CN114249819A

CN114249819A - Feline panleukopenia virus antibody, kit containing feline panleukopenia virus antibody and application

Info

Publication number: CN114249819A
Application number: CN202010995236.9A
Authority: CN
Inventors: 田克恭; 王莹; 白晶晶; 邓均华
Original assignee: Luoyang Pu Tai Biotechnology Co ltd
Current assignee: Luoyang Pu Tai Biotechnology Co ltd
Priority date: 2020-09-21
Filing date: 2020-09-21
Publication date: 2022-03-29
Anticipated expiration: 2040-09-21
Also published as: CN114249819B

Abstract

The invention provides an antibody, which comprises basic units of an Ig monomer, wherein a heavy chain variable region of the Ig monomer is shown as SEQ ID NO.1, and a light chain variable region is shown as SEQ ID NO. 2; or the heavy chain variable region of the Ig monomer is shown as SEQ ID NO.3, and the light chain variable region is shown as SEQ ID NO. 4. The feline panleukopenia virus colloidal gold test strip consisting of the two antibodies can be used for detecting feline panleukopenia virus antigens, and has high sensitivity and good specificity. The heavy chain variable region and the light chain variable region of the antibody can also be used for preparing a single-chain antibody, and the single-chain antibody can be used for evaluating the reactivity of the feline panleukopenia virus.

Description

Feline panleukopenia virus antibody, kit containing feline panleukopenia virus antibody and application

Technical Field

The invention relates to a feline panleukopenia virus antibody, a kit containing the antibody preparation and application, and belongs to the field of immunoassay.

Background

Feline panleukopenia virus (also known as Feline parvovirus or Feline distemper virus, FPV) belongs to the genus parvovirus, and is three very similar autonomously replicating viruses (see Mingke et al, comparison of relationships among mink enteritis virus, Feline panleukopenia virus, and canine parvovirus type 2. the Chinese veterinary journal, 1992(6):45-47), which is one of the most pathogenic and broad-spectrum infections; the infection can be caused all the year round, the high-contact and acute infectious diseases of dogs, cats and minks can be caused, the clinical symptoms caused by the infection are high fever, vomiting, severe dehydration, leukopenia, body temperature rise, inappetence, mental depression, higher infection rate and death rate, particularly the death rate of young animals reaches 90 percent, and huge loss is brought (see Hokkaize and the like, the characteristics of cat parvovirus, dog parvovirus and mink parvovirus are compared, China livestock veterinarians 2009,36(7): 166-.

The application of cats as experimental animals in medical and biological experiments and animal disease model research is becoming more and more extensive worldwide, and in some experiments, such as pharmacology, blood pressure related experiments, disease diagnosis, nutrition related research, oncology, anatomy and the like, the work is not enough. Although cats are used as experimental animals, the application of cats is more and more extensive, but due to the lack of detection reagents, most cats used for experiments are pet cats which are not strictly detected, trapped wild cats or Chinese pastoral cats, and at present, no detection report for developing cats for experiments is found in China, and the potential safety hazard is obvious.

At present, methods for detecting feline panleukopenia viruses comprise methods such as PCR (polymerase chain reaction), hemagglutination test and the like, but the methods have defects, and molecular biological methods mainly based on PCR (see Liuwei Quanet. establishment of general PCR diagnostic technology for carnivorous animal parvovirus; Chinese veterinary science report: 2001,21(3):249-251) have high requirements on technology and equipment, and are complex to operate and long in time consumption; the hemagglutination test not only needs the red blood cells, but also requires the red blood cells to be prepared, has long operation time, and is easy to be interfered by impurities in secretion or excrement when being found in clinical practical detection. All of the above detection methods are difficult to apply in veterinary clinical settings. In addition, the detection targets of the current commercial test strip products are only feces and anus swabs, and when the test strip products are used for detecting other types of samples, the accuracy cannot be guaranteed.

Therefore, in order to ensure the quality level of the experimental cat during the experiment and improve the accuracy of the experiment and ensure the health and safety of the cat breeder, a product for rapidly, simply, conveniently and accurately detecting the feline panleukopenia virus is urgently needed to be developed for clinical diagnosis.

Disclosure of Invention

In order to solve the defects of the prior art, the invention provides a pair of monoclonal antibodies of feline panleukopenia virus, a kit containing the monoclonal antibodies and application thereof.

The invention relates to an antibody, which is composed of basic units of an Ig monomer, wherein the Ig monomer molecule comprises four heterologous polypeptide chains, wherein two chains with larger molecular weight are heavy chains, two chains with smaller molecular weight are light chains, the amino acid composition between the two heavy chains in the same Ig molecule is completely the same, the amino acid composition between the two light chains in the same Ig molecule is completely the same, wherein, the N end of each heavy chain is provided with a heavy chain variable region, the heavy chain variable region is shown as SEQ ID NO.1, the N end of each light chain is provided with a light chain variable region, and the light chain variable region is shown as SEQ ID NO. 2.

The heavy chain variable region SEQ ID NO.1 and the light chain variable region SEQ ID NO.2 of the antibody of the invention can have good binding capacity with feline panleukopenia virus, the HI titer is 1: 5120, and the IFA titer is 1: 6400.

In one embodiment of the present invention, the antibody is IgA, IgD, IgE, IgG or IgM.

The invention also relates to an antibody or a fragment thereof specifically binding to feline panleukopenia virus, wherein a heavy chain variable region of the antibody or the fragment thereof is shown as SEQ ID No.1 or a conservative variant thereof obtained by one or more amino acid addition, deletion, substitution or modification conservative mutation, and a light chain variable region of the antibody or the fragment thereof is shown as SEQ ID No.2 or a conservative variant thereof obtained by one or more amino acid addition, deletion, substitution or modification conservative mutation.

In one embodiment of the present invention, the antibody or the fragment thereof is a monoclonal antibody or a genetically engineered antibody, wherein the genetically engineered antibody comprises a single chain antibody, a chimeric monoclonal antibody, a modified monoclonal antibody or a fragment of the single chain antibody, the chimeric monoclonal antibody or the modified monoclonal antibody, and the antibody or the fragment thereof still retains the ability to specifically bind to feline panleukopenia virus.

In a preferred embodiment of the present invention, the antibody or its fragment is monoclonal antibody 3C3, the heavy chain variable region of monoclonal antibody 3C3 is shown in SEQ ID No.1, and the light chain variable region is shown in SEQ ID No. 2.

The epitope recognized by the monoclonal antibody 3C3 is positioned in the protein of the feline panleukopenia virus VP 2. The heavy chain variable region of the monoclonal antibody 3C3 is shown in SEQ ID No.1, and the light chain variable region is shown in SEQ ID No. 2; the monoclonal antibody 3C3 has a HI titer of 1: 5120 and an IFA titer of 1: 6400 on feline panleukopenia virus, and shows that the monoclonal antibody has good response characteristics with the feline panleukopenia virus.

The invention also relates to a hybridoma cell 3C3 strain, wherein the hybridoma cell 3C3 strain secretes the monoclonal antibody 3C 3.

The invention also relates to an antibody, which is composed of basic units of Ig monomer, wherein the Ig monomer molecule contains four heterologous polypeptide chains, wherein two chains with larger molecular weight are heavy chains, two chains with smaller molecular weight are light chains, the amino acid composition between the two heavy chains in the same Ig molecule is completely the same, the amino acid composition between the two light chains in the same Ig molecule is completely the same, wherein, the N end of each heavy chain is provided with a heavy chain variable region, the heavy chain variable region is shown as SEQ ID NO.3, the N end of each light chain is provided with a light chain variable region, and the light chain variable region is shown as SEQ ID NO. 4.

The heavy chain variable region SEQ ID NO.3 and the light chain variable region SEQ ID NO.4 of the antibody of the invention can have good binding capacity with feline panleukopenia virus, the HI titer is 1: 10240, and the IFA titer is 1: 12800.

The invention also relates to an antibody or a fragment thereof specifically binding to feline panleukopenia virus, wherein a heavy chain variable region of the antibody or the fragment thereof is shown as SEQ ID No.3 or a conservative variant thereof obtained by one or more amino acid addition, deletion, substitution or modification conservative mutation, and a light chain variable region of the antibody or the fragment thereof is shown as SEQ ID No.4 or a conservative variant thereof obtained by one or more amino acid addition, deletion, substitution or modification conservative mutation.

In a preferred embodiment of the present invention, the antibody or its fragment is monoclonal antibody 4A1, the heavy chain variable region of monoclonal antibody 4A1 is shown as SEQ ID No.3, and the light chain variable region is shown as SEQ ID No. 4.

The epitope recognized by the monoclonal antibody 4A1 is positioned in the protein of the feline panleukopenia virus VP 2. The heavy chain variable region of the monoclonal antibody 4A1 is shown in SEQ ID No.3, and the light chain variable region is shown in SEQ ID No. 4; the monoclonal antibody 4A1 has HI titer of 1: 10240 and IFA titer of 1: 12800 on feline panleukopenia virus, which shows that the monoclonal antibody has good response characteristic with the feline panleukopenia virus.

The invention also relates to a hybridoma cell 4A1 strain, wherein the hybridoma cell 4A1 strain secretes the monoclonal antibody 4A 1.

The invention also relates to a kit, wherein the kit comprises a feline panleukopenia virus colloidal gold detection test strip and a sample treatment solution, the test strip comprises an effective amount of the monoclonal antibody 3C3 and an effective amount of the gold-labeled monoclonal antibody 4A1, or the test strip comprises an effective amount of the monoclonal antibody 4A1 and an effective amount of the gold-labeled monoclonal antibody 3C3, and a detection reagent for detecting the antigen-antibody reaction of the feline panleukopenia virus.

The kit is constructed according to the principle of double-antibody sandwich antigen detection, and can realize antigen detection by methods including but not limited to ELISA, enzyme immunoassay test paper strips, colloidal gold test paper strips, fluorescent test paper strips and the like.

As an embodiment of the present invention, the test strip in the kit includes: a bottom plate, wherein the bottom plate is provided with a first end and a second end, and a sample pad, a gold-labeled pad, a nitrocellulose membrane and a water absorption pad are sequentially arranged along the direction from the first end to the second end, and the nitrocellulose membrane is in contact with the gold-labeled pad or the sample pad and the gold-labeled pad, so that the combined body of the feline panleukopenia virus antigen and the gold-labeled monoclonal antibody 4A1 can migrate to the second end of the bottom plate; the gold label pad contains the monoclonal antibody 4A1 labeled by colloidal gold, the nitrocellulose membrane comprises a detection line and a quality control line, the monoclonal antibody 3C3 is immobilized on the detection line, and the goat anti-mouse polyclonal antibody or the goat anti-mouse secondary antibody is immobilized on the quality control line; wherein the effective amount of the monoclonal antibody 3C3 is 0.5-2.5 mg/ml, the effective amount of the monoclonal antibody 4A1 is 4-64 μ g/ml when being labeled with colloidal gold, and the goat anti-mouse polyclonal antibody or the goat anti-mouse secondary antibody is 1.0-3.0 mg/ml; wherein the sample processing solution is a solution containing 0.01M PBS with pH7.4, 0.5% V/V Triton X-114, 0.2-1.0% W/V Pluronic F-68 and 0.05% Proclin 300.

The content of the monoclonal antibody 3C3 in the test strip in the kit can be 0.5mg/ml, 0.6mg/ml, 0.7mg/ml, 0.8mg/ml, 0.9mg/ml, 1.0mg/ml, 1.1mg/ml, 1.2mg/ml, 1.3mg/ml, 1.4mg/ml, 1.5mg/ml, 1.6mg/ml, 1.7mg/ml, 1.8mg/ml, 1.9mg/ml, 2.0mg/ml, 2.1mg/ml, 2.2mg/ml, 2.3mg/ml, 2.4mg/ml and 2.5 mg/ml.

The content of the monoclonal antibody 4A1 colloidal gold in the test strip in the kit can be 4 μ g/ml, 5 μ g/ml, 6 μ g/ml, 7 μ g/ml, 8 μ g/ml, 9 μ g/ml, 10 μ g/ml, 11 μ g/ml, 12 μ g/ml, 13 μ g/ml, 14 μ g/ml, 15 μ g/ml, 16 μ g/ml, 17 μ g/ml, 18 μ g/ml, 19 μ g/ml, 20 μ g/ml, 21 μ g/ml, 22 μ g/ml, 23 μ g/ml, 24 μ g/ml, 25 μ g/ml, 26 μ g/ml, 27 μ g/ml, 28 μ g/ml, 29 μ g/ml, 30 μ g/ml, 31 μ g/ml, 32. mu.g/ml, 33. mu.g/ml, 34. mu.g/ml, 35. mu.g/ml, 36. mu.g/ml, 37. mu.g/ml, 38. mu.g/ml, 39. mu.g/ml, 40. mu.g/ml, 41. mu.g/ml, 42. mu.g/ml, 43. mu.g/ml, 44. mu.g/ml, 45. mu.g/ml, 46. mu.g/ml, 47. mu.g/ml, 48. mu.g/ml, 49. mu.g/ml, 50. mu.g/ml, 51. mu.g/ml, 52. mu.g/ml, 53. mu.g/ml, 54. mu.g/ml, 55. mu.g/ml, 56. mu.g/ml, 57. mu.g/ml, 58. mu.g/ml, 59. mu.g/ml, 60. mu.g/ml, 61. mu.g/ml, 62. mu.g/ml, 63. mu.g/ml, 64. mu.g/ml.

The Pluronic F-68 content in the sample treatment fluid in the kit may be 0.2% W/V, 0.3% W/V, 0.4% W/V, 0.5% W/V, 0.6% W/V, 0.7% W/V, 0.8% W/V, 0.9% W/V, 1.0% W/V.

In one embodiment of the present invention, the effective amount of the monoclonal antibody 3C3 in the test strip is 0.8-2.5 mg/ml, and the effective amount of the monoclonal antibody 4a1 is 8-50 μ g/ml when labeled with colloidal gold.

In one embodiment of the present invention, the effective amount of the monoclonal antibody 3C3 in the test strip is 0.8-1.5 mg/ml, and the effective amount of the monoclonal antibody 4a1 when labeled with colloidal gold is 12-50 μ g/ml.

In a preferred embodiment of the present invention, the test strip contains 1.0mg/ml of the effective amount of the monoclonal antibody 3C3 and 18 μ g/ml of the effective amount of the monoclonal antibody 4a1 labeled with colloidal gold, or contains 1.5mg/ml of the effective amount of the monoclonal antibody 3C3 and 12 μ g/ml of the effective amount of the monoclonal antibody 4a1 labeled with colloidal gold, or contains 1.0mg/ml of the effective amount of the monoclonal antibody 3C3 and 12 μ g/ml of the effective amount of the monoclonal antibody 4a1 labeled with colloidal gold.

In one embodiment of the present invention, adjacent components of the sample pad, the gold-labeled pad, the nitrocellulose membrane, and the absorbent pad, which are arranged in the test strip in the direction from the first end to the second end, are in contact with each other, and non-adjacent components are not in contact with each other.

As an embodiment of the invention, the distance between the detection line and the quality control line is more than or equal to 4 mm.

The invention also relates to a preparation method of the colloidal gold detection kit, which comprises the following steps:

step 1) labeling the monoclonal antibody 4A1 as a gold-labeled antibody by using colloidal gold to prepare a gold-labeled pad;

step 2) fixing the monoclonal antibody 3C3, a goat anti-mouse secondary antibody or a goat anti-mouse polyclonal antibody, and respectively adsorbing one end of a nitrocellulose membrane as a detection line and a quality control line;

step 3) sequentially sticking the sample pad, the gold label pad prepared in the step 1), the nitrocellulose membrane prepared in the step 2) and absorbent paper on the bottom plate, and cutting;

and step 4), preparing a sample treatment solution and subpackaging; assembling the sample processing solution prepared in the step 3) into a kit.

In one embodiment of the present invention, the monoclonal antibody 4a1 in step 1) is labeled at a content of 8 to 50 μ g/ml.

As an embodiment of the invention, the amount of the monoclonal antibody 3C3 immobilized on the detection line in the step 2) is 0.8-2.5 mg/ml, and the amount of the goat anti-mouse polyclonal antibody or the goat anti-mouse secondary antibody immobilized on the quality control line is 1-3 mg/ml.

In one embodiment of the present invention, the sample processing solution in step 3) is a solution containing 0.01M PBS with pH7.4, 0.5% V/V Triton X-114, 0.2% -1.0% W/V Pluronic F-68, and 0.05% Proclin 300.

As an embodiment of the invention, the sample processing solution in the step 3) is a solution containing 0.01M PBS with pH7.4, 0.5% V/V Triton X-114, 0.5% W/V Pluronic F-68 and 0.05% Proclin 300.

The invention also relates to application of the kit in non-immunodiagnosis, wherein the application of the non-immunodiagnosis comprises epidemiological analysis, detection of isolated tissues, epitope identification research and antigen reactivity of feline panleukopenia virus.

The invention also provides a single-chain antibody, wherein the heavy chain variable region of the single-chain antibody is shown as SEQ ID No.1 or SEQ ID No.3, and the light chain variable region of the single-chain antibody is shown as SEQ ID No.2 or SEQ ID No. 4.

The single-chain antibody provided by the invention has the heavy chain variable region and the light chain variable region of the monoclonal antibodies 3C3 and 4A1, and has good binding capacity with the feline panleukopenia virus strain.

The invention also relates to the application of the antibody or the fragment thereof in identification research of feline panleukopenia virus epitope; the antibody or fragment thereof is monoclonal antibody 3C3 or monoclonal antibody 4a 1.

The kit containing the monoclonal antibody pair can detect FPV with high sensitivity, can detect various targets of cat sources, has high coincidence rate and high accuracy, makes up the defects of the FPV of the existing commercial product, has the advantages of rapidness, convenience and accuracy, and is more favorable for clinical application.

Detailed Description

Hereinafter, embodiments of the present invention will be described.

The term "Feline panleukopenia virus" also known as Feline Parvovirus (FPV), Feline distemper virus, and Feline infectious enteritis virus belongs to the genus parvovirus of the family parvoviridae, only 1 serotype can infect various animals of the families felidae, raccoon, and ferridae, and the Feline panleukopenia (an acute highly-contact infectious disease, also known as Feline distemper, Feline infectious enteritis, Feline parvoviral enteritis, and Feline ataxia) of the family felidae is mainly caused by the fact that minks are most susceptible to the animals of the families felidae and ferridae, and clinical symptoms after infection mainly include leukopenia, hemorrhagic enteritis, diarrhea, paroxysmal fever, vomiting, and the like.

The term "VP 2 protein" is the major structural protein of feline panleukopenia virus, one of the 2 proteins that make up the nucleocapsid, forming a cyclic structure with a molecular weight of approximately 65 kD.

The term "antibody" is a kind of globulin with immune function, which is synthesized and secreted after B cell is differentiated and matured into plasma cell after immune cell is activated by antigen.

The term "Ig", immunoglobulin (Immunologlobulin), refers to a globulin having the activity or chemical structure of an antibody (Ab) similar to an antibody molecule. Immunoglobulins are tetrapeptide chain structures made up of two identical light chains and two identical heavy chains joined by interchain disulfide bonds.

The term "IgA", Immunoglobulin A (abbreviated as IgA), which is present in serum in an amount of 10-20% next to IgG, is present in mucosal tissues such as the digestive tract, respiratory tract and urogenital system. Mucosal tissue, which has mucosal lymphoid tissue, produces IgA to protect against pathogenic invasion, and is also found in saliva, tears and milk, especially colostrum, which has a relatively high IgA content. In the human body, the structure of IgA exists mainly in monomeric and dimeric forms. According to the distribution of IgA in the body, it can be divided into serotypes and secretory types. The serotype IgA is a monomer and has weak immune effect. Secretory IgA has diploids and trisomes, is the main component of mucosal defense system of organism, and is widely distributed in milk, saliva, and mucous membrane secretion of gastrointestinal tract, respiratory tract and genitourinary tract.

The term "IgD", immunoglobulin d (IgD), which is present in serum in very low amounts, about 1% of total Ig, and in relatively large amounts, individually different, and can be present on the surface of B cells as membrane receptors.

The term "IgE", IgE is an antibody that mediates type I allergy, and therefore the detection of serum total IgE and specific IgE is valuable for the diagnosis of type I allergy and the determination of allergens.

The term "IgG", immunoglobulin G (IgG), which is synthesized in the spleen and lymph nodes, is present in the highest amounts (75% of the Ig) in human serum, is mainly distributed in serum and tissue fluid, is a major component of antibacterial, antitoxin and antiviral antibodies, and is also an important material basis in the process of anti-infective immunity

The term "IgM", immunoglobulin m (IgM), is the largest molecular weight immunoglobulin, mainly secreted and synthesized by plasma cells in the spleen and lymph nodes, and is divided into two subtypes, IgM2 and IgM. Mainly distributed in serum and exists in the form of pentamer, which accounts for 5-10% of the total Ig in serum. IgM has powerful bactericidal, complement activating, immunoregulation and agglutination functions and is also involved in some autoimmune diseases and hypersensitivity reaction.

The term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical, except for the possible presence of a small number of possible spontaneous mutations. Thus, the modifier "monoclonal" indicates that the antibody is not a mixture of discrete antibodies in nature. Preferably, the monoclonal antibodies include monovalent or single chain antibodies, diabodies, chimeric antibodies, canine, feline, mink-derived antibodies, as well as derivatives, functional equivalents, and homologs of the foregoing, and also include antibody fragments and any polypeptides containing an antigen binding domain. An antibody is any specific binding member which encompasses a binding domain with the desired specificity, and thus, this term encompasses antibody fragments, derivatives, caninized antibodies, and functional equivalents and homologs of antibodies which are homologous thereto, as well as any polypeptide, whether natural or synthetically produced, which contains an antigen binding domain. Examples of antibodies are immunoglobulin subtypes (e.g., IgG, IgE, IgM, IgD and IgA) and subclasses thereof; or a fragment comprising an antigen binding domain such as Fab, scFv, Fv, dAb, Fd; and diabodies (diabodies). Chimeric molecules comprising an antigen binding domain fused to another polypeptide or an equivalent are also included. Cloning and expression of chimeric antibodies is described in ep.a.0120694 and ep.a.0125023. Antibodies can be modified in a number of ways and recombinant DNA techniques can be used to produce other antibodies or chimeric molecules that retain the specificity of the original antibody. Such techniques may involve the introduction of DNA encoding the immunoglobulin variable regions or Complementarity Determining Regions (CDRs) of antibodies into the constant regions or constant region plus framework regions of different immunoglobulins, see ep.a.184187, GB2188638A or ep.a.239400. Genetic mutations or other changes may also be made to the hybridoma cells or other cells that produce the antibody, which may or may not alter the binding specificity of the produced antibody. The "monoclonal antibody" used in the present invention can also be produced by a hybridoma method, since a DNA sequence encoding the murine antibody of the present invention can be obtained by a conventional method well known to those skilled in the art, such as artificially synthesizing a nucleotide sequence based on the amino acid sequence disclosed in the present invention or amplifying it by a PCR method, and thus, a recombinant DNA method can be used, and the sequence can be ligated into an appropriate expression vector by various methods well known in the art. Finally, the transformed host cell is cultured under conditions suitable for the expression of the antibody of the present invention, and then purified by a person skilled in the art using a conventional separation and purification means well known to those skilled in the art to obtain the monoclonal antibody of the present invention. Antibodies comprise polypeptide chain geometries linked together by disulfide bridges, with the two polypeptide backbones, termed light and heavy, constituting all major structural classes (isoforms) of antibodies. Both the heavy and light chains can be further divided into subregions known as variable and constant regions. The heavy chain comprises a single variable region and three different constant regions, and the light chain comprises a single variable region (different from the variable region of the heavy chain) and a single constant region (different from the constant region of the heavy chain). The variable regions of the heavy and light chains are responsible for the binding specificity of the antibody.

The term "heavy chain variable region" refers to a polypeptide of 110 to 125 amino acids in length whose amino acid sequence corresponds to the amino acid sequence of the heavy chain of a monoclonal antibody of the invention starting from the N-terminal amino acid of the heavy chain. Similarly, the term "light chain variable region" refers to a polypeptide of 95 to 115 amino acids in length whose amino acid sequence corresponds to the light chain amino acid sequence of the monoclonal antibody of the invention starting from the N-terminal amino acid of the light chain. It is obvious to those skilled in the art that, based on the amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody specifically disclosed in the present invention, modifications such as addition, deletion, substitution and the like of one or more amino acids can be performed by conventional genetic engineering and protein engineering methods to obtain conservative variants, while still maintaining specific binding with feline panleukopenia virus. The monoclonal antibodies of the invention also include active fragments or conservative variants thereof.

The term "conservative variant" refers to a variant that substantially retains the characteristics of its parent, such as basic immunological biological, structural, regulatory, or biochemical characteristics. Generally, conservative variants of a polypeptide differ in amino acid sequence from the parent polypeptide, but the differences are limited so that the sequence with the parent polypeptide is very similar to the conservative variant overall and is identical in many regions. The difference in amino acid sequence between the conservative variant and the parent polypeptide can be, for example: substitutions, additions, and deletions of one or more amino acid residues and any combination thereof. The amino acid residue that is substituted or inserted may or may not be encoded by the genetic code. A conservative variant of a polypeptide may occur naturally, or it may be a non-naturally occurring variant. Non-naturally occurring conservative variants of the polypeptide may be generated by mutagenesis techniques or by direct synthesis.

The term "effective amount" when understood as "detecting an effective amount" refers to an amount that enables a positive sample to be detected with high sensitivity and a negative sample to be distinguished.

The terms "quality control line" and "control line" are used interchangeably to refer to the conditions used to determine whether an antigen-antibody reaction is appropriate, and to monitor whether the background of the reaction interferes with the assay results.

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

The phosphate buffer used in the examples of the present invention was PBS buffer (pH7.4) and was formulated in a volume of 1L: NaCl 8.0g, KCl 0.2g, Na₂HPO₄·12H₂O 2.9g、KH₂PO₄0.24g, but this embodiment should not be construed as limiting the scope of the present invention in any wayAnd (4) determining.

The chemical reagents used in the invention are all analytically pure and purchased from the national pharmaceutical group.

In order that the invention may be more readily understood, reference will now be made to the following examples. It should be understood that these examples are only for the purpose of the present invention and are not intended to limit the scope of the present invention. The experimental methods are conventional methods unless specified otherwise; the biomaterial is commercially available unless otherwise specified.

Example 1 isolation and identification of feline panleukopenia Virus

Intestinal content samples of suspected cat lethal to feline panleukopenia virus infection from multiple pet hospitals in Henan are respectively collected and are detected as 50 cat lethal to feline panleukopenia virus infection through PCR. Diluting the collected intestinal content sample by 10 times with PBS, centrifuging at 10000 rpm for 10 min, taking supernatant, filtering with 0.22 μm filter, inoculating to F81 cell, observing cell lesion day by day, repeatedly freezing and thawing at-20 deg.C when cell lesion appears, inoculating to F81 cell, and performing blind transmission in the same way until cell lesion is produced and virus is collected. The results show that the cytopathic effect generated after 47 samples are inoculated is not obvious or the pathological effect is lost in the process of passage, only 3 samples can generate obvious cytopathic effect after being inoculated, primers are designed, the obtained 3 isolate virus liquid VP2 genes are amplified by a molecular biology method and sequenced, the comparison is carried out with the feline panleukopenia virus strain sequences published by Genbank, the feline panleukopenia viruses are determined, and the 3 viruses are numbered as No.1, No.2 and No. 3.

Example 2 preparation, purification and characterization of monoclonal antibodies to feline panleukopenia Virus

2.1 preparation and purification of monoclonal antibodies against feline panleukopenia Virus

3 FPVs isolated in example 1 were used as immunogens, emulsified with Freund's adjuvant, and HI titers in sera of mice were determined by immunizing mice at 200. mu.l/mouse, 4 mice/group, and blood collection after two-and three-immunizations. Wherein, HI titer determination: the pig erythrocyte is used for carrying out erythrocyte agglutination test, namely HA test according to Chinese animal pharmacopoeia, 8 units of antigen (the strain for the antigen is 2#, and FPV 1009 strain) is prepared according to the result, and then the sample to be detected is carried out erythrocyte agglutination inhibition test, namely HI titer determination, according to Chinese animal pharmacopoeia. Results (see table 1): after FPV 1# secondary and tertiary immunizations, HI titer rises slowly and less, and cell fusion is abandoned; 2# post-secondary-tertiary-immune HI titer is increased quickly and is higher, selecting the mouse with the highest HI titer for cell fusion to obtain positive hybridoma cells, and preferably selecting 5 strains of positive hybridoma cells (the number is A, B, C, D, E) according to the HI titer and the cell state; and (3) slightly increasing HI titer after the second and third immunizations, selecting the mouse with the highest HI titer for cell fusion to obtain positive hybridoma cells, and preferably selecting 2 strains of positive hybridoma cells (numbered F, G) according to the HI titer and the cell state. The strain # 2 was designated as feline panleukopenia virus 1009 strain.

TABLE 1 summary of HI titers and cell fusion of mouse sera following FPV antigen immunization

The supernatants of the 7 selected hybridoma cells were subjected to HI titer and IFA titer measurement. Wherein, the IFA titer determination method comprises the following steps: f81 cells were diluted to 2X 10 with 1640 medium containing 8% fetal bovine serum⁵One cell/ml, seeded at 100 μ Ι/well into 96 well cell plates; then, the feline panleukopenia virus 1009 strain was inoculated to a 96-well cell plate at a rate of 2% and 100. mu.l/well, and placed at 37 ℃ under 5% CO²Culturing in an incubator for 68-72 hours. The culture medium was discarded, and the cells were washed 2 times with PB buffer (0.01mol/L, pH7.4), 250. mu.l/well, 3 minutes/time. Abandoning PB buffer solution (0.01mol/L, pH7.4), fixing with 80% cold acetone, acting at 50 μ L/hole for 30 min at 2-8 ℃. Discard acetone and wash 3 times with PB buffer (0.01mol/L, pH7.4), 250. mu.l/well, 3 min/time. Abandoning PB buffer solution (0.01mol/L, pH value 7.4), and drying to obtain IFA antigen plate, and storing at-20 ℃ for later use. After washing the IFA antigen plate 1 time with PB buffer (0.01mol/L, pH7.4), the samples to be tested were added to each well, 100. mu.l/well and positive control was set, and incubated at 37 ℃ for 1 hour.The column was washed 3 times for 3 minutes/time with PB buffer (0.01mol/L, pH 7.4). FITC-labeled rabbit anti-mouse antibody diluted 1: 400 was added to each well at 100. mu.l/well and allowed to react at 37 ℃ for 40 minutes. The wells were drained, washed 3 times with PB buffer (0.01mol/L, pH7.4), and 50. mu.l of PB buffer (0.01mol/L, pH7.4) was added to each well, and observed under an inverted fluorescence microscope. And (4) judging a result: and if the yellow-green fluorescence is observed in the dilution multiple corresponding to the sample hole, the sample hole is judged to be positive, otherwise, the sample hole is negative, and the reciprocal of the dilution multiple is the IFA titer. Results (see table 2): the HI titer and the IFA titer of the hybridoma G are lower, and the hybridoma G is discarded; the HI and IFA titers of the hybridoma cell A, B, C, D, E, F are relatively high, and the hybridoma cell A, B, C, D, E, F is injected into a mouse body to prepare ascites after cell recovery.

TABLE 27 summary of cell supernatant and ascites purification assay results for monoclonal antibodies

The ascites of monoclonal antibody 5 strain monoclonal antibody was purified by Protein G affinity chromatography and identified by SDS-PAGE gel electrophoresis, and the results were: the monoclonal antibody A has lower yield and is abandoned; monoclonal antibody B, C, D, E, F gave ideal results for subsequent evaluation.

2.2 monoclonal antibody pairing test study for test paper strip

Using FPV2# (10) in embodiment 1^5.5TCID₅₀Ml) virus solution and its diluent, 10 cat-derived fecal samples positive in PCR detection, 10 cat-derived fecal samples negative in PCR detection, and PBS buffer solution, test strips were prepared as in example 2, and monoclonal antibody pairing test was investigated, and the results (see Table 3) were: the test strip prepared by pairing only the monoclonal antibody D as a gold-labeled antibody and the monoclonal antibody C as a fixed antibody has the highest detection sensitivity, the results of detecting clinical samples and PBS buffer solution are the most accurate, the ascites yield of the monoclonal antibody C, D and the evaluation results after purification show that the protein content, the purity, the HI titer and the IFA titer are all ideal, and the monoclonal antibody D is used for the subsequent testAnd (5) pairing the monoclonal antibody to prepare a test strip for detection.

TABLE 3 summary of antibody pairing test results

The monoclonal antibodies C, D were designated monoclonal antibodies 3C3 and 4a1, respectively.

2.3 identification of additional characteristics of monoclonal antibodies 3C3, 4A1

Subtype: and (3) identifying the antibody subtype by using a monoclonal antibody subtype kit. As a result: the heavy chain subtypes of the monoclonal antibodies 3C3 and 4A1 are IgG2b and IgG2a, respectively, and the light chain subtypes are kappa.

Specificity: FPV, feline calicivirus FCV, feline herpesvirus FHV and cultured IFA antigen plates prepared from F81 cells were each subjected to IFA detection for determining the specificity of monoclonal antibodies. The results show that: the monoclonal antibodies 3C3 and 4A1 reacted positively only with FPV and negatively with other common viruses of feline origin, indicating that: monoclonal antibodies 3C3 and 4a1 are specific monoclonal antibodies to feline panleukopenia virus.

2.4 study of monoclonal antibody recognition proteins

The FPV nucleic acid prepared in example 1 was extracted with DNA kit as template, primers were designed based on VP1 and VP2 gene sequences published by NCBI, VP1 and VP2 gene sequences of FPV were amplified by PCR, expressed by baculovirus expression system, expressed plasmids were transfected into cells for culture, fixed with 80% cold acetone after culture, used as IFA antigen plate, and indirect immunofluorescence IFA detection was performed using monoclonal antibody as primary antibody. As a result: the monoclonal antibodies 3C3 and 4A1 only positively react with the plasmid constructed by the VP2 protein. Shows that: both monoclonal antibodies 3C3, 4a1 recognized VP2 protein of feline panleukopenia virus.

2.5 determination of the sequence of the variable regions of monoclonal antibodies 3C3, 4A1

Designing a heavy chain variable region primer sequence according to the sequence characteristics of the mouse-derived monoclonal antibody:

P1：ACTAGTCGACATGAAGWTGTGGBTRAA

P2：CCAGGGRCCARKGGATARACNGRTGG

design of light chain variable region primer sequence:

P3：ACTAGTCGACATGGAGWCAGACACACTSCT

P4：CCCAAGCTTGGATGGTGGGAAGATCCA

collecting cell supernatants of 2 monoclonal antibodies 3C3 and 4A1, extracting RNA, performing reverse transcription to serve as a template, amplifying variable region sequences of the variable region sequences by using the primers, and sending amplified products to Suzhou Jinweizhi biotechnology limited for sequencing. As a result, the protein sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody 3C3 are shown in SEQ ID No.1 and SEQ ID No.2, respectively, and the protein sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody 4A1 are shown in SEQ ID No.3 and SEQ ID No.4, respectively.

Example 3 preparation and application of test strip

3.1 preparation and detection of test strip

Heating and boiling 0.01% chloroauric acid solution, adding 1% trisodium citrate solution to prepare colloidal gold, cooling to room temperature, and recovering the volume to the original volume with distilled water to obtain the colloidal gold solution.

With 0.1mol/L K₂CO₃And (3) adjusting the pH value of the colloidal gold solution to 8.0, adding the monoclonal antibody 4A1 solution (the working concentration is 4-64 mu g/ml) into the colloidal gold solution for marking after uniform stirring, dropwise adding a proper amount of 10% BSA after stirring, and stirring at a uniform speed for 30 minutes. Standing at 2-8 ℃ for 2 hours, centrifuging at 4 ℃ at 2000 rpm for 30 minutes, dissolving the precipitate with 1/10 volume of PBS buffer solution containing 1% BSA to obtain gold-labeled monoclonal antibody 4A1, and coating the gold-labeled monoclonal antibody 4A1 by spraying or soaking to obtain a gold-labeled pad 2; and (3) spraying the monoclonal antibody 3C3 (with the coating concentration of 0.5-2.5 mg/ml) and the goat anti-mouse secondary antibody (with the coating concentration of 1-3 mg/ml) on a nitrocellulose membrane to be used as a detection line 6 and a quality control line 7 respectively. Sample pad 1, gold label pad 2, nitrocellulose membrane 3 and water absorptionThe pad 4 is stuck on the bottom plate 5, and the colloidal gold test strip for detecting the feline panleukopenia virus is obtained. The sample processing tube contains a sample processing solution.

During detection, a sample to be detected is placed in a sample processing tube, the sample is dissolved in a solution as much as possible, the head of a cover of the sample processing tube containing the sample to be detected is broken, and 2-4 drops of the uniformly mixed sample are dripped to the center of a sample adding hole of a test strip; and observing and recording results in a detection area of the detection test strip after 10 minutes, and judging according to a judgment standard. And (4) result judgment standard: the quality control line is developed, namely the test is established, the detection line is developed to be positive, and the detection line is not developed to be negative; the quality control line is not developed, namely the test is not established, and whether the detection line is developed or not is judged to be an invalid result, and the test is needed to be retested.

3.2 optimization of working concentration of monoclonal antibody in test paper strip

Test strips were prepared according to the concentrations of the immobilized antibody 3C3 and the gold-labeled antibody 4a1 in table 5, and virus solutions of different strains of FPV (wherein the antigen strain FPV Philips-Roxane strain is derived from ATCC), dilutions thereof, sample treatment solutions, and 20 clinical positive samples for PCR detection were tested. The matching mode of high test strip detection sensitivity, high PCR coincidence rate and clear background of the test sample treatment solution is selected as the optimal fixed antibody concentration and the optimal gold-labeled antibody marker concentration for preparing the colloidal gold test strip. Results (see table 4): the test strip can be prepared for detection when the concentration of the immobilized antibody is 0.5-2.5 mg/ml and the concentration of the gold-labeled antibody marker is 4-64 mu g/ml, but the test strip prepared for detection when the concentration of the immobilized antibody is 0.8-2.5 mg/ml and the concentration of the gold-labeled antibody marker is 8-50 mu g/ml has better detection effect (the sensitivity is 10)^3.5～10^4.5TCID₅₀Per ml); when the concentration of the immobilized antibody is 0.8-1.5 mg/ml and the concentration of the gold-labeled antibody marker is 12-50 mu g/ml, the detection effect of the prepared test strip is better (the sensitivity is 10)^3.5～10^4.0TCID₅₀Per ml); the test strip prepared when the concentration of the fixed antibody is 1.0mg/ml and the concentration of the gold-labeled antibody marker is 18 mu g/ml or when the concentration of the fixed antibody is 1.5mg/ml and the concentration of the gold-labeled antibody marker is 12 mu g/ml has the optimal detection effect (the sensitivity is 10)^3.5～10^4.0TCID₅₀/ml)。

TABLE 4 working concentration of monoclonal antibody in reagent strip 1

3.3 selection of sample treatment solutions

The following sample treatment solutions (see table 5) were prepared, and samples were taken for property testing, sterility testing (according to the appendix of the current pharmacopoeia of the Chinese veterinary society) and shelf life studies, the results of which are shown in table 6.

TABLE 5 summary of the components contained in the sample treatment solutions and the results of the tests

The gold-labeled monoclonal antibody 4A1 is labeled according to 12 mu g/ml, the fixed monoclonal antibody 3C3 is coated according to 1.0mg/ml, test strips are prepared when the concentration of the goat-anti-mouse secondary antibody is 1.0mg/ml, FPV virus liquid is diluted by treating with different sample treatment solutions and then detected, and after 20 clinical samples (10 cat leucopenia positive samples and 10 cat leucopenia negative samples) are treated, the detection is carried out, and the result (shown in Table 6) shows that: the kit prepared when the sample treatment solution is C7 has high sensitivity (10) for detecting FPV virus solution^3.5TCID₅₀/ml～10^4.0TCID₅₀And/ml), the consistency of the detection result of the clinical sample and the PCR detection result is higher. The kit prepared by other sample treatment solutions has low detection sensitivity, and severe false positive and false negative phenomena appear in clinical samples.

TABLE 6 detection results of different sample treatment solutions after preparation of the kit

Multiple times of debugging find that Pluronic F-68 plays a key role in a sample treatment solution, in order to evaluate the content of Pluronic F-68 in the sample treatment solution, under the condition that other components in C7 are kept unchanged, the content of Pluronic F-68 is adjusted to be 0.05%, 0.2%, 0.4%, 0.8%, 1.0% and 1.5% W/V to prepare a kit and detect the kit, and as a result, when the Pluronic F-68 contained in the sample treatment solution is 0.05%, the sensitivity of the prepared kit for detecting PDCoV is reduced, and when the Pluronic F-68 contained in the sample treatment solution is 1.5%, the prepared kit for detecting clinical samples is negative and positive, and a serious false positive and false negative phenomenon exists; when the Pluronic F-68 contained in the sample treatment solution is 0.1%, 0.4%, 0.8% or 1.0%, the detection sensitivity of the prepared kit is high, which is equivalent to C7, and the results of detecting clinical samples are all correct, so that the Pluronic F-68 content in the sample treatment solution is set to be 0.2% -1.0% W/V.

In addition, the kit comprising the test strip 1I and the sample treatment solution C7 was used for subsequent evaluation in view of cost.

3.4 application of colloidal gold test strip

3.4.1 test strip characteristic study

(1) Sensitivity of the composition

FPV was detected using the test strip according to the detection method described in example 2.2.1 (10)^5.5TCID₅₀Ml) virus solution and diluent thereof, 20 clinical samples with positive PCR detection and 20 clinical samples with negative PCR detection. The result of the detection by using the Korean Anjie feline panleukosis virus colloidal gold test strip (called Anjie FPV test strip for short) is shown in Table 4: the sensitivity of the test strip for detecting FPV is 10^3.5～10^4.0TCID₅₀The clinical sample detection rate is 95% (19/20), the negative rate is 100% (20/20), the total rate is 98%, the sensitivity is about 6 times higher than that of the corresponding virus detection liquid of the commercially available agile FPV test strip, and the clinical sample detection rate is far higher than that of the commercially available products (the positive rate is 75% (15/20), the negative rate is 100% (20/20), and the total rate is 88%).

(2) Specificity of

FPV, feline calicivirus FCV, feline herpesvirus FHV and the sample treatment solution were each detected with a test strip. As a result: the test strip can only detect FPV, and other common viruses of cat source are negative; shows that: the test paper has good specificity.

(3) Repeatability of

The sensitivity of FPV virus liquid is respectively detected by different batches of test strips and a plurality of test strips in the same batch, and the result is as follows: the sensitivity is consistent, and the color development degree of the same sample is consistent. The results of the detection of FCV, FHV and the sample treatment solution were all negative. Shows that: the test paper has good repeatability.

(4) Shelf life

And (3) carrying out sensitivity detection on the FPV virus solution by using the test paper strips stored at the temperature of 2-30 ℃ for 6, 9, 12, 24 and 27 months, and detecting FCV and FHV. As a result: the sensitivity of the FPV virus detection solution is consistent and not reduced during the storage period of the test strip; the test paper strip detects that both FCV and FHV are negative. Indicating that the test strip can be stored for 27 months.

3.4.2 clinical application

120 parts of clinical cat source clinical samples (including 68 parts of positive samples and 52 parts of negative samples) detected by FPV PCR methods all over the country are detected by test strips respectively, commercial agile FPV test strips are used for detection according to the instructions, the results are shown in Table 7, and analysis is carried out: the agile FPV test strip has high accuracy (is consistent with the specification) in detecting the excrement and the anus swab, and has low accuracy in detecting other targets; the test strip prepared by the invention can detect a plurality of targets and has higher detection accuracy, and compared with a PCR method, the test strip has the advantages that the positive coincidence rate reaches 87 percent, the total coincidence rate reaches 93 percent and is far higher than that of an agile FPV test strip.

TABLE 7 comparison of clinical test results

In conclusion, the test strip provided by the invention can detect FPV with high sensitivity, can detect a plurality of targets of cat sources, has high coincidence rate and high accuracy, and makes up for the defects of the existing commercialized products. In a word, the test strip has the advantages of rapidness, convenience and accuracy, and is convenient for clinical application in non-diagnosis-purpose feline panleukopenia virus detection, in particular to researches such as epidemiological investigation, health examination and investigation.

Example 4 preparation and application of genetically engineered antibodies

Amplifying heavy chain variable region (VH) gene and light chain variable region (VL) gene of 2 monoclonal antibodies, transferring into connecting peptide, connecting to prokaryotic expression vector pET-32a (+), respectively constructing recombinant plasmid, transforming BL21 competent cell for expression, and obtaining fusion protein. The variable region sequences of monoclonal antibodies 3C3 and 4A1 were used to prepare corresponding single-chain antibody 1 and 2, the heavy chain variable region of monoclonal antibody 3C3 and the light chain variable region of monoclonal antibody 4A1 were used to prepare single-chain antibody 3, and the heavy chain variable region of monoclonal antibody 4A1 and the light chain variable region of monoclonal antibody 3C3 were used to prepare single-chain antibody 4, respectively, as described above. HI titer and IFA titer detection were performed on the single-chain antibodies 1 to 4 according to example 2, and the results were as follows: the HI titer of the single-chain antibody 1-4 to the FPV is more than or equal to 1: 2560, and the IFA titer is more than or equal to 1: 3200, which shows that the single-chain antibody 1-4 and the FPV have good reaction characteristics.

The above results show that SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 can be used for preparing the feline panleukopenia virus genetic engineering antibody.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

SEQUENCE LISTING

<110> Luoyang Putai Biotech Ltd

<120> feline panleukopenia virus antibody, kit containing the same and use thereof

By using

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 124

<212> PRT

<213> hybridoma cell 3C3 Strain (Strain 3C3 hybridomya)

<400> 1

Asp Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Asn Leu Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Tyr Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Leu Val

35 40 45

Ala Ala Ile Asn Ser Asn Gly Gly Gly Thr His Ser Pro Asp Thr Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Glu Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg His Ala Asp Asp Gly Ser Phe Gly Leu Asn Trp Tyr Phe Asp

100 105 110

Val Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ser

115 120

<210> 2

<211> 113

<212> PRT

<213> hybridoma cell 3C3 strain (strain 3C3 hybridoma)

<400> 2

Asp Ile Val Met Ser Gln Ser Pro Ser Ser Leu Ala Val Ser Val Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Arg

20 25 30

Ser Asn Glu Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Ser Pro Lys Leu Leu Ile Tyr Trp Gly Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

65 70 75 80

Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys His Gln

85 90 95

Tyr Tyr Arg Tyr Ser Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile

100 105 110

Lys

<210> 3

<211> 119

<212> PRT

<213> hybridoma cell line 4A1 (strain 4A1 hybridomya)

<400> 3

Gln Val Gln Leu Gln Gln Pro Gly Ser Glu Leu Val Thr Phe Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Trp Ile His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Asp Ile Tyr Pro Ala Val Gly Ser Thr Asn Tyr Asn Glu Lys Phe

50 55 60

Lys Ser Lys Ala Thr Leu Thr Val Asp Thr Leu Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Lys Asp Tyr Gly Thr Ser Gly Tyr Val Phe Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Ala

115

<210> 4

<211> 107

<212> PRT

<213> hybridoma cell line 4A1 (strain 4A1 hybridomya)

<400> 4

Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Glu Thr Val Thr Ile Ala Cys Arg Ala Ser Glu Asn Ile Tyr Ser Tyr

20 25 30

Leu Glu Trp Tyr Gln Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu Val

35 40 45

Tyr Asn Ala Lys Thr Leu Ala Glu Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Gln Phe Ser Leu Lys Ile Asn Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Gly Ser Tyr Tyr Cys Gln His His Tyr Gly Ser Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Met Lys

100 105

Claims

1. An antibody, which is composed of a basic unit of an Ig monomer, wherein the Ig monomer molecule comprises four heterologous polypeptide chains, wherein two chains with larger molecular weight are heavy chains, two chains with smaller molecular weight are light chains, the amino acid composition between the two heavy chains in the same Ig molecule is identical, and the amino acid composition between the two light chains in the same Ig molecule is identical, wherein each heavy chain has a heavy chain variable region at the N-terminal, the heavy chain variable region is shown as SEQ ID No.1, each light chain has a light chain variable region at the N-terminal, and the light chain variable region is shown as SEQ ID No. 2; preferably, the antibody is IgA, IgD, IgE, IgG or IgM.

2. An antibody or fragment thereof which specifically binds to feline panleukopenia virus, wherein the heavy chain variable region of the antibody or fragment thereof is shown as SEQ ID No.1, and the light chain variable region of the antibody or fragment thereof is shown as SEQ ID No. 2; preferably, the antibody or the fragment thereof is a monoclonal antibody, a genetically engineered antibody, wherein the genetically engineered antibody comprises a single chain antibody, a chimeric monoclonal antibody, a modified monoclonal antibody or a fragment of the single chain antibody, the chimeric monoclonal antibody or the modified monoclonal antibody, and the antibody or the fragment thereof still maintains the ability to specifically bind to feline panleukopenia virus; more preferably, the antibody or fragment thereof is monoclonal antibody 3C3, the heavy chain variable region of monoclonal antibody 3C3 is shown as SEQ ID No.1, and the light chain variable region is shown as SEQ ID No. 2.

3. A hybridoma cell 3C3 strain, the hybridoma cell 3C3 strain secreting the monoclonal antibody 3C3 of claim 2.

4. An antibody, which is composed of a basic unit of an Ig monomer, wherein the Ig monomer molecule comprises four heterologous polypeptide chains, wherein two chains with larger molecular weight are heavy chains, two chains with smaller molecular weight are light chains, the amino acid composition between the two heavy chains in the same Ig molecule is identical, and the amino acid composition between the two light chains in the same Ig molecule is identical, wherein each heavy chain has a heavy chain variable region at the N-terminal, the heavy chain variable region is shown as SEQ ID No.3, each light chain has a light chain variable region at the N-terminal, and the light chain variable region is shown as SEQ ID No. 4; preferably, the antibody is IgA, IgD, IgE, IgG or IgM.

5. An antibody or fragment thereof which specifically binds to feline panleukopenia virus, wherein the heavy chain variable region of the antibody or fragment thereof is represented by SEQ ID No.3, and the light chain variable region of the antibody or fragment thereof is represented by SEQ ID No. 4; preferably, the antibody or fragment thereof is a monoclonal antibody, a genetically engineered antibody; wherein the genetically engineered antibody comprises a single chain antibody, a chimeric monoclonal antibody, a modified monoclonal antibody or a fragment of the single chain antibody, the chimeric monoclonal antibody or the modified monoclonal antibody, and the antibody or the fragment thereof still maintains the ability to specifically bind to feline panleukopenia virus; more preferably, the antibody is monoclonal antibody 4A1, the heavy chain variable region of monoclonal antibody 4A1 is shown as SEQ ID No.3, and the light chain variable region is shown as SEQ ID No. 4.

6. A hybridoma cell 4a1 strain that secretes the monoclonal antibody 4a1 of claim 5, 4a1 strain.

7. A kit comprising a feline panleukopenia virus colloidal gold test strip comprising an effective amount of the monoclonal antibody 3C3 of claim 2, an effective amount of the gold-labeled monoclonal antibody 4a1 of claim 5, or an effective amount of the monoclonal antibody 4a1 of claim 5, an effective amount of the gold-labeled monoclonal antibody 3C3 of claim 2, and a test reagent for detecting an antigen-antibody reaction of feline panleukopenia virus.

8. The kit of claim 7, wherein the test strip comprises: a bottom plate, wherein the bottom plate is provided with a first end and a second end, and a sample pad, a gold-labeled pad, a nitrocellulose membrane and a water absorption pad are sequentially arranged along the direction from the first end to the second end, and the nitrocellulose membrane is in contact with the gold-labeled pad or the sample pad and the gold-labeled pad, so that the combined body of the feline panleukopenia virus antigen and the gold-labeled monoclonal antibody 4A1 can migrate to the second end of the bottom plate; the gold label pad contains the monoclonal antibody 4A1 labeled by colloidal gold, the nitrocellulose membrane comprises a detection line and a quality control line, the monoclonal antibody 3C3 is immobilized on the detection line, and the goat anti-mouse polyclonal antibody or the goat anti-mouse secondary antibody is immobilized on the quality control line; wherein the effective amount of the monoclonal antibody 3C3 is 0.5-2.5 mg/ml, the effective amount of the monoclonal antibody 4A1 is 4-64 μ g/ml when being labeled with colloidal gold, and the goat anti-mouse polyclonal antibody or the goat anti-mouse secondary antibody is 1.0-3.0 mg/ml; preferably, adjacent parts of the sample pad, the gold-labeled pad, the nitrocellulose membrane and the absorbent pad which are arranged in sequence along the direction from the first end to the second end in the test strip are contacted with each other, and non-adjacent parts are not contacted with each other;

wherein the effective amount of the monoclonal antibody 3C3 in the test strip is 0.8-2.5 mg/ml, and the effective amount of the monoclonal antibody 4A1 is 8-50 μ g/ml when being labeled by colloidal gold; preferably, the effective amount of the monoclonal antibody 3C3 in the test strip is 0.8-1.5 mg/ml, and the effective amount of the monoclonal antibody 4A1 in the test strip is 12-50 μ g/ml when labeled with colloidal gold; more preferably, the test strip contains 1.0mg/ml of the effective amount of the monoclonal antibody 3C3, 18 μ g/ml of the effective amount of the monoclonal antibody 4a1 labeled with colloidal gold, 1.5mg/ml of the effective amount of the monoclonal antibody 3C3, 12 μ g/ml of the effective amount of the monoclonal antibody 4a1 labeled with colloidal gold, 1.0mg/ml of the effective amount of the monoclonal antibody 3C3, and 12 μ g/ml of the effective amount of the monoclonal antibody 4a1 labeled with colloidal gold;

wherein the sample processing solution is a solution containing 0.01M PBS with pH7.4, 0.5% V/V Triton X-114, 0.2-1.0% W/V Pluronic F-68 and 0.05% Proclin300, preferably a solution containing 0.01M PBS with pH7.4, 0.5% V/V Triton X-114, 0.5% W/V Pluronic F-68 and 0.05% Proclin 300;

wherein adjacent components of the sample pad, the gold-labeled pad, the nitrocellulose membrane and the absorbent pad which are sequentially arranged in the test strip along the direction from the first end to the second end are contacted with each other, and non-adjacent components are not contacted with each other; preferably, the distance between the detection line and the quality control line is more than or equal to 4 mm.

9. The kit according to claims 7-8, wherein the non-immunodiagnostic applications include epidemiological analysis, ex vivo tissue detection, epitope identification studies, feline panleukopenia virus antigen reactivity.

10. A single-chain antibody, wherein the heavy chain variable region of the single-chain antibody is shown as SEQ ID No.1 or SEQ ID No.3, and the light chain variable region of the single-chain antibody is shown as SEQ ID No.2 or SEQ ID No. 4.