonation of PsbS albumen results then in the change of the light-harvesting protein complex conformation in conjunction with chlorophyll and carotenoid.It crosses Surplus excitation can dissipation be by carotenoid radical cation charge transfer mechanism and chlorophyll and carotenoid it Between energy transmission carry out.

Lutern (C₄₀H₅₆O₂) be a kind of double hydroxyls lutein, with zeaxanthin isomer each other.In high plant Main carotenoid is lutern, carrotene, violaxanthin, antheraxanthin, zeaxanthin, neoxathin etc. in object, wherein with The content of lutern is most.Many researchs have shown that the non-photochemistry of mediation that lutern can be direct or indirect as zeaxanthin The rapid induction of quenching, dissipate the superfluous luminous energy being absorbed into, to prevent chloroplaset by photo oxidative damage.At present to lutern The mechanism of NPQ induction is directly or indirectly mediated, there are two types of different viewpoints.A kind of foundation thinking lutern indirect induction NPQ Be: the PSII antenna of mutant also correspondingly becomes smaller after lacking lutern, and the antenna for losing lutern can change that catch photopigment multiple Fit structure, and the variation of induced conformational, to reduce luminous energy quenching rate, so lutern perhaps will not directly exist In energy Quenching mechanism.And it is yes that another kind, which thinks that lutern directly induces the viewpoint of NPQ mechanism: the excitation energy state of lutern Have between the spectrum of both the excitation state of chlorophyll overlapping, the optical physics ability of lutern and its site are quenching singlet leaves Necessary to green element Chl, it is believed that lutern has directly mediated the induction of NPQ as a kind of quencher of energy

The Antioxidative Defense System of higher plant complex network institute as composed by some enzymes and non-enzyme antioxidant It constitutes.In the research of some extracorporeal modes, it has proved that lutern has quenching singlet oxygen O₂With the function for removing free radical Energy.

Rice is usually grown under the conditions of high Natural light intensity, and sunny noon actinic light quantum flux density (PPFD) is general In 2,000 μm of ol m^-2s^-1More than, photosynthesis has just been saturated when being far below largest light intensity.QE is in rice major part leaf Can be by induced strong in piece, to dissipate safely, superfluous excitation can, avoid or mitigate Xanthophyll cycle, this health sustainable for rice It grows extremely important.The gene OsPsbS1 of control qE value, the gene expression amount and plant NPQ are only cloned in rice at present Value is positively correlated in significant.

The present invention inhibits the expression of the gene using CRISPR technology, to carry out the phenotype of observation of plant, verifies gene Function.OsLUT2 gene control NPQ isophenous in rice is demonstrated, important function has been played to the strong light protection of rice.

CRISPR technical principle: when bacterium resists the invasion of the exogenous DNAs such as bacteriophage, under the regulation of leader, CRISPR is transcribed into long RNA precursor (Pre RISPR RNA, pre-crRNA), is subsequently processed into a series of short contain The mature crRNA of conservative repetitive sequence and spacer region, finally identifies and is integrated to play on the exogenous DNA array being complementary and cut The effect of cutting.CRISPR is exactly to utilize this system, is artificially introduced the sequence of one section and target dna targeting.So in the cell CrRNA, tracrRNA and Cas9 form complex, identify and are incorporated into the sequence of crRNA complementation, then unlock DNA double chain, shape At R-loop, make crRNA and complementary strand thereof, another chain keeps free single-chain state, then living by the HNH in Cas9 Property site shearing crRNA complementary dna chain, RuvC active site shear incomplementarity chain, be eventually introduced DNA double chain fracture (DSB).So that target dna is formed different size of missing, causes target gene can not be with normal level transcription and translation.

Summary of the invention

It is an object of the invention to overcome the deficiencies of existing technologies, clone obtains a kind of OsLUT2 gene from rice, benefit Successfully conversion carrier is constructed with CRISPR technology, by Agrobacterium-mediated genetic transformation by the OsLUT2 channel genes water In rice host, the present invention inhibits the expression of the gene by knocking out the gene in Transgenic studies simultaneously, further Ground has studied functional expression of the gene in rice plant, demonstrates the physiological function of the gene in rice, it was demonstrated that the base Because playing an important role in the strong light protection of plant.

Shown in technical scheme is as follows

Applicant's separation has cloned a kind of pair of rice light protection and has had effective functional gene, which is named as OsLUT2 gene, as shown in sequence table SEQ ID NO:1, the accession number in ncbi database is its nucleotide sequence XM_015766712, albumen annotation are chloroplastic lycopene epsilon cyclase.Shown in the gene The 388-407 of the sequence of 3745bp；1894-1913 is the gene specific target position, wherein in the gene order 1908-1911 base positions have lacked four bases: CTTT.

To the un-mixing bases because of the biological function verification of progress, show that OsLUT2 gene plays weight in the protection of rice light The effect wanted further demonstrates the application approach of OsLUT2 gene by genetic transformation test.

The NPQ value of transgenic positive plant is significantly lower than transgene negative plant it can be seen from table 2, table 3 and Fig. 3.Table Bright LUT2 gene makes the light protective capability of plant have conspicuousness decline after knocking out using CRISPR technology, it was demonstrated that LUT2 gene pairs water The light protection process of rice plays certain regulating and controlling effect.

Detailed description of the invention

Sequence table SEQ ID NO:1 is the nucleosides with the gene OsLUT2 of adjusting and controlling rice light protective capability that the present invention clones Acid sequence (3745bp).

Fig. 1: being Technology Roadmap of the invention.

Fig. 2: T₀Turn OsLUT2 gene regeneration plant positive detection glue figure.

Fig. 3: T₀In generation, turns OsLUT2 gene regeneration plant Phenotype Distribution and significance test.

Fig. 4: CRISPR/gRNA vectors plasmid construction route and map of the present invention.

Fig. 5: pYLCRISPR/Cas9-MH (B) plasmid construction route and map of the present invention.

Fig. 6: pYLCRISPR/Cas9-MH-LUT2 plasmid construction route and map of the present invention.Appended drawing reference is said Bright: T1 is first target spot AGTCCATGGACAGCCAGTCC；T2 is second target spot GGGATCGTGAGGTACTTTGC.

Specific embodiment

Embodiment 1

The building of 1.CRISPR carrier

The specific primer in target gene is targeted with the design of rice varieties " OryzasativaLcv.Nipponbare " sequencing sequence, building CRISPR is carried Body.Applicant controls its target site and falls in LUT2 gene first with two CRISPR target sites of LUT2 sequence design Exon region.Two target connectors are linked with CRISPR/gRNA-U3 and CRISPR/gRNA-U6a plasmid respectively, are utilized GRNA-U3 and gRNA-U6a are completely cut and are commonly connected to pYLCRISPR/Cas9-MH by Bsa I restriction enzyme On carrier, final pYLCRISPR/Cas9-MH-LUT2 plasmid is obtained, and whole plasmid is transferred in OryzasativaLcv.Nipponbare callus.Subculture, After co-cultivation, the transgenic seedling that the gene coding region OsLUT2 is knocked 4 bases is obtained, its NPQ (non-photochemistry is finally observed It is quenched) phenotype, verify critical function of the gene in the protection of adjusting and controlling rice light.Genetic transformation receptor rice used in test Material is japonica rice variety OryzasativaLcv.Nipponbare (Oryza.Sativa L.spp.japonica), is general types.

The selection of 1.1 genome target sites and double-stranded adapters design

1.1.1 target site selects

If can find the base of the upstream NGG the 20th in target area is A (with U3 promoter, sequence sees below described) or G The sequence (the transcription initiation base that A, G are respectively U3 and U6a promoter) of (using U6a promoter, sequence sees below described), it is preferential to select For the synthetic linker of target sequence.If base is not A or G the upstream NGG the 20th, optional 20 bases are that target sequence synthesis connects Head.In order to improve mutation efficiency, two target spots can be designed to a target gene.Such as in the area ORF 5` and functional domain Respectively 1 target spot of design, the mutation for being allowed to any 1 target spot can generate afunction, or by the sequence between two target spots It is knocked.Target sequence GC% is higher to can be improved target practice efficiency, therefore target spot preferably contains 11-14 C/G (including U6 is transcribed Initial point G).

OsU3 promoter sequence

CTCTGGAATCGGCAGCAAAGGACGCGTTGACATTGTAGGACTATATTGCTCTAATAAAGGAAGGA ATCTTTAAACATACGAACAGATCACTTAAAGTTCTTCTGAAGCAACTTAAAGTTATCAGGCATGCA TGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGCACAAGACAGGCGTCTTCTACTGGT GCTACCAGCAAATGCTGGAAGCCGGGAACACTGGGTACGTTGGAAACCACGTGTGATGTGAAGGA GTAAGATAAACTGTAGGAGAAAAGCATTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGTATTG CAGTATGGGCCGGCCCATTACGCAATTGGACGACAACAAAGACTAGTATTAGTACCACCTCGGCT ATCCACATAGATCAAAGCTGGTTTAAAAGAGTTGTGCAGATGATCCGTGGC

OsU6a promoter sequence

CTCTGGAATCGGCAGCAAAGGATTTTTTCCTGTAGTTTTCCCACAACCATTTTTTACCATCCGA ATGATAGGATAGGAAAAATATCCAAGTGAACAGTATTCCTATAAAATTCCCGTAAAAAGCCTGCA ATCCGAATGAGCCCTGAAGTCTGAACTAGCCGGTCACCTGTACAGGCTATCGAGATGCCATACAA GAGACGGTAGTAGGAACTAGGAAGACGATGGTTGATTCGTCAGGCGAAATCGTCGTCCTGCAGTC GCATCTATGGGCCTGGACGGAATAGGGGAAAAAGTTGGCCGGATAGGAGGGAAAGGCCCAGGTG CTTACGTGCGAGGTAGGCCTGGGCTCTCAGCACTTCGATTCGTTGGCACCGGGGTAGGATGCAATA GAGAGCAACGTTTAGTACCACCTCGCTTAGCTAGAGCAAACTGGACTGCCTTATATGCGCGGGTG CTGGCTTGGCTGCC

1.1.2 target spot specificity inspection

Although not being important problem to the specificity that plant gene is practiced shooting, just in case have the non-spy of negative effect Different target practice just separates mutant and original receptor parents (and backcrossing) and excludes non-specific target practice site, but should will wait It selects target sequence+NGG (upstream and downstream adds tens bases) to be Blast to target gene group, avoids in the 3` end+NGG of target sequence and its Its functional gene and genome sequence show similitude.It is contemplated that knocking out two or more homologous genes with a target sequence When, just selecting the identical region of several target genes is target site.

Two pairs of OsLUT2 specificity target spot primers of sequence as follows are devised according to the above regular applicant:

LUT2-U3-F:ggcaGGGATCGTGAGGTACTTTGC,

LUT2-U3-R:aaacGCAAAGTACCTCACGATCCC；

LUT2-U6a-F:gccGGACTGGCTGTCCATGGACT,

LUT2-U6a-R:aaacAGTCCATGGACAGCCAGTC.

1.2 actication of culture and plasmid extract preparation

By pYLCRISPR/Cas9-MH (B) strain (Liu Yao light seminar of Agricultural University Of South China give) (TOP10F) and CRISPR/gRNA vectors strain DH10B (Liu Yao light seminar of Agricultural University Of South China give) is containing 25 μ g/ml's respectively Kanamycins and 50 μ g/ml ampicillin plate culture mediums mark activation single colonie, take single colonie culture 1ml seed liquor, then Expand culture, for extracting plasmid.

PYLCRISPR/Cas9-MH (B) carrier is larger (about 16.5kb), and copy number is lower (pBR322 replicon), uses The rate of recovery of the small-sized column extraction purification of plasmid is lower, therefore the most handy big Column kit for being suitable for extracting compared with Large plasmid (the EndoFree Maxi Plasmid Kit kit of biochemical (Beijing) the Science and Technology Ltd. production of such as Tiangeng) extraction purification. Specific step is as follows (reagent used in below step (1) to (10) or buffer are all from the included reagent of the kit).Tool Body step:

(1) inoculation monoclonal in 500ml/1L corresponding resistant LB culture medium, in 37 DEG C shaking overnight (200-250rpm, 16-18 hours).

(2) bacterium solution is collected with 500ml centrifuge tube, is centrifuged 10min in 5000g, abandons clean supernatant as far as possible.

(3) 30ml solution I (containing RNA enzyme 100ug/ml) is added, concussion, which is resuspended, mixes thallus.

(4) 50ml solution II is added, slowly spins upside down centrifuge tube about 10 times, is placed at room temperature for 10min.

(5) 40ml solution III (pH=5.2) is added, is uniformly mixed, ice bath 10min.

(6) supernatant is filtered into a new 500ml triangular flask in 5000g 4 DEG C of centrifugations 15min, miracloth.Precipitating ratio Loosely, very clean supernatant can be obtained with miracloth filtering, prevents impurity from blocking QIAGEN-tip.If no Miracloth, can multiple centrifuging and taking supernatant, to obtain very clean supernatant

(7) 10ml buffer QBT is added in 100/500 pillar of QIAGEN-tip, is filtered by gravity, Activate Filter column.

(8) pillar that the supernatant that step 6 obtains is slowly flowed across to QIAGEN-tip 100/500, with 10/30ml buffer QC is washed QIAGEN-tip 2 times.

(9) 15ml buffer QF dissolving DNA is used, then is collected with 50ml centrifuge tube.

(9) 10.5ml isopropanol is added, 12000g after mixing, 4 degree of centrifugation 20min abandon supernatant.

(10) 70% ethanol washing of 5ml is added, 12000g, 4 DEG C of centrifugation 10min abandon supernatant, natural air drying.100/500μ L TE buffer dissolution, -20 DEG C of placements are spare.

The preparation of 1.3 target spot connectors

Adapter-primer TE dissolution is made to 100 μM of mother liquor, 1 μ l is respectively taken to be added to 98 μ l 0.5x TE mixed dilutings to 1 μ M.About 90 DEG C of 30s move to room temperature cooling, complete annealing.

1.4 side trimmings connect

It prepares 10 μ l 1x BsaI digestions connection reaction solution: ATP (three phosphorus being added in 1x Bsa I- restriction endonuclease Buffer Adenosine monophosphate) to final concentration 0.5-1.0mM, addition about 20ng pYLgRNA-OsU# plasmid (prepares 20ng/ μ l preservation) in advance, 0.5 μ l connector (0.05 μM of ultimate density), 5U BsaI, 35U T4DNA ligase (buffer (buffer) to Bsa I and Ligase is effective).If laboratory does not have ATP, 0.2-0.3 μ l 10x NEB is added in 1x restriction endonuclease Buffer T4DNA ligase buffer (contains 10mM ATP, but the precious biological work of 10x in 10x NEB T4DNA ligase buffer Contain 1.0mM ATP in the T4DNA ligase buffer of Cheng great Lian Co., Ltd, therefore preferentially using NEB company；Or add Add the T4DNA ligase buffer of 1 μ l 10x treasured bioengineering Dalian Co., Ltd).It is followed with temperature varied cyclical instrument or PCR instrument Ring reacts 5 circulations: 37 DEG C of 5min, 20 DEG C of 5min.

1.5 amplification gRNA expression cassettes

1.5.1 the first round expands

Taking 1 μ l connection product is template, uses primer U-F (being shown in Table 1)/connector reverse primer LUT2-U3-R and LUT2- U6a-R (reacting 1) and connector forward primer LUT2-U3-F and LUT2-U6a-F/gRNA-R (being shown in Table 1) (reacting 2), respectively 0.2 μM, appropriate High fidelity PCR enzyme, it is preferred to use KOD-Plus (is purchased from TOYOBO company), fidelity highest and cost performance height, Or the ExTaq of KODFX or Takara company.Not use can make product in the Taq enzyme of the additional A base of product 3`, this A base It is not matched with complementary strand in the second wheel PCR and filling-in cannot be extended).

25-28 circulation: 95 DEG C of 10s, 60 DEG C of 15s, 68 DEG C of 20s.

Take 4 μ l electrophoretic examinationss (reaction 2 product lengths about 140bp is detected with 2% agarose gel).If amplified production compared with It is weak, it can continue to the second wheel PCR.

1.5.2 the second wheel amplification

First round PCR is taken to react 1,2 product, 1 μ l H₂O dilutes 10 times, and 1 μ l is respectively taken to be mixed into template.Each expression cassette 20- 50 μ lPCR (1 50 μ l of target spot；Each 30 μ l of 2-3 target spot；Each 20 μ l of 4 or more target spots).Every kind of primer of 1/10 amount is added Work in combination liquid (0.15 μM of ultimate density).Use appropriate KOD-Plus or other High fidelity PCR enzymes.Expand 15-20 circulation: 95 DEG C of 10s, 58 DEG C of 15s, 68 DEG C of 20s.It takes whether 2-3 μ l electrophoretic examinations product length meets, and estimates the substantially concentration of sample.

U3-gRNA utilizes mix primer PT1 (B1`+B2) (being shown in Table 1)；U6a-gRNA utilizes mix primer PT2L (B2`+ BL) (1 is shown in Table) to carry out the second wheel amplification.

Labeled primer sequence used in 1 present invention of table

GRNA expression cassette is linked whole carrier by 1.6

1.6.1 the purifying of amplified production

According to each sample product amount all product mixed in equal amounts, (it is purchased from using PCR product purifying kit purification kit Tiangeng biochemistry (Beijing) Science and Technology Ltd.) it is purified.Specific step is as follows:

(1) the Buffer PCR-A of 3 times of volumes is added in PCR reaction solution, if the Buffer PCR-A that need to be added is insufficient 100 μ l are then added in 100 μ l.

(2) DNA-prep Tube is placed in 2-ml Microfuge Tube, by step (1) in mixed liquor move into In DNA-prep test tube, 5500rpm is centrifuged 1min.

(3) filtrate is abandoned, DNA-prep test tube is put back into former 2-ml Microfuge test tube, 500 μ l Buffer are added W1,5500rpm are centrifuged 1min.

(4) filtrate is abandoned, DNA-prep test tube is put back into former 2-ml Microfuge test tube, 700 μ l are added and have added nothing Buffer W2,5500rpm the centrifugation 1min of water-ethanol, has added dehydrated alcohol with 700 μ l again in the same way BufferW2 washed once.

(5) filtrate is abandoned, DNA-prep test tube is put back into former 2-ml Microfuge test tube, 14000rpm centrifugation 1min。

(6) even filtrate discards collecting pipe together, and DNA-prep test tube is placed in a new 1.5ml centrifuge tube, 25-30 μ l Eluent or deionized water (65 DEG C of preheatings) is added in silica film center.

(7) it is stored at room temperature 2min, 14000rpm is centrifuged 1min eluted dna

1.6.2 purified product connects whole carrier

About 20ng purified product is taken, the uncut pYLCRISPR/Cas9-MH of about 60ng (B) plasmid (beforehand dilution is added At about 100ng/l freezen protective), in 15 μ l reaction (1x Bsa I- restriction endonuclease Buffer), 37 DEG C of digestions of 10U BsaI 10min (excessive BsaI and not crossed for a long time, otherwise carrier, which can generate, destroys smooth end and connect certainly).It is dense to end that ATP is added Spend 1.0mM.It is recycled with temperature varied cyclical digestion connection 15: 37 DEG C of 2min；10 DEG C of 3min, 20 DEG C of 5min；Last 37 DEG C of 2min.It should Method is characterized by: due to not having to remove the 13/17 base small fragment and ccdBs segment that Bsa I is cut out, they can be connected by competition Take back original position.Even reaction again can be cut off the segment that connection is gone back by Bsa I for this alternating temperature side trimming, and connect Target product sequence is not cut off since there is no the recognition site of Bsa I.

The conversion of 1.7 electrizations

Connection product drop is loaded in floated dialysis membrane Millipore VSWP04700 (aperture is 0.025 μm) to 1/5x TE dialyse 15-30min (preferably in 4 DEG C of refrigerators) desalination (or use ethanol precipitation, 70% ethyl alcohol washes, it is air-dried be dissolved in 5 μ l go from Sub- water), take 1-1.5 μ l connection product Electroporation Escherichia coli (E.coli) DH10B competent cell (although other bacterial strains It can use, but DH10B is more suitable for high efficiency Electroporation Large plasmid.Electroporation experiences the most handy SOB training of posture cell preparation Support base (ingredient is seen below) culture (not cultivated with LB).The card that 1ml SOC culture medium is LB+25 μ g/ml is added after electric shock, and that is mould Element, 0.3-0.5mM IPTG (use Lac Iq genotype strain 1.0 mM), appropriate X-gal.IPTG induction is not cut thoroughly Except the ccdBs expression of the empty plasmid transformant of ccdBs is lethal.And contain (the LacZ-OsU3-gRNA expression of target insetion sequence Box) positive colony expressed by LacZ and generate blue bacterial plaque.

1.SOB (Super Optimal Broth) culture medium

Every liter of culture medium is prepared, is added in 950ml deionized water:

Tryptone 20g；

Yeast extract 5g；

NaCl 0.5g；

Shaking container is completely dissolved solute.10ml 250mmol/L KCl solution is added (to go 1.86g KCl with 100ml Ionized water dissolution is made into 250mmol/l KCl solution).With 5mol/L KOH tune pH value to 7.0.It is settled to deionized water 1L.In 121 DEG C of high pressure steam sterilization 20min.The solution is before use, be added the 2mol/l MgCl2 [2mol/L of 5ml sterilizing The preparation method of MgCl2 solution is as follows: using 90ml deionized water dissolving 19g MgCl2, is with deionized water adjusting body product 100ml, the steam sterilizing 20min under 121 DEG C of high pressures].

2.SOC (Super Optimal broth with Catabolite repression) culture medium

SOC culture medium is in addition to containing 20mmol/L glucose, other compositions identical as SOB culture medium

SOB culture medium is cooled to 60 DEG C or 60 DEG C or less after high pressure sterilization, adds the 1mol/L glucose solution of 20ml degerming ?.

2. the rice conversion of mediated by agriculture bacillus

2.1 reagents and culture medium

1.KT (Kinetin), company/article No. Sigma Cat No.K-0753；

2.6-BA (6-BenzylaminoPurine), company/article No. Sigma Cat No.B-5898；

3.IAA (Indole-3-acetic acid), company/article No. Sigma Cat No.I-5148；

4.NAA (Napthalene acetic acid), company/article No. Sigma Cat N-0640；

5.2,4-D (2,4-Dichlorophenoxyacetic acid), company/article No. Sigma Cat No.D-8407；

6.CH (Casein Enzymatic Hydrolysate), company/article No. Sigma Cat No.C-7290；

7.Kanamycin, company/article No. USB Cat No.17924；

8.Cn (Carbenicillin), company/article No. GiBco BRL Cat No.10177-012；

9.Hn (hygromycin B), company/article No. GiBco BRL Cat No.10687-010；

10.AS (Acetosringone), company/article No. Aldrich chem., CO 01531EG；

11.Pyridoxine HCl, article No. Sigma Cat No.P-8666；

12.Nicotinic acid, company/article No. Sigma Cat No.N-0765；

13.Inositol, company/article No. Sigma Cat No.I-3011；

14.Thiamine HCl, company/article No. Sigma Cat No.T-3902；

15.Phytagel, company/article No. Sigma Cat No.P-8169；

16.Dimethyl Sulfoxide-DMSO, company/article No. Sigma Cat No.D-5879；

17.X-gluc (5-bromo-4-chloro-3-indolyl-D-galactoside), company/article No. Sigma Cat No.B-3783；

18.MS a great number of elements (MSmax) stock solution (10 times of volumes, a times volume are abbreviated as X, similarly hereinafter)

NH₄NO₃16.5g；

KH₂PO₄ 1.7g

KNO₃ 19.0g

MgSO₄·7H2O 3.7g

CaCl₂3.32g or CaCl₂·2H₂O 4.4g

Then plus dH2O to 1000ml it dissolves one by one,.

19.MS microelement (MSmin) stock solution (100X)

MnSO₄·4H₂O 2.23g；

ZnSO₄·7H₂O 0.86g；

KI 0.083g；

H₃BO₃0.62g；

Na₂MoO₄·2H₂O 0.025g；

CoCl₂·6H₂O 0.0025g；

CuSO₄·5H₂O 0.0025g；

Note: Na₂MoO₄It must individually dissolve, then be mixed with other components, supplement dH₂O is settled to 1000ml；Room temperature preservation.

20.N6 a great number of elements (N6max) stock solution (10X)

KNO₃28.3g；

(NH₄)SO₄4.63g；

KH₂PO₄4.0g；

MgSO₄·7H₂O 1.85g；

CaCl₂1.25g；Or CaCl₂·2H₂O 1.66g；

Then plus dH it dissolves one by one,₂O is settled to 1000ml.

21.N6 microelement (N6min) stock solution (100X)

KI 0.08g；

H₃BO₃0.16g；

ZnSO₄·7H₂O 0.15g；

MnSO₄·4H₂O 0.44g；Or MnSO₄·H₂O 0.3335g；

Use dH₂O is settled to 1000ml；Room temperature preservation.

22.Fe₂+-EDTA stock solution (100X)

300ml dH is added into a reagent bottle₂O and FeSO₄·7H₂O 2.78g, then be added into another reagent bottle 300ml dH₂O, and 70 DEG C are heated to, Na is then added₂EDTA·2H₂It, will be molten in two bottles after O 3.73g, dissolution are good Liquid mixing keeps the temperature 2 hours at 70 DEG C, and then plus dH2O is settled to 1000ml；4 DEG C are kept in dark place.

Vitamin 23. (Vitamin) stock solution (100X)

Nicotinic acid 0.1g；

Thiamine HCl(VB1) 0.1g；

Pyridoxine HCl(VB6) 0.1g；

Inositol 10g；

Glycine 0.2g；

Add dH₂O is settled to 1000ml；4 DEG C of preservations.

24.AAmax stock solution (10X)

KCl 29.50g；

MgSO₄·7H2O 2.50g；

NaH₂PO₄1.50g；

CaCl₂·2H₂O 1.50g；

Add dH₂O is settled to 1000ml；Room temperature is kept in dark place.

25.AAmin stock solution (100X)

MnSO₄·H₂O 1.0g；

ZnSO₄·7H₂O 0.2g；

CuSO₄·5H₂O 0.0025g；

H₃BO₃0.3g；

KI 0.075g

CoCl₂·6H₂O 0.0025g；

NaMoO₄·2H₂O 0.025g；

By Na₂MoO₄Individually dissolution, then mixes with other components and adds dH₂O is settled to 1000ml；Room temperature is kept in dark place.

26. 6-BA stock solution (1mg/ml)

6-BA 100mg；

Then plus dH the KOH that 1.0ml 1N is added, which shakes to 6-BA, to be dissolved,₂O is settled to 100ml；Room temperature preservation.

27.KT stock solution (1mg/ml)

KT 100mg；

Then plus dH the KOH that 1.0ml 1N is added, which shakes to KT, to be dissolved,₂O is settled to 100ml；Room temperature preservation.

28. 2,4-D stock solution (1mg/ml)

2,4-D 100mg

Be added 1.0ml 1N KOH shake 5min, then plus 10ml dH2O and shake to 2,4-D dissolve, with dH2O constant volume To 100ml, room temperature preservation.

29.100mM AS stock solution

AS 0.196g；

DMSO 10ml；

It is dispensed with 1.5ml centrifuge tube；4 DEG C of preservations.

30.IAA stock solution (1mg/ml)

IAA 100mg；

The KOH that 1.0ml 1N is added, which shakes to IAA, to be dissolved, and dH is then used₂O is settled to 100ml；Room temperature is kept in dark place.

31.NAA stock solution (1mg/ml)

NAA 100mg；

The KOH that 1.0ml 1N is added, which shakes to NAA, to be dissolved, then uses dH₂O is settled to 100ml；Room temperature is kept in dark place.

32. the KOH stock solution of 1N

KOH 5.6g；

With 100ml dH₂O dissolution；Room temperature preservation.

33. 0.15% HgCl₂Solution is prepared

HgCl₂1.5g；

HgCl first is partially or completely solubilized with 1ml dehydrated alcohol₂, then use dH₂O is settled to 1000ml；Stirring 4-8 hours

Culture medium prescription:

Induced medium

Subculture medium

Pre-culture medium

Co-culture medium

Suspension medium

Screening and culturing medium

Differential medium

Root media

The induction of 2.2 callus

The sterile induced medium of 40-50ml is poured into the triangular flask of a 100ml；In superclean bench by water Rice peels glume off, first impregnates 1min (time cannot be too long) with the ethyl alcohol of 75% concentration, then with the HgCl of 0.15% concentration₂ Solution impregnates 15-25min, finally uses sterile water wash 5-10 times, spare；Every bottle of culture medium accesses 8~12 seeds, in room temperature Callus is generated through induction in 40~50 days under dark culture.

2.3 squamous subculture

2-3 days in advance preparation subculture mediums, sterilizing, making culture medium drying, (overly wet culture medium is unfavorable for callus Growth).

From the callus of induction, faint yellow, graininess is chosen, it is dry, and energetic callus is transferred to after being commissioned to train Support room temperature dark culture 20d in base；Do and infect after best subculture is primary, the most subcultures of each callus twice, otherwise callus Metaplasia efficiency reduces, and when first time subculture notices that the removals such as its hetero-organization such as endosperm or bud that will adhere on callus are done Only.

2.4 preculture

Prepared that 300 μ l are added in every 250ml culture medium before appropriate sterile pre-culture medium is tested with 500ml triangular flask in advance 40% glucose of AS (Acetosringone), 5ml and ware, every bottle fall culture medium can configure 8~10 culture dishes；

From subcultured callus, faint yellow, graininess is chosen, it is dry, and energetic callus is transferred to preculture In base, the callus of usually each ware inoculation 60-80 block or so mung bean size, the larger available tweezers of callus are caught broken, room Warm dark culture 3d.

2.5 infect and co-culture

The receptor of Agrobacterium-mediated Transformation is rice varieties " OryzasativaLcv.Nipponbare ".With contain CRISPR carrier pYLCRISPR/Cas9-MH- The bacterium solution of the EHA105 of LUT2 (see attached drawing 6) and pYLCRISPR/Cas9-MH empty carrier (see Fig. 5) infects " OryzasativaLcv.Nipponbare " seed and lures The callus led." OryzasativaLcv.Nipponbare " callus is protected from light in 19 DEG C after EHA105 bacterium solution infects and co-cultures 2d, washing, It is protected from light, 15d is cultivated at 28 DEG C and carries out the 1st screening, the resistant calli filtered out is protected from light and is further cultured for 15d at 28 DEG C Carry out the 2nd screening, the resistant calli until growing glassy yellow.The callus that 1 segment converts is shared into 10 trainings It supports ware (diameter 9cm), has 25 callus on each culture dish.Differentiation culture a period of time obtains regeneration plant, as T₀ For transgenic seedling.

3.T₀For the positive detection of transgenic regenerated plant

Transgenic plant genomic DNA is extracted using conventional CTAB method, as pcr template.By expanding selection markers Primer (being shown in Table 1) detects transgenic positive plant, and labeled primer used is shown in Table Cas9 primer in 1.PCR product size is 750bp.The PCR reaction system of 20 μ l includes: 20-50ng DNA profiling, 10mM Tris-HCl, 50mM KCl, and 0.1% Triton X-100,1.8mM MgCl₂, 0.1mM dNTP, 0.2 μM of primer and 1U rTaq DNA polymerase.PCR amplification Condition: 94 DEG C of initial denaturation 5min；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 34 circulations；72 DEG C extend to 10min.PCR Product is detected with 1% Ago-Gel.Testing result is shown in Fig. 1.In addition to LUT2 1-4, LUT2 1-8, LUT2 2-1, LUT2 2- 5, five plants of LUT2 2-6 are other than feminine gender, remaining transgenic plant is all positive.And with OsLUT2-cx-F/R primer in table one Sequencing is examined.

4. the measurement of chlorophyll fluorescence parameters

The measurement of the fluorescence correlations such as NPQ (non-Photochemical quenching) is the PAM-2500 leaf using the manufacture of Walz company of Germany Green element luminoscope.Specific measuring process includes the following steps: referring to the operation instructions of the instrument

Buffer is stored as blade in the agarose that laboratory prepares 0.01%；The sword-like leave leaf sample of field water intaking rice Tissue is placed in buffer, by sample dark treatment 2h or more；Middle part of blade is clamped with 2030-B leaf during being protected from light, is used PAM-2500 is measured.

The NPQ data (table 2 and table 3) of the CRISPR material of above-mentioned LUT2 are compared, find transgenic positive plant NPQ value be significantly lower than transgene negative plant.Show the light protection energy of plant after LUT2 gene is knocked out using CRISPR technology Power has conspicuousness decline, it was demonstrated that the light protection process of LUT2 gene pairs rice plays certain regulating and controlling effect.

The NPQ value of the 2 each plant of LUT2 transgenic positive plant of table

The NPQ value of the 3 each plant of LUT2 transgene negative plant of table

ID	Fv/Fm	NPQ
			LUT2 1-4	0.825	2.730
LUT2 1-8	0.820	2.882
			LUT2 2-1	0.819	2.862
LUT2 2-5	0.836	2.447
			LUT2 2-6	0.824	2.849

In conclusion the present invention is based on prior art problem, the primary study function of entire OsLUT2 gene is utilized CRISPR technology knocks out four bases of this gene coding region, so that the function of whole gene is lost, wherein in 3745bp The 388-407 of long sequence；1894-1913 sections are the gene specific target positions, and the selection of target spot is exactly to select this Coding sequence, and have the site of NGG+NNNNNN NNNNNNNNNNNNNN+A/G, it is knocked out using CRISPR technology After this gene, its light protection phenotype is observed, the light protective capability of rice has dropped (see Fig. 3 after discovery OsLUT2 gene knockout With table 2 and table 3), selecting the two target spots is exactly because the sequence of the two positions meets NGG+ in OsLUT2 sequence The requirement of NNNNNNNNNNNNNNNNNNNN+A/G, what the final purpose using CRISPR technology was is to obtain OsLUT2 gene quilt The plant of knockout, thus designing the two target spots is to improve target practice efficiency.When first target spot of applicant's design not It practices shooting successfully, also without generating base deletion.Second target spot of applicant's design successfully practices shooting and leads to 4 bases Missing, directly affects the normal translation of OsLUT2 albumen.OsLUT2 (measuring so that NPQ value is (non-Photochemical quenching)) has aobvious Work property decline, it was demonstrated that the light protection process of OsLUT2 gene pairs rice plays certain regulating and controlling effect.

Sequence table

<110>Hua Zhong Agriculture University

<120>application of the OsLUT2 gene in the protection of rice light

<141> 2017-12-09

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3745

<212> DNA

<213>rice (Oryza Sativa)

<220>

<221> gene

<222> (1)..(3745)

<220>

<221> mutation

<222> (1908)..(1911)

<220>

<221> mutation

<222> (1894)..(1913)

<220>

<221> mutation

<222> (388)..(407)

<400> 1

cagcagccag cagcagacgc agagaccagt agctttcgca gaggcggcag ccaccaccgc 60

ctcctcctcc tcctcctcat ccgacggtgt gcaaccaagc gatggagttc tccggcggcg 120

cgaccgtgtc ggcgccgttc ggttgctgcc gtgcggcgtg gggcgccgcg gcggcgggtg 180

cgggggcgga gggaaggagc aggagggttg tgccgcgcgc ggtggagccg cggcggcgcg 240

ggcggtggat ggtgaggtgc gtggcgacgg agaagcacaa ggacgcggcg gcgcggcgcg 300

gcggcgtgga ggtggagttc gccgacgagg aggactacgt caagggcggc ggcggcgagc 360

ttctctacgt gcaaatgcag gcgtccaagt ccatggacag ccagtccaag atctcctcca 420

aggtaggagg agtagcagta aataaatcat atcactactc caattttttt tgtttgttta 480

tgcatgccta gatgatcttg attttagcag ttaattagca ttatgcaagg tcgagatctg 540

gctttataca aaacccacaa tcaccttgct gccatggttg ccgtttacaa gaaagaatca 600

aacacgaaat tcatcaacag catgaatgaa acactgttgc atcgccctga tcacgcgcgt 660

gctacgacga cgggtgtgga atgttgattc acgtgatgct atcacgaatt cactccatat 720

cttgaccaaa aaaaaaaaaa gagcagcctc tggttgccca tgcttgctgc tgcctgccat 780

atctctgtgg agcttggact attctccatg tctcctgtaa tgggagctca cgtcgtcgcc 840

tgtacaaaag gtgttaatta ggggataagt taagagtatc tcatactgtt ctcaactcaa 900

ctgctgacta attacacctt cggatgcaac ttggaacgta ctgttgcatt aattattgtc 960

tgcttgcaaa tttctcagag atgttgaatt tgatgaagtg tacgtgcgtc gcatttgcag 1020

tccaacatca cacctttgac ttgatgtgat tcaagcaaca agtgaagtgc taggctaaac 1080

acaagcacag ttccccgaaa tcatgccatt tattcttgac acatggacat cctggaaatt 1140

gttcaaagtt tctagactgc taggaatgcg aataacttgt actgaacttt tgaaacattt 1200

ttgtcagccc aatcaggatt ttttttagtt tatttcctga aactctgcat tggaacgaat 1260

aaataaatgg tgtctcaaga aaataaagca cgtgctctga atctttgtgt gcagctgctg 1320

cccatacccg atgaaaattc agttcttgat ttggtcatca ttggctgcgg tccagctggc 1380

ttatccctag cagcagagtc agctaagaaa gggctcaatg ttggtctcat tggccctgat 1440

cttccattca cgaacaacta cggtgtgtgg gaggatgaat tcaaaggtag catactattt 1500

tcagcactga ataacattgt tgccatcata atttggtaca tgatggactt atggctcttg 1560

atcttttgct atccagacct gggcctggag agctgcattg aacatgtctg gaaggatact 1620

atcgtgtacc tagacggtaa caagccaata atgattggcc gtgcgtatgg cagggttcac 1680

agggacttgc tgcacgagga gttgctgaga cggtaaattt tcagttagca atcttgagag 1740

taaacagagt caggcaaagt gatacaaaat tattgatgaa aaattatact ctaaaaactg 1800

tcagatgcta tgacgctggc gtcacatacc tcagctcgaa ggtggacaag atcatggaat 1860

ctcctgatgg acatcgggta gtctgttgtg aaggggatcg tgaggtactt tgcaggcttg 1920

ccattgttgc atctggggca gcatctggta ggcttctaga gtacgaggtt ggtggtccgc 1980

gtgtttgtgt gcagactgca tatggtgtcg aagtcgaggt atgcacaact cctatagaac 2040

ttactcccct cgagagttta gaatagtttc ccttctgtcg tcgtgtttct acgagcattt 2100

tattcatatt gtttcaagct gaaaatttta gatatgttat ttgggcacat gtcattcatc 2160

tttcacaatg atttgaaaat tttcaggtgg aaaacaatcc atatgatccc agcttaatgg 2220

ttttcatgga ctacagagat tgcttcaaag acaaattctc acatcctgag caaggaaatc 2280

caacgttcct ctatgccatg cccatgtcat ccacacgaat tttctttgag gtccatatga 2340

gaaactttat cacaatttat tcctccgact agtattttcc catgcttttg tgttgctgat 2400

gataattatt tcaagacagg aaacatgcct agcttctaaa gaagcaatgc cctttgacct 2460

ccttaaaaag cggttgatgt ctcggttgga tgcaatggga gttcatattc gaaaagtata 2520

cgaggaggta acaagttatg gcttggtgtc actagttgtt tctcttgcat aggtgaagtg 2580

gaaacttaac ctaaatgctg aactcttgat ttcaggaatg gtcctacatt cctgttggag 2640

ggtccttacc aaatacagac cagaaaaatc tcgcatttgg tgcggcagca agtatggtgc 2700

atcctgcaac cggtactaac aaatcctcaa tccgtacttt caatttctct tgtatttaca 2760

ggcaataata taatatttat ctgtcaaaaa cataggatac tcggtggtta gatcattgtc 2820

tgaagctcca agatatgcat ctgtgatatc tgatatcttg agaaaccgtg tctaccctgg 2880

agaatatttg cctggaacct ctcaaagttc cagtccatca atgcttggta agcattcttc 2940

tgatatttat tcaattttat tgacaagcac accagtatta caaattggag tacattgctt 3000

cagatgaggg cagtatttta gtataatttt ggaaatgtca ggaacatttt ctggtactaa 3060

ttgctatgcg gtgttgcagc atggagaaca ttatggcccc aagaacggaa acgtcaacga 3120

tcattcttcc tttttgggct ggctttgata atccaactga ataacgaagg cattcagaca 3180

ttctttgaaa cctttttccg gttgcccaaa tggtaattct actcttgatt gcatttgcct 3240

ctgttttcag tctatttaca aataccatta tgtatgacct gaagattgcc acccaacaaa 3300

gtgttcatca ctgttctttg ttactatcag gatgtggcga ggattccttg gttcgacgct 3360

ttcttcagtg gatctcatac tctttgcatt ctacatgttc acaattgcgc cgaaccaaat 3420

gcgaatgaac cttgtcagac atctcctctc tgatccgacc ggctcaacga tgatcaagac 3480

ctacctgacc ttgtaaaacc atttcagcag tctacaagaa tattaggaaa tgtacagttt 3540

tgtagtttgt acataacata gtgagagcca gaggatatgg gggttggggg gttacttatc 3600

atgctagaac aacaaaacac tgcaagaatt ttatgcatga atttggcaaa tggaatagat 3660

tatgcagaat gggaacacgt gaatacgtga tgcgtgtgct ggaacaacaa gtaggaggaa 3720

taaaacccat ggattatgga tcttg 3745

Claims

Application of the 1.OsLUT2 gene in adjusting and controlling rice light protective capability, which is characterized in that the nucleotide sequence of the gene is such as Shown in SEQ ID NO:1.
2. application of the OsLUT2 gene as described in claim 1 in adjusting and controlling rice light protective capability, which is characterized in that the base 1621-1624th base position of the nucleotide sequence of cause lacks four bases: CTTT.