CN109111520A - People's HLA-F monoclonal antibody and its preparation method and application - Google Patents
People's HLA-F monoclonal antibody and its preparation method and application Download PDFInfo
- Publication number
- CN109111520A CN109111520A CN201810979617.0A CN201810979617A CN109111520A CN 109111520 A CN109111520 A CN 109111520A CN 201810979617 A CN201810979617 A CN 201810979617A CN 109111520 A CN109111520 A CN 109111520A
- Authority
- CN
- China
- Prior art keywords
- hla
- cell
- monoclonal antibody
- obtains
- people
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2833—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to a kind of people HLA-F monoclonal antibodies and preparation method thereof, synthesis gene HLA-F is connected into carrier pCzn1 (+), it obtains recombinant plasmid and is transferred to expression bacterial strain, obtain that there is the monoclonal bacterial strain of ampicillin resistant to carry out inducing expression using IPTG, it obtains target protein HLA-F inclusion body and successively carries out refolding strategy processing, the processing of Ni column purification, it obtains HLA-F albumen after purification and tachysynthesis is carried out to mouse, the lymphocyte and myeloma cell for recycling immune mouse carry out cell fusion, positive hole cell is filtered out later and is subcloned, it obtains strong positive cell strain and carries out ascites preparation, after purification process ascites, obtain the people HLA-F monoclonal antibody, it is applicable not only to protein immunization imprinting, ELISA, and it is suitable for co-immunoprecipitation, it is immune Fluorescence and neutralizing antibody.Tumour cell can be blocked to the inhibiting effect of NK cellular immune function, activate NK cell-targeting killing tumor cell.
Description
Technical field
The invention belongs to biomedicine fields, and in particular to a kind of people HLA-F monoclonal antibody and preparation method thereof and answer
With.
Background technique
It is that tumour cell escapes body that human leukocyte antigen (human leukocyte antigen HLA) expression, which changes,
One of immune mechanism, HLA can be with the identifications and killing of adjuvant therapy cells escape cytotoxic T cell, various pernicious swollen
It plays an important role in the generation of tumor, development.Although the downward of HLA-I class developed by molecule can help tumour cell to escape cell toxicant
Property T cell identification and killing, but equally enhance the killing activity of NK cell, however study the tumour of discovery HLA-I defect
Cell still has stronger growth vigor, and further analysis confirms to be overexpressed non-classical HLA-I class molecule (HLA- due to these cells
E, F, G), and then lead to immunosurveillance escape.HLA-F as the third newly discovered non-classical HLA-I class molecule,
Function and clinical meaning research are at the early-stage.Similar to HLA-E, HLA-F inhibits NK in combination with Inhibitory receptor CD94/NKG2A
The killing activity of cell and part CD8+T cell escapes immunity of organism killing.But at present on the market HLA-F antibody mostly with inspection
It surveys based on protein immunoblot, still cannot function as neutralizing antibody use.
Summary of the invention
In order to solve the above problems existing in the present technology, the present invention provides people HLA-F monoclonal antibody and its preparations
Methods and applications.HLA-F monoclonal antibody of the present invention can be specifically bound with HLA-F, not with other points of human hla class
Son combines；It is applicable not only to protein immunization imprinting (WB), ELISA, and is suitable for co-immunoprecipitation (IP), immunofluorescence (IF)
And neutralizing antibody.As the HLA-F being integrated on human tumor cells, inhibition of the tumour cell to NK cellular immune function can be blocked
Effect, to activate NK cell-targeting killing tumor cell.The invention further relates to include the people HLA-F monoclonal antibody or its
The pharmaceutical composition of segment is applied in preparing the drug for treating tumor patient.
The technical scheme adopted by the invention is as follows:
A kind of preparation method of people HLA-F monoclonal antibody, includes the following steps:
(1) synthesis gene HLA-F is connected into carrier pCzn1 (+), obtains recombinant plasmid pCzn1 (+)-HLA-F；
(2) plasmid pCzn1 (+)-HLA-F is transferred to expression bacterial strain, obtains carrier fusion；It is induced later using IPTG
The carrier fusion is expressed, and target protein HLA-F inclusion body is obtained；
(3) refolding strategy processing, the processing of Ni column purification are successively carried out to step (2) the target protein HLA-F inclusion body, obtained
To HLA-F albumen after purification；
(4) using HLA-F albumen carries out tachysynthesis to mouse after purification described in step (3), immune mouse is obtained, is utilized
The lymphocyte of immune mouse and myeloma cell carry out cell fusion, filter out positive hole cell later and are subcloned；
(5) it screens the strong positive cell strain obtained after step (4) subclone and carries out ascites preparation, ascites is purified
To get the people HLA-F monoclonal antibody after processing.
In step (2), the expression bacterial strain is Escherichia coli TM.
The concrete operations that plasmid pCzn1 (+)-HLA-F is transferred to the expression bacterial strain are as follows:
(concentration is 100ng/ μ l) is dispersed in distilled water by plasmid, competence expression bacterial strain is suspended in containing glycerol
15%, concentration is the CaCl of 0.1mol/L2(cell number is 5 × 10 in solution6It is a), take 1 μ l to be dispersed with the distilled water of plasmid later
It is added to the CaCl that 100 μ l are suspended with competence expression bacterial strain2In solution, it is placed in 20min on ice；Later in 42 DEG C of hot compress 90s,
It sets 5min in ice rapidly again, 600 μ lLB culture solutions is added；33 DEG C, 220r/min shaking 1h, are all coated on after centrifugation containing 50 μ
The LB plate of g/ml ampicillin, 33 DEG C of inversion overnight incubations, obtains the monoclonal bacterial strain with ampicillin resistant.
Concrete operations using IPTG inducing expression are as follows:
Take monoclonal strain inoculated on LB plate with ampicillin resistant in containing 50 μ g/ml ampicillins
In the test tube of 3mlLB culture solution, 33 DEG C, 220r/min shaking overnight；Next day, 1:100 was inoculated in containing 50 μ g/ml ammonia by volume
In the 30mlLB culture solution of parasiticin, 33 DEG C, 220r/min shake to thallus OD600 be 0.6-0.8；It is added into culture
IPTG to final concentration of 0.5mM, 33 DEG C, 220r/min shaking 4h, inducing expression target protein HLA-F, 10000r/min room temperature
It is centrifuged 2min, abandons supernatant to get target protein HLA-F inclusion body.
The concrete operations for carrying out refolding strategy processing to the target protein HLA-F inclusion body are as follows:
The target protein HLA-F inclusion body is resuspended in 20ml lysate, after ultrasonication, 4 DEG C of rooms 10000r/min
Temperature centrifugation 20min, collects precipitating；It uses the washing of inclusion body cleaning solution precipitating 3 times；It is described molten with dissolution buffer solution precipitating
The volume for solving buffer and the precipitating is 10:1, and 4 DEG C stand overnight, room temperature, and 10000r/min is centrifuged 15min, obtains supernatant
Liquid is slowly added dropwise into the buffer containing 20mMtris-HCl, 0.15MNaCl and pH8.0 under agitation, and it is molten to obtain albumen
Liquid is fitted into bag filter dialysed overnight in the solution containing 20mMtris-HCl, 0.15MNaCl and pH8.0, obtains refolding strategy processing
HLA-F inclusion body afterwards.
The concrete operations for carrying out the processing of Ni column purification to the refolding strategy treated HLA-F inclusion body are as follows:
Using low pressure chromatography system, supernatant solution, to nickel ion affinity chromatograph column, first uses nickel with 0.5ml/min flow velocity loading
Ion affinity chromatography column (Ni2+- IDA) combination buffer is with the flushing of 0.5ml/min flow velocity, until efflux OD280 value reaches baseline；
Then nickel ion affinity chromatograph column (Ni is used2+- IDA) cleaning solution (20mMTris-HCl, 20mM imidazoles,
0.15MNaCl, pH8.0) with the flushing of 1ml/min flow velocity, until efflux OD280 value reaches baseline；
Nickel ion affinity chromatograph column (Ni is used later2+- IDA) eluent (20mMTris-HCl, 250mM imidazoles,
0.15MNaCl, pH8.0) with 1ml/min flow velocity elution destination protein, collect albumen efflux；
It is saturating in the solution containing 20mMtris-HCl, 0.15MNaCl and pH8.0 that bag filter finally is added in albumen efflux
Analysis overnight, obtains HLA-F albumen after purification.
Lymphocyte and the concrete operations that myeloma cell carries out fusion experiment are as follows:
Myeloma cell and lymphocyte are mixed according to quantity ratio 1:5, obtains cell mixture；By the cell mixture
It is put into 50ml centrifuge tube, is diluted with DMEM basal medium, 5min is then centrifuged under the conditions of 1000rpm, abandon supernatant, shake
Centrifuge tube keeps cell uniform, is slowly added to 0.8ml50%PEG, reacts 90 seconds, and 20-30mlDMEM culture medium is then added and terminates
PEG is put into the cell of fusion in 33 DEG C of water-baths and reacts 10min, and 5min is centrifuged under the conditions of 1000rpm, adds after abandoning supernatant
Enter HATDMEM culture medium；
Cell fusion is auxiliary into 96 orifice plates, every 100 μ l of hole；Then tissue culture plate is put into CO2It is trained in incubator
It supports, after fusion 10 days, positive hole cell is screened in fusion.
The concrete operations of the subclone are as follows:
Cell in positive hole is blown and beaten, N is counted as, N/4mlDMEM culture medium is added in centrifuge tube, takes 100 μ l cells outstanding
Liquid into centrifuge tube, blow it is even after stay 1ml, add DMEM to 4ml, blow even, stay 100 μ l in tube bottom；Add DMEM extremely in centrifuge tube
5ml is added dropwise to the first three rows of 96 orifice plates after mixing, every hole one is dripped, and tube bottom stays 1.8-2ml, adds DMEM to 5ml, blows even rear drop
Add to tri- row of D, E, F of 96 orifice plates, every hole one is dripped, and tube bottom stays 1.5-1.8ml, adds DMEM to 2.8-3ml, blow it is even after be added dropwise to
G, H row of 96 orifice plates, every hole one is dripped, and after 3-10 days, is screened the monoclonal hole being positive and is expanded culture singling.
The operation for carrying out purification process to ascites is specific as follows:
Protein A Sepharose medium is packed into nickel ion affinity chromatograph column, by ascites and PBS according to volume ratio 1:1
Slow loading after mixed in equal amounts is eluted in conjunction with after with glycine elution buffer anti-to get the people HLA-F monoclonal after antibody
Body.
People's HLA-F monoclonal antibody that the method is prepared.
The monoclonal antibody is in preparation for the application in tumor.
The invention has the benefit that
Synthesis gene HLA-F is connected into carrier pCzn1 by the preparation method of people HLA-F monoclonal antibody of the present invention
(+) obtains recombinant plasmid pCzn1 (+)-HLA-F and is transferred to Escherichia coli TM expression bacterial strain, obtain the list with ampicillin resistant
After clone strain, inducing expression is carried out using IPTG, obtains target protein HLA-F inclusion body；To the target protein HLA-F packet
Contain body and successively carry out refolding strategy processing, the processing of Ni column purification, obtains HLA-F albumen after purification and tachysynthesis is carried out to mouse, then
Cell fusion is carried out using the lymphocyte of immune mouse and myeloma cell, filter out positive hole cell later and carries out sub- gram
It is grand；Obtained strong positive cell strain carries out ascites preparation after screening subclone, carries out after purification process ascites to get the people
HLA-F monoclonal antibody；HLA-F monoclonal antibody of the present invention can be specifically bound with HLA-F, not with human hla class
Other molecules combine；Compared with the existing HLA-F antibody that only can be suitably used for protein immunoblot on the market, Dan Ke of the present invention
Grand antibody is applicable not only to protein immunization imprinting (WB), ELISA, and is suitable for co-immunoprecipitation (IP), immunofluorescence (IF)
And neutralizing antibody.As the HLA-F being integrated on human tumor cells, inhibition of the tumour cell to NK cellular immune function can be blocked
Effect, to activate NK cell-targeting killing tumor cell.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this
Some embodiments of invention for those of ordinary skill in the art without creative efforts, can be with
It obtains other drawings based on these drawings.
Fig. 1 is the sequencing result of HLA-F gene region and the part comparison result figure of expected sequence；
Fig. 2 is the Western Blot identification and analysis figure of HLA-F albumen after purification；
Fig. 3 is the schematic diagram of HLA-F antibody test human glioma cell HLA-F expression after purification；
Fig. 4 is HLA-F antibody test human glioma cell HLA-F immunofluorescence dyeing result schematic diagram after purification；
Fig. 5 is that HLA-F antibody mediated immunity is co-precipitated testing result figure after purification；
Fig. 6 is HLA-F antibody LDH testing result figure after purification.
Specific embodiment
To make the object, technical solutions and advantages of the present invention clearer, technical solution of the present invention will be carried out below
Detailed description.Obviously, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Base
Embodiment in the present invention, those of ordinary skill in the art are obtained all without making creative work
Other embodiment belongs to the range that the present invention is protected.
Embodiment 1
The present embodiment provides a kind of preparation methods of people HLA-F monoclonal antibody, include the following steps:
(1) gene splicing by overlap extension is used, design overall length splices primer, synthesizes gene HLA-F, and synthesis gene HLA-F is connected
Enter carrier pCzn1 (+), obtains recombinant plasmid pCzn1 (+)-HLA-F；
Recombinant plasmid pCzn1 (+)-HLA-F of acquisition is transferred to TOP10 clone strain (one kind of Escherichia coli TM), is chosen
Positive clone molecule is taken to be sequenced, sequencing result splicing is as follows, and single scribe area is HLA-F gene region:
GCACATTCCTTTAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTA
AGAGGTAATACACCATGAATCACAAAGTGCATCATCATCATCATCATATGGGTAGTCATAGCCTGCGTTATTTTAG CACCGCCGTGAGTCGTCCGGGTCGCGGTGAACCGCGTTATATTGCAGTGGAATATGTTGATGATACCCAGTTTCTG CGTTTTGATAGTGATGCCGCCATTCCGCGTATGGAACCGCGCGAACCGTGGGTTGAACAGGAAGGCCCGCAGTATT GGGAATGGACCACCGGTTATGCAAAAGCAAATGCACAGACCGATCGTGTTGCACTGCGCAATCTGCGCCGCTATAA TCAGAGCGAAGCCGGTAGTCATACCCTGCAGGGCATGAATGGCTGTGATATGGGCCCGGATGGCCGTCTGCTGCGC GGTTATCATCAGCATGCATACGATGGCAAAGATTATATTAGTCTGAATGAAGATCTGCGCAGTTGGACCGCCGCAG ATACCGTTGCCCAGATTACCCAGCGCTTTTATGAAGCCGAAGAATATGCAGAAGAATTTCGTACCTATCTGGAAGG CGAATGCCTGGAACTGCTGCGCCGTTATCTGGAAAATGGCAAAGAAACCCTGCAGCGCGCAGAACAGAGTCCGCAG CCGACCATTCCGTAATCTAGATAGGTAATCTCTGCTTAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGA
TTTTTTTATTTGTTTTCAGGAAATAAATAATCGATCGCGTAATAAAATCTAT；
Sequencing result is compared with expected sequence, and interception part aligned sequences are as shown in Figure 1；
(2) plasmid pCzn1 (+)-HLA-F is transferred to TOP10 clone strain, concrete operations are as follows: disperse double steamings for plasmid
In water (concentration is 100ng/ μ l), competence expression bacterial strain is suspended in containing glycerol 15%, the CaCl that concentration is 0.1mol/L2It is molten
(cell number is 5 × 10 in liquid6It is a), take later 1 μ l be dispersed with plasmid distilled water be added to 100 μ l be suspended with competence expression
The CaCl of bacterial strain2In solution, it is placed in 20min on ice；Later in 42 DEG C of hot compress 90s, then 5min in ice is set rapidly, 600 μ are added
LLB culture solution；33 DEG C, 220r/min shake 1h, be all coated on the LB plate containing 50 μ g/ml ampicillins after centrifugation, 33
DEG C be inverted overnight incubation, obtain the monoclonal bacterial strain with ampicillin resistant；
The concrete operations of IPTG inducing expression are used later are as follows: take the monoclonal on LB plate, with ampicillin resistant
Strain inoculated in containing 50 μ g/ml ampicillins 3mlLB culture solution test tube in, 33 DEG C, 220r/min shaking overnight；Next day
1:100 is inoculated in the 30mlLB culture solution containing 50 μ g/ml ampicillins by volume, and 33 DEG C, 220r/min shakes to bacterium
Body OD600 is 0.6-0.8；IPTG to final concentration of 0.5mM is added into culture, 33 DEG C, 220r/min shaking 4h induce table
Up to target protein HLA-F, 10000r/min room temperature is centrifuged 2min, abandons supernatant to get target protein HLA-F inclusion body；
(3) refolding strategy processing, concrete operations are as follows: by the mesh are carried out to step (2) the target protein HLA-F inclusion body
Mark albumen HLA-F inclusion body is resuspended in 20ml lysate (cytostatics containing 1mMPMSF of Tris-HCl containing 20mM), and ultrasound is broken
After broken, 4 DEG C of 10000r/min room temperatures are centrifuged 20min, collect precipitating；Using inclusion body cleaning solution (Tris containing 20mM,
1mMEDTA, 2M urea, 1MNaCl, 1%Triton X-100, pH8.0) washing precipitating 3 times；(contained with dissolution buffer
20mMtris, 5mMDTT, 8M urea, pH8.0) dissolution precipitating, the buffer and the volume ratio of the precipitating of dissolving is 10:1,
4 DEG C stand overnight, room temperature, and 10000r/min is centrifuged 15min, obtain supernatant and are slowly added dropwise under agitation to containing
In the buffer of 20mMtris-HCl, 0.15MNaCl and pH8.0, obtains protein solution and be packed into bag filter in containing 20mMtris-
Dialysed overnight in the solution of HCl, 0.15MNaCl and pH8.0 obtains refolding strategy treated HLA-F inclusion body；
The processing of Ni column purification is carried out to the refolding strategy treated HLA-F inclusion body, obtains HLA-F albumen after purification；
Concrete operations are as follows: utilize low pressure chromatography system, supernatant solution is with 0.5ml/min flow velocity loading to nickel ion affinity chromatograph column, first
With nickel ion affinity chromatograph column (Ni2+- IDA) combination buffer is with the flushing of 0.5ml/min flow velocity, until efflux OD280 value reaches
Baseline；Then with then with nickel ion affinity chromatograph column (Ni2+- IDA) cleaning solution (20mMTris-HCl, 20mM imidazoles,
0.15MNaCl, pH8.0) with the flushing of 1ml/min flow velocity, until efflux OD280 value reaches baseline；The affine layer of nickel ion is used later
Analyse column (Ni2+- IDA) eluent (20mMTris-HCl, 250mM imidazoles, 0.15MNaCl, pH8.0) with 1ml/min flow velocity elution
Destination protein collects albumen efflux；Bag filter finally is added in containing 20mMtris-HCl, 0.15MNaCl in albumen efflux
And pH is dialysed overnight in 8.0 solution, obtains HLA-F albumen after purification；
Western Blot identification and analysis is carried out to HLA-F albumen after purification, as a result as shown in Fig. 2, in figure: M- represents egg
White matter molecular mass standard, I- represent HLA-F albumen after purification；
(4) choose 10 6-8 week old female Balb/c mouse, using described in step (3) after purification HLA-F albumen to mouse
Tachysynthesis is carried out, immune mouse is obtained；Blood sampling detection determines antiserum for HLA-F albumen by indirect ELISA method
Potency is in 121.5K or so；
Cell fusion is carried out using the lymphocyte of immune mouse and myeloma cell, specifically: it is mixed according to quantity ratio 1:5
Myeloma cell and lymphocyte are closed, cell mixture is obtained；The cell mixture is put into 50ml centrifuge tube, DMEM is used
Basal medium dilution, is then centrifuged 5min under the conditions of 1000rpm, abandons supernatant, and shaking centrifuge tube keeps cell uniform, slowly adds
Enter 0.8ml50%PEG, react 90 seconds, 20-30mlDMEM culture medium is then added and terminates PEG, the cell of fusion is put into 33 DEG C
10min is reacted in water-bath, 5min is centrifuged under the conditions of 1000rpm, and HATDMEM culture medium is added after abandoning supernatant；Fusion
Cell is auxiliary into 96 orifice plates, every 100 μ l of hole；Then tissue culture plate is put into CO2It cultivates in incubator, after fusion 10 days, melts
It closes and screens positive hole cell and be subcloned；
The concrete operations of the subclone are as follows:
Cell in positive hole is blown and beaten, N is counted as, N/4mlDMEM culture medium is added in centrifuge tube, takes 100 μ l cells outstanding
Liquid into centrifuge tube, blow it is even after stay 1ml, add DMEM to 4ml, blow even, stay 100 μ l in tube bottom；Add DMEM extremely in centrifuge tube
5ml is added dropwise to the first three rows of 96 orifice plates after mixing, every hole one is dripped, and tube bottom stays 1.8-2ml, adds DMEM to 5ml, blows even rear drop
Add to tri- row of D, E, F of 96 orifice plates, every hole one is dripped, and tube bottom stays 1.5-1.8ml, adds DMEM to 2.8-3ml, blow it is even after be added dropwise to
G, H row of 96 orifice plates, every hole one are dripped, are observed under the microscope after 3-10 days, and detection has the hole of clonal growth, mark monoclonal
Hole, the monoclonal cell of the picking positive as far as possible is subcloned again, after detection to 100% positive, chooses monoclonal hole
Expand culture singling；
(5) screen after step (4) subclone obtained cell growing way preferably, the higher 3G2E2 monoclonal of ELISA potency
Strong positive cell strain carries out ascites preparation, carries out purification process, concrete operations are as follows: coagulate Protein A Sepharose to ascites later
Glue medium is packed into nickel ion affinity chromatograph column, by ascites and PBS according to slow loading after volume ratio 1:1 mixed in equal amounts, to antibody
It is eluted in conjunction with rear with glycine elution buffer to get the people HLA-F monoclonal antibody.
Embodiment 2
The present embodiment provides a kind of preparation methods of people HLA-F monoclonal antibody, include the following steps:
(1) gene splicing by overlap extension is used, design overall length splices primer, synthesizes gene HLA-F, and synthesis gene HLA-F is connected
Enter carrier pCzn1 (+), obtains recombinant plasmid pCzn1 (+)-HLA-F；
Recombinant plasmid pCzn1 (+)-HLA-F of acquisition is transferred to TOP10 clone strain (one kind of Escherichia coli TM), is chosen
Positive clone molecule is taken to be sequenced, sequencing result splicing is as follows, and single scribe area is HLA-F gene region:
GCACATTCCTTTAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTA
AGAGGTAATACACCATGAATCACAAAGTGCATCATCATCATCATCATATGGGTAGTCATAGCCTGCGTTATTTTAG CACCGCCGTGAGTCGTCCGGGTCGCGGTGAACCGCGTTATATTGCAGTGGAATATGTTGATGATACCCAGTTTCTG CGTTTTGATAGTGATGCCGCCATTCCGCGTATGGAACCGCGCGAACCGTGGGTTGAACAGGAAGGCCCGCAGTATT GGGAATGGACCACCGGTTATGCAAAAGCAAATGCACAGACCGATCGTGTTGCACTGCGCAATCTGCGCCGCTATAA TCAGAGCGAAGCCGGTAGTCATACCCTGCAGGGCATGAATGGCTGTGATATGGGCCCGGATGGCCGTCTGCTGCGC GGTTATCATCAGCATGCATACGATGGCAAAGATTATATTAGTCTGAATGAAGATCTGCGCAGTTGGACCGCCGCAG ATACCGTTGCCCAGATTACCCAGCGCTTTTATGAAGCCGAAGAATATGCAGAAGAATTTCGTACCTATCTGGAAGG CGAATGCCTGGAACTGCTGCGCCGTTATCTGGAAAATGGCAAAGAAACCCTGCAGCGCGCAGAACAGAGTCCGCAG CCGACCATTCCGTAATCTAGATAGGTAATCTCTGCTTAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGA
TTTTTTTATTTGTTTTCAGGAAATAAATAATCGATCGCGTAATAAAATCTAT；
Sequencing result is compared with expected sequence, and interception part aligned sequences are as shown in Figure 1；
(2) plasmid pCzn1 (+)-HLA-F is transferred to TOP10 clone strain, concrete operations are as follows: disperse double steamings for plasmid
In water (concentration is 100ng/ μ l), competence expression bacterial strain is suspended in containing glycerol 15%, the CaCl that concentration is 0.1mol/L2It is molten
(cell number is 5 × 10 in liquid6It is a), take later 1 μ l be dispersed with plasmid distilled water be added to 100 μ l be suspended with competence expression
The CaCl of bacterial strain2In solution, it is placed in 30min on ice；Later in 42 DEG C of hot compress 45s, then 1min in ice is set rapidly, 600 μ are added
LLB culture solution；33 DEG C, 220r/min shake 1h, be all coated on the LB plate containing 50 μ g/ml ampicillins after centrifugation, 33
DEG C be inverted overnight incubation, obtain the monoclonal bacterial strain with ampicillin resistant；
The concrete operations of IPTG inducing expression are used later are as follows: take the monoclonal on LB plate, with ampicillin resistant
Strain inoculated in containing 50 μ g/ml ampicillins 3mlLB culture solution test tube in, 33 DEG C, 220r/min shaking overnight；Next day
1:100 is inoculated in the 30mlLB culture solution containing 50 μ g/ml ampicillins by volume, and 33 DEG C, 220r/min shakes to bacterium
Body OD600 is 0.6-0.8；IPTG to final concentration of 0.5mM is added into culture, 33 DEG C, 220r/min shaking 4h induce table
Up to target protein HLA-F, 10000r/min room temperature is centrifuged 2min, abandons supernatant to get target protein HLA-F inclusion body；
(3) refolding strategy processing, concrete operations are as follows: by the mesh are carried out to step (2) the target protein HLA-F inclusion body
Mark albumen HLA-F inclusion body is resuspended in 20ml lysate (cytostatics containing 1mMPMSF of Tris-HCl containing 20mM), and ultrasound is broken
After broken, 4 DEG C of 10000r/min room temperatures are centrifuged 20min, collect precipitating；Using inclusion body cleaning solution (Tris containing 20mM,
1mMEDTA, 2M urea, 1MNaCl, 1%Triton X-100, pH8.0) washing precipitating 3 times；(contained with dissolution buffer
20mMtris, 5mMDTT, 8M urea, pH8.0) dissolution precipitating, the buffer and the volume ratio of the precipitating of dissolving is 10:1,
4 DEG C stand overnight, room temperature, and 10000r/min is centrifuged 15min, obtain supernatant and are slowly added dropwise under agitation to containing
In the buffer of 20mMtris-HCl, 0.15MNaCl and pH8.0, obtains protein solution and be packed into bag filter in containing 20mMtris-
Dialysed overnight in the solution of HCl, 0.15MNaCl and pH8.0 obtains refolding strategy treated HLA-F inclusion body；
The processing of Ni column purification is carried out to the refolding strategy treated HLA-F inclusion body, obtains HLA-F albumen after purification；
Concrete operations are as follows: utilize low pressure chromatography system, supernatant solution is with 0.5ml/min flow velocity loading to nickel ion affinity chromatograph column, first
With nickel ion affinity chromatograph column (Ni2+- IDA) combination buffer is with the flushing of 0.5ml/min flow velocity, until efflux OD280 value reaches
Baseline；Then with then with nickel ion affinity chromatograph column (Ni2+- IDA) cleaning solution (20mMTris-HCl, 20mM imidazoles,
0.15MNaCl, pH8.0) with the flushing of 1ml/min flow velocity, until efflux OD280 value reaches baseline；The affine layer of nickel ion is used later
Analyse column (Ni2+- IDA) eluent (20mMTris-HCl, 250mM imidazoles, 0.15MNaCl, pH8.0) with 1ml/min flow velocity elution
Destination protein collects albumen efflux；Bag filter finally is added in containing 20mMtris-HCl, 0.15MNaCl in albumen efflux
And pH is dialysed overnight in 8.0 solution, obtains HLA-F albumen after purification；
Western Blot identification and analysis is carried out to HLA-F albumen after purification, as a result as shown in Fig. 2, in figure: M- represents egg
White matter molecular mass standard, I- represent HLA-F albumen after purification；
(4) choose 10 6-8 week old female Balb/c mouse, using described in step (3) after purification HLA-F albumen to mouse
Tachysynthesis is carried out, immune mouse is obtained；Blood sampling detection determines antiserum for HLA-F albumen by indirect ELISA method
Potency is in 121.5K or so；
Cell fusion is carried out using the lymphocyte of immune mouse and myeloma cell, specifically: it is mixed according to quantity ratio 1:5
Myeloma cell and lymphocyte are closed, cell mixture is obtained；The cell mixture is put into 50ml centrifuge tube, DMEM is used
Basal medium dilution, is then centrifuged 5min under the conditions of 1000rpm, abandons supernatant, and shaking centrifuge tube keeps cell uniform, slowly adds
Enter 0.8ml50%PEG, react 90 seconds, 20-30mlDMEM culture medium is then added and terminates PEG, the cell of fusion is put into 33 DEG C
10min is reacted in water-bath, 5min is centrifuged under the conditions of 1000rpm, and HATDMEM culture medium is added after abandoning supernatant；Fusion
Cell is auxiliary into 96 orifice plates, every 100 μ l of hole；Then tissue culture plate is put into CO2It cultivates in incubator, after fusion 10 days, melts
It closes and screens positive hole cell and be subcloned；
The concrete operations of the subclone are as follows:
Cell in positive hole is blown and beaten, N is counted as, N/4mlDMEM culture medium is added in centrifuge tube, takes 100 μ l cells outstanding
Liquid into centrifuge tube, blow it is even after stay 1ml, add DMEM to 4ml, blow even, stay 100 μ l in tube bottom；Add DMEM extremely in centrifuge tube
5ml is added dropwise to the first three rows of 96 orifice plates after mixing, every hole one is dripped, and tube bottom stays 1.8-2ml, adds DMEM to 5ml, blows even rear drop
Add to tri- row of D, E, F of 96 orifice plates, every hole one is dripped, and tube bottom stays 1.5-1.8ml, adds DMEM to 2.8-3ml, blow it is even after be added dropwise to
G, H row of 96 orifice plates, every hole one are dripped, are observed under the microscope after 3-10 days, and detection has the hole of clonal growth, mark monoclonal
Hole, the monoclonal cell of the picking positive as far as possible is subcloned again, after detection to 100% positive, chooses monoclonal hole
Expand culture singling；
(5) screen after step (4) subclone obtained cell growing way preferably, the higher 3G2E2 monoclonal of ELISA potency
Strong positive cell strain carries out ascites preparation, carries out purification process, concrete operations are as follows: coagulate Protein A Sepharose to ascites later
Glue medium is packed into nickel ion affinity chromatograph column, by ascites and PBS according to slow loading after volume ratio 1:1 mixed in equal amounts, to antibody
It is eluted in conjunction with rear with glycine elution buffer to get the people HLA-F monoclonal antibody.
Embodiment 3
The present embodiment provides a kind of preparation methods of people HLA-F monoclonal antibody, include the following steps:
(1) gene splicing by overlap extension is used, design overall length splices primer, synthesizes gene HLA-F, and synthesis gene HLA-F is connected
Enter carrier pCzn1 (+), obtains recombinant plasmid pCzn1 (+)-HLA-F；
Recombinant plasmid pCzn1 (+)-HLA-F of acquisition is transferred to TOP10 clone strain (one kind of Escherichia coli TM), is chosen
Positive clone molecule is taken to be sequenced, sequencing result splicing is as follows, and single scribe area is HLA-F gene region:
GCACATTCCTTTAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTA
AGAGGTAATACACCATGAATCACAAAGTGCATCATCATCATCATCATATGGGTAGTCATAGCCTGCGTTATTTTAG CACCGCCGTGAGTCGTCCGGGTCGCGGTGAACCGCGTTATATTGCAGTGGAATATGTTGATGATACCCAGTTTCTG CGTTTTGATAGTGATGCCGCCATTCCGCGTATGGAACCGCGCGAACCGTGGGTTGAACAGGAAGGCCCGCAGTATT GGGAATGGACCACCGGTTATGCAAAAGCAAATGCACAGACCGATCGTGTTGCACTGCGCAATCTGCGCCGCTATAA TCAGAGCGAAGCCGGTAGTCATACCCTGCAGGGCATGAATGGCTGTGATATGGGCCCGGATGGCCGTCTGCTGCGC GGTTATCATCAGCATGCATACGATGGCAAAGATTATATTAGTCTGAATGAAGATCTGCGCAGTTGGACCGCCGCAG ATACCGTTGCCCAGATTACCCAGCGCTTTTATGAAGCCGAAGAATATGCAGAAGAATTTCGTACCTATCTGGAAGG CGAATGCCTGGAACTGCTGCGCCGTTATCTGGAAAATGGCAAAGAAACCCTGCAGCGCGCAGAACAGAGTCCGCAG CCGACCATTCCGTAATCTAGATAGGTAATCTCTGCTTAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGA
TTTTTTTATTTGTTTTCAGGAAATAAATAATCGATCGCGTAATAAAATCTAT；
Sequencing result is compared with expected sequence, and interception part aligned sequences are as shown in Figure 1；
(2) plasmid pCzn1 (+)-HLA-F is transferred to TOP10 clone strain, concrete operations are as follows: disperse double steamings for plasmid
In water (concentration is 100ng/ μ l), competence expression bacterial strain is suspended in containing glycerol 15%, the CaCl that concentration is 0.1mol/L2It is molten
(cell number is 5 × 10 in liquid6It is a), take later 1 μ l be dispersed with plasmid distilled water be added to 100 μ l be suspended with competence expression
The CaCl of bacterial strain2In solution, it is placed in 30min on ice；Later in 42 DEG C of hot compress 45s, then 1min in ice is set rapidly, 600 μ are added
LLB culture solution；33 DEG C, 220r/min shake 1h, be all coated on the LB plate containing 100 μ g/ml ampicillins after centrifugation, 33
DEG C be inverted overnight incubation, obtain the monoclonal bacterial strain with ampicillin resistant；
The concrete operations of IPTG inducing expression are used later are as follows: take the monoclonal on LB plate, with ampicillin resistant
Strain inoculated in containing 100 μ g/ml ampicillins 3mlLB culture solution test tube in, 33 DEG C, 220r/min shaking overnight；It is secondary
Day by volume 1:100 be inoculated in the 30mlLB culture solution containing 100 μ g/ml ampicillins, 33 DEG C, 220r/min shake to
Thallus OD600 is 0.6-0.8；IPTG to final concentration of 0.5mM, 33 DEG C, 220r/min shaking 4h, induction are added into culture
Target protein HLA-F is expressed, 10000r/min room temperature is centrifuged 2min, abandons supernatant to get target protein HLA-F inclusion body；
(3) refolding strategy processing, concrete operations are as follows: by the mesh are carried out to step (2) the target protein HLA-F inclusion body
Mark albumen HLA-F inclusion body is resuspended in 20ml lysate (cytostatics containing 1mMPMSF of Tris-HCl containing 20mM), and ultrasound is broken
After broken, 4 DEG C of 10000r/min room temperatures are centrifuged 20min, collect precipitating；Using inclusion body cleaning solution (Tris containing 20mM,
1mMEDTA, 2M urea, 1MNaCl, 1%Triton X-100, pH8.0) washing precipitating 3 times；(contained with dissolution buffer
20mMtris, 5mMDTT, 8M urea, pH8.0) dissolution precipitating, the buffer and the volume ratio of the precipitating of dissolving is 10:1,
4 DEG C stand overnight, room temperature, and 10000r/min is centrifuged 15min, obtain supernatant and are slowly added dropwise under agitation to containing
In the buffer of 20mMtris-HCl, 0.15MNaCl and pH8.0, obtains protein solution and be packed into bag filter in containing 20mMtris-
Dialysed overnight in the solution of HCl, 0.15MNaCl and pH8.0 obtains refolding strategy treated HLA-F inclusion body；
The processing of Ni column purification is carried out to the refolding strategy treated HLA-F inclusion body, obtains HLA-F albumen after purification；
Concrete operations are as follows: utilize low pressure chromatography system, supernatant solution is with 0.5ml/min flow velocity loading to nickel ion affinity chromatograph column, first
With nickel ion affinity chromatograph column (Ni2+- IDA) combination buffer is with the flushing of 0.5ml/min flow velocity, until efflux OD280 value reaches
Baseline；Then with then with nickel ion affinity chromatograph column (Ni2+- IDA) cleaning solution (20mMTris-HCl, 20mM imidazoles,
0.15MNaCl, pH8.0) with the flushing of 1ml/min flow velocity, until efflux OD280 value reaches baseline；The affine layer of nickel ion is used later
Analyse column (Ni2+- IDA) eluent (20mMTris-HCl, 250mM imidazoles, 0.15MNaCl, pH8.0) with 1ml/min flow velocity elution
Destination protein collects albumen efflux；Bag filter finally is added in containing 20mMtris-HCl, 0.15MNaCl in albumen efflux
And pH is dialysed overnight in 8.0 solution, obtains HLA-F albumen after purification；
Western Blot identification and analysis is carried out to HLA-F albumen after purification, as a result as shown in Fig. 2, in figure: M- represents egg
White matter molecular mass standard, I- represent HLA-F albumen after purification；
(4) choose 10 6-8 week old female Balb/c mouse, using described in step (3) after purification HLA-F albumen to mouse
Tachysynthesis is carried out, immune mouse is obtained；Blood sampling detection determines antiserum for HLA-F albumen by indirect ELISA method
Potency is in 121.5K or so；
Cell fusion is carried out using the lymphocyte of immune mouse and myeloma cell, specifically: it is mixed according to quantity ratio 1:5
Myeloma cell and lymphocyte are closed, cell mixture is obtained；The cell mixture is put into 50ml centrifuge tube, DMEM is used
Basal medium dilution, is then centrifuged 5min under the conditions of 1000rpm, abandons supernatant, and shaking centrifuge tube keeps cell uniform, slowly adds
Enter 0.8ml50%PEG, react 90 seconds, 20-30mlDMEM culture medium is then added and terminates PEG, the cell of fusion is put into 33 DEG C
10min is reacted in water-bath, 5min is centrifuged under the conditions of 1000rpm, and HATDMEM culture medium is added after abandoning supernatant；Fusion
Cell is auxiliary into 96 orifice plates, every 100 μ l of hole；Then tissue culture plate is put into CO2It cultivates in incubator, after fusion 10 days, melts
It closes and screens positive hole cell and be subcloned；
The concrete operations of the subclone are as follows:
Cell in positive hole is blown and beaten, N is counted as, N/4mlDMEM culture medium is added in centrifuge tube, takes 100 μ l cells outstanding
Liquid into centrifuge tube, blow it is even after stay 1ml, add DMEM to 4ml, blow even, stay 100 μ l in tube bottom；Add DMEM extremely in centrifuge tube
5ml is added dropwise to the first three rows of 96 orifice plates after mixing, every hole one is dripped, and tube bottom stays 1.8-2ml, adds DMEM to 5ml, blows even rear drop
Add to tri- row of D, E, F of 96 orifice plates, every hole one is dripped, and tube bottom stays 1.5-1.8ml, adds DMEM to 2.8-3ml, blow it is even after be added dropwise to
G, H row of 96 orifice plates, every hole one are dripped, are observed under the microscope after 3-10 days, and detection has the hole of clonal growth, mark monoclonal
Hole, the monoclonal cell of the picking positive as far as possible is subcloned again, after detection to 100% positive, chooses monoclonal hole
Expand culture singling；
(5) screen after step (4) subclone obtained cell growing way preferably, the higher 3G2E2 monoclonal of ELISA potency
Strong positive cell strain carries out ascites preparation, carries out purification process, concrete operations are as follows: coagulate Protein A Sepharose to ascites later
Glue medium is packed into nickel ion affinity chromatograph column, by ascites and PBS according to slow loading after volume ratio 1:1 mixed in equal amounts, to antibody
It is eluted in conjunction with rear with glycine elution buffer to get the people HLA-F monoclonal antibody.
Experimental example
Potency is detected using ELISA to 1 income earner HLA-F monoclonal antibody (antibody purification) of embodiment, utilizes BCA albumen
Concentration measuring kit carries out concentration mensuration to gained antibody.
1, antibody purification ELISA bioactivity
Concrete operations are as follows:
(1) it needs to design coating plate according to experiment, and is marked on lath.
(2) it is coated with: lath is added after mixing at the concentration of needs in HLA-F Protein Detection antigen diluent with PBS coating buffer
In, every 100 μ l of hole, 4 DEG C of refrigerator overnights.
Envelope antigen: HLA-F albumen
Peridium concentration: 0.1 μ g/ml, 100 holes μ l/
It is coated with buffer: phosphate buffer (PBS, pH3.4)
(3) it closes
After coating is good, coating buffer is discarded, board-washing 3 times, 200 μ l confining liquids, 33 DEG C of insulating box 1h are added in every hole.Take out enzyme mark
Plate, discards interior liquid, and board-washing 1 time.
(4) primary antibody reacts
Purified antibody samples are by 1/500 (initial dilution 500), 2 times of dilutions, every hole 100 μ l, 33 DEG C of insulating box 1h.
(5) secondary antibody reacts
ELISA Plate is taken out, interior liquid is discarded, board-washing 3 times, the ELIAS secondary antibody that 100 μ l have diluted, enzyme mark two is added into every hole
It is anti-: mountain sheep anti mouse-HRP, 1/5000.33 DEG C of insulating box 1h.
(6) it develops the color
ELISA Plate is taken out, discards interior liquid, board-washing 4 times, 100 μ lTMB developing solutions are first added in every hole, determine according to the depth of color
Determine developing time, general 33 DEG C, 15min.
(3) reaction is terminated
100 μ l1MHCl solution are added in every hole, terminate reaction.It is engraved in 450nm in microplate reader to read, OD value is greater than and is set
The corresponding dilution in hole of 2.1 times of fixed negative control OD value, it is determined as the potency of the sample.
The results are shown in Table 1.
Table 1- antibody purification indirect ELISA titer testing result
Show that the potency of 3G2E2 antibody purification is in 512K or so by ELISA bioactivity result.
2, Purity
Purified antibody samples carry out SDS-PAGE electrophoresis, and purity is 85% or more after detection obtains antibody purification.
3, purposes is verified
(1) immunoblotting
The normal Glial cells HEB of people does not express HLA-F, but human glioma cell U251, U138MG and SHG44 are low
HLA-F is expressed, and human glioma cell A132, TG905, U333 and T98G and human brain neuroglia of optic nerve oncocyte HS683 are different
Often high expression HLA-F, is illustrated in figure 3 the schematic diagram of HLA-F antibody test human glioma cell HLA-F expression after purification.
(2) immunofluorescence
Normal Glial cells HEB (negative control) and brain glioblastoma cell T98G (height expression HLA-F) use neutrality Fu Er
Malin fixes, and 0.2%TritonX-1004 DEG C is incubated for 5 minutes.After pre-cooling PBS washes 3 times, after 5%BSA is incubated at room temperature 30 minutes,
HLA-F antibody 1:200 is stayed overnight at 4 DEG C.PBS is washed 3 times, Alexa488 rabbit-anti mouse secondary antibody 1:400, is incubated at room temperature 1 hour.PBS washes 3
Secondary, after DAPI is dyed 3 minutes, PBS is washed 3 times, and quencher mounting, micro- sem observation is added dropwise.As a result as shown in figure 4, normal brain activity glue
Non-coloring (left figure) after cell plastid HEB cell HLA-F dyeing, but after brain glioblastoma cell T98G cell HLA-F dyeing, it is seen that
HLA-F is positioned at cell membrane and cytoplasm (light tone region in right figure).
(3) co-immunoprecipitation
T98G cell is collected, 0.1%NP-40 lysate 1ml, on ice after 1 hour, 4 DEG C of 13200rpm are centrifuged 5 minutes.It surveys
Protein concentration.Take 1mg protein sample that IgG the or HLA-F antibody of 0.25 μ g/mg is added to it respectively, shaking table is incubated for 4 DEG C overnight.
10 μ lproteinA/G are added, sample is placed in 4 DEG C and is incubated for 1 hour.4 DEG C of 3200rpm are centrifuged 2 minutes.PBS is washed 3 times.1×SDS
15 μ l of sample-loading buffer.95 DEG C are heated 3 minutes, loading after of short duration centrifugation.After loading, polyacrylamide gel elder generation 90V is run
Complete spacer gel, then voltage is risen into 200V until electrophoresis terminates；After electrophoresis, removes gel and carry out transferring film, constant pressure 100V turns
Film, about 1.5h, constant current 250mA；After electricity turns, first washed 4 times with PBST after removing film, each 5min；Film is placed in 5%
33 DEG C of 1h are closed in skimmed milk power confining liquid；Primary antibody is diluted with confining liquid, film is stayed overnight for 4 DEG C in primary antibody dilution；Next day is by film
Film 4 times are washed with PBST after taking-up, each 5min；Secondary antibody is diluted with the confining liquid containing 5% milk.Film 33 DEG C of reactions in secondary antibody
1h；After completion of the reaction, film taking-up is placed in clean box and washes film 4 times, each 5min；ECL development, exposure.Such as Fig. 5 institute
Show, it is seen that compared with negative control IgG group, HLA-F antibody after purification can be in conjunction with HLA-F in T98G cell.
(4) LDH is tested
T98G cell and each 100 μ L of NK cell (effect target ratio 50:1,25:1) are taken, is added in U-shaped 96 well culture plate；Target cell
Spontaneous release hole adds T98G cell and each 100 μ L of culture solution, target cell maximum relief hole add T98G cell and 1%NP40 or
Each 100 μ L of 2.5%Triton；Above-mentioned items are all provided with three multiple holes, in 33 DEG C, 5%CO24h is cultivated in incubator, then by 96
Well culture plate is centrifuged 5min with 1500r/min, and every hole is drawn in 100 μ L horizontalization bottom of supernatant, 96 well culture plate, while LDH base is added
100 μ L of matter liquid reacts 3min, and the HCl30 μ L of 1mol/L is added in every hole, measures OD value (OD) at microplate reader 490nm.
As shown in Figure 6, it is seen that compared with the control group, HLA-F antibody (10g/ml) after purification being capable of enhancement effect cell
(NK cell) kills the function and effect of target cell (T98G cell).
Purified antibody samples of the present invention are applicable not only to protein immunization imprinting (WB), ELISA, and are suitable for immune
It is co-precipitated (IP), immunofluorescence (IF) and neutralizing antibody (LDH).
The above description is merely a specific embodiment, but scope of protection of the present invention is not limited thereto, any
Those familiar with the art in the technical scope disclosed by the present invention, can easily think of the change or the replacement, and should all contain
Lid is within protection scope of the present invention.Therefore, protection scope of the present invention should be based on the protection scope of the described claims.
Claims (10)
1. the preparation method of people's HLA-F monoclonal antibody, which comprises the steps of:
(1) gene HLA-F is connected into carrier pCzn1 (+), obtains recombinant plasmid pCzn1 (+)-HLA-F；
(2) plasmid pCzn1 (+)-HLA-F is transferred to expression bacterial strain, obtains the monoclonal bacterial strain with ampicillin resistant；Later
Inducing expression is carried out using IPTG, obtains target protein HLA-F inclusion body；
(3) refolding strategy processing, the processing of Ni column purification are successively carried out to step (2) the target protein HLA-F inclusion body, obtained pure
HLA-F albumen after change；
(4) using HLA-F albumen carries out tachysynthesis to mouse after purification described in step (3), immune mouse is obtained, using immune
The lymphocyte of mouse and myeloma cell carry out cell fusion, filter out positive hole cell later and are subcloned；
(5) it screens the strong positive cell strain obtained after step (4) subclone and carries out ascites preparation, purification process is carried out to ascites
Afterwards to get the people HLA-F monoclonal antibody.
2. the preparation method of people HLA-F monoclonal antibody according to claim 1, which is characterized in that in step (2), institute
Stating expression bacterial strain is Escherichia coli TM；
The concrete operations that plasmid pCzn1 (+)-HLA-F is transferred to the expression bacterial strain are as follows:
The plasmid aqueous solution for measuring the 1 μ l μ of 100ng/ containing plasmid concentration l, being added to 100 μ l containing cell number is 5 × 106A impression
State expresses bacterial strain CaCl2In suspension, it is placed in 20min on ice；Later in 42 DEG C of hot compress 90s, then 5min in ice is set rapidly, be added
600 μ lLB culture solutions；33 DEG C, 220r/min shaking 1h, it is flat to be all coated on the LB containing 50 μ g/ml ampicillins after centrifugation
Plate, 33 DEG C of inversion overnight incubations, obtains the monoclonal bacterial strain with ampicillin resistant；
Concrete operations using IPTG inducing expression are as follows:
Take the monoclonal strain inoculated on LB plate with ampicillin resistant in the LB culture solution for containing 50 μ g/ml ampicillins
In, 33 DEG C, 220r/min shaking overnight；Next day, 1:100 was inoculated in the training of the 30mlLB containing 50 μ g/ml ampicillins by volume
In nutrient solution, 33 DEG C, 220r/min shake to thallus OD600 be 0.6-0.8；IPTG is added into culture to final concentration of
0.5mM, 33 DEG C, 220r/min shake 4h, inducing expression target protein HLA-F, 10000r/min room temperature is centrifuged 2min, in abandoning
Clearly to get target protein HLA-F inclusion body.
3. the preparation method of people HLA-F monoclonal antibody according to claim 1, which is characterized in that right in step (3)
The concrete operations that the target protein HLA-F inclusion body carries out refolding strategy processing are as follows:
The target protein HLA-F inclusion body is resuspended in 20ml lysate, after ultrasonication, 4 DEG C of 10000r/min room temperatures from
Heart 20min collects precipitating；It uses the washing of inclusion body cleaning solution precipitating 3 times；With dissolution buffer solution precipitating, the dissolution is delayed
The volume of fliud flushing and the precipitating is 10:1, and 4 DEG C stand overnight, room temperature, and 10000r/min is centrifuged 15min, obtains supernatant and exists
It is slowly added dropwise under stirring condition into the buffer containing 20mMtris-HCl, 0.15MNaCl and pH8.0, obtains protein solution dress
Enter bag filter dialysed overnight in the solution containing 20mMtris-HCl, 0.15MNaCl and pH8.0, obtaining refolding strategy, treated
HLA-F inclusion body.
4. the preparation method of people HLA-F monoclonal antibody according to claim 1, which is characterized in that the refolding strategy
The concrete operations for HLA-F inclusion body progress Ni column purification processing that treated are as follows:
Using low pressure chromatography system, supernatant solution, to nickel ion affinity chromatograph column, first uses buffer with 0.5ml/min flow velocity loading
With the flushing of 0.5ml/min flow velocity, until efflux OD280 value reaches baseline；
Then with cleaning solution with the flushing of 1ml/min flow velocity, until efflux OD280 value reaches baseline；
Destination protein is eluted with 1ml/min flow velocity with eluent later, collects albumen efflux；
Finally albumen efflux addition bag filter was dialysed in the solution containing 20mMtris-HCl, 0.15MNaCl and pH8.0
Night obtains HLA-F albumen after purification.
5. the preparation method of people HLA-F monoclonal antibody according to claim 1, which is characterized in that in step (4), leaching
The concrete operations that bar cell and myeloma cell carry out fusion experiment are as follows:
Myeloma cell and lymphocyte are mixed according to quantity ratio 1:5, obtains cell mixture；The cell mixture is put into
It in 50ml centrifuge tube, is diluted with DMEM basal medium, 5min is then centrifuged under the conditions of 1000rpm, abandon supernatant, shake centrifugation
Pipe keeps cell uniform, is slowly added to 0.8ml50%PEG, reacts 90 seconds, and 20-30mlDMEM culture medium is then added and terminates PEG,
The cell of fusion is put into 33 DEG C of water-baths and reacts 10min, 5min is centrifuged under the conditions of 1000rpm, is added after abandoning supernatant
HATDMEM culture medium；
Cell fusion is auxiliary into 96 orifice plates, every 100 μ l of hole；Then tissue culture plate is put into CO2It cultivates, melts in incubator
After closing 10 days, positive hole cell is screened in fusion.
6. the preparation method of people HLA-F monoclonal antibody according to claim 1, which is characterized in that in step (4), institute
The concrete operations for stating subclone are as follows:
Cell in positive hole is blown and beaten, N is counted as, N/4mlDMEM culture medium is added in centrifuge tube, 100 μ l cell suspensions is taken to arrive
In centrifuge tube, blow it is even after stay 1ml, add DMEM to 4ml, blow even, stay 100 μ l in tube bottom；Add DMEM to 5ml in centrifuge tube,
Be added dropwise to the first three rows of 96 orifice plates after mixing, every hole one is dripped, and tube bottom stays 1.8-2ml, adds DMEM to 5ml, blow it is even after be added dropwise to
Tri- row of D, E, F of 96 orifice plates, every hole one are dripped, and tube bottom stays 1.5-1.8ml, adds DMEM to 2.8-3ml, blow it is even after be added dropwise to 96 holes
G, H row of plate, every hole one is dripped, and after 3-10 days, is screened the monoclonal hole being positive and is expanded culture singling.
7. the preparation method of people HLA-F monoclonal antibody according to claim 1, which is characterized in that right in step (5)
The operation that ascites carries out purification process is specific as follows:
Protein A Sepharose medium is packed into nickel ion affinity chromatograph column, by ascites and PBS according to volume ratio 1:1 equivalent
Slow loading after mixing is eluted after antibody in conjunction with after with glycine elution buffer to get the people HLA-F monoclonal antibody.
8. people's HLA-F monoclonal antibody that any one of claim 1-3 the method is prepared.
9. application of the monoclonal antibody described in claim 8 in terms of co-immunoprecipitation, immunofluorescence and neutralizing antibody.
10. monoclonal antibody described in claim 8 is in preparation for the application in tumor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810979617.0A CN109111520A (en) | 2018-08-24 | 2018-08-24 | People's HLA-F monoclonal antibody and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810979617.0A CN109111520A (en) | 2018-08-24 | 2018-08-24 | People's HLA-F monoclonal antibody and its preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109111520A true CN109111520A (en) | 2019-01-01 |
Family
ID=64860924
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810979617.0A Pending CN109111520A (en) | 2018-08-24 | 2018-08-24 | People's HLA-F monoclonal antibody and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109111520A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114746152A (en) * | 2020-08-23 | 2022-07-12 | 应用干细胞有限公司 | HLA-F modified cells and methods |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106084056A (en) * | 2016-06-08 | 2016-11-09 | 中国热带农业科学院热带作物品种资源研究所 | A kind of starch phosphorylase monoclonal antibody and preparation method thereof |
-
2018
- 2018-08-24 CN CN201810979617.0A patent/CN109111520A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106084056A (en) * | 2016-06-08 | 2016-11-09 | 中国热带农业科学院热带作物品种资源研究所 | A kind of starch phosphorylase monoclonal antibody and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| BIOLEGEND公司: "Purified anti-human HLA-F Antibody", 《BIOLEGEND官网》 * |
| J MOSCOSO等: "HLA-G, -E and -F: allelism, function and evolution", 《TRANSPL IMMUNOL》 * |
| 赵肃清等: "《生命科学及生物技术现状与应用前景》", 31 May 2015, 广东经济出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114746152A (en) * | 2020-08-23 | 2022-07-12 | 应用干细胞有限公司 | HLA-F modified cells and methods |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105461805B (en) | Monoclonal Antibodies against Porcine Epidemic Diarrhea Virus and its application | |
| CN106632660A (en) | T cell receptor (TCR) capable of identifying NY-ESO-1 antigen short-peptides | |
| CN108047332A (en) | Using CD19 as the specific antibody of target spot, CAR-NK cells and its preparation and application | |
| CN106749620A (en) | Recognize the φt cell receptor of MAGE A1 antigen small peptides | |
| CN105473745B (en) | For characterizing the function of people's memebrane protein and the virion display array of interaction | |
| CN106771250B (en) | A kind of luciferase co-immunoprecipitation kit for detecting mammal Lyme disease | |
| Newsom-Davis et al. | T-cell reactivity in myasthenia gravis | |
| CN114480298B (en) | Hybridoma cell strain secreting anti-TIGIT monoclonal antibody and application thereof | |
| CN109232736A (en) | Specifically bind monoclonal antibody, pharmaceutical composition, kit and its application of transmissible gastro-enteritis virus | |
| CN106699874A (en) | T cell receptor identifying PRAME antigenic short-peptide | |
| CN114058595B (en) | Hybridoma cell strain secreting anti-LAG 3 monoclonal antibody and application thereof | |
| CN109232734A (en) | Specifically bind monoclonal antibody, pharmaceutical composition, kit and its application of hepatitis infectiosa canis virus | |
| CN109254143A (en) | Use the adaptive immune response of Arm-PCR and high-flux sequence identification antigen-specific | |
| KR20240096684A (en) | Ns1-binding protein and uses thereof | |
| CN110684105A (en) | anti-HSP 90 monoclonal antibody and kit | |
| CN112979817A (en) | Monoclonal antibody for recognizing anti-CLDN 18_2 antibody and preparation method and application thereof | |
| CN109111520A (en) | People's HLA-F monoclonal antibody and its preparation method and application | |
| CN108314731B (en) | It is a kind of for the full source of people monoclonal neutralizing antibody of tetanus toxin and its application | |
| CN108218984B (en) | A kind of full people source neutralizing antibody of anti-tetanus toxin | |
| CN109535255A (en) | A kind of anti-human CD26 antibody and its application in detection kit | |
| CN113817063A (en) | Anti-human abnormal prothrombin antibody and application thereof | |
| CN109867725A (en) | PD-1-Fc fusion protein and its preparation method and application | |
| CN112625133A (en) | CDK2 nano antibody and application thereof | |
| CN114249819A (en) | Feline panleukopenia virus antibody, kit containing feline panleukopenia virus antibody and application | |
| CN109251244A (en) | A kind of identification is derived from the TCR of EBV memebrane protein LMP1 antigen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190101 |