CN109055590B - Primer and method for qualitatively detecting streptococcus thermophilus - Google Patents
Primer and method for qualitatively detecting streptococcus thermophilus Download PDFInfo
- Publication number
- CN109055590B CN109055590B CN201811179187.0A CN201811179187A CN109055590B CN 109055590 B CN109055590 B CN 109055590B CN 201811179187 A CN201811179187 A CN 201811179187A CN 109055590 B CN109055590 B CN 109055590B
- Authority
- CN
- China
- Prior art keywords
- streptococcus thermophilus
- primer
- kit
- pcr
- 1min
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application provides a specific primer for qualitatively detecting Streptococcus thermophilus S10(Streptococcus thermophilus S10) and a method for qualitatively detecting Streptococcus thermophilus S10 by using the primer, wherein the microorganism preservation number of the Streptococcus thermophilus S10 is CGMCC No.16129, and the sequence of an upstream primer in the specific primer is shown as SEQ No. 1; the sequence of the downstream primer S10R is shown in SEQ No.2, the primer provided by the application has good specificity, high sensitivity, good stability and good repeatability, and the target strain S10 of the specific primer is used for PCR analysis, so that the rapid and accurate qualitative detection of the Streptococcus thermophilus S10 is realized, and particularly the qualitative detection of the Streptococcus thermophilus S10 in the fermented dairy product is realized.
Description
Technical Field
The application belongs to the technical field of genetic engineering, and particularly relates to a primer, a kit and a qualitative detection method for qualitatively detecting streptococcus thermophilus S10.
Background
Streptococcus thermophilus (Streptococcus thermophilus) is a lactic acid bacterium with low GC content (GC content means the ratio of guanine and cytosine in 4 bases of DNA), facultative anaerobic property, catalase negative property, no spore formation, gram-positive non-pathogenic property and homofermentation. Streptococcus thermophilus is a well-recognized safety (GRAS) strain, is widely applied to the industrial production of some important fermented dairy products, is the second important industrial lactic acid bacteria after lactococcus lactis, and has the market value of about $ 400 billion. Streptococcus thermophilus is often used widely together with Lactobacillus bulgaricus as a starter in the industrial production of yoghurt, cheese and other dairy products.
The streptococcus thermophilus has the characteristics of acidification capability, proteolytic enzyme activity, rapid growth, capability of generating extracellular polysaccharide, bacteriocin, flavor substances, bacteriophage resistance and the like, and directly or indirectly influences the quality of the fermented milk, wherein the acidification capability, the proteolytic enzyme activity, the generation capability of the extracellular polysaccharide and the flavor substances are key characteristics for screening production strains.
The streptococcus thermophilus S10 is a lactic acid bacterium with excellent fermentation performance separated from the traditional fermented dairy products in China. The acid production rate of the streptococcus thermophilus S10 is high, and the pH of the fermented milk can reach 4.6 after 7 hours of fermentation. The streptococcus thermophilus S10 has excellent fermentation performance and is suitable for being used as a starter in industry.
Streptococcus thermophilus includes more than thousands of specific strains, so a method for qualitatively detecting whether a fermented product contains the streptococcus thermophilus S10 strain is needed.
Disclosure of Invention
The application aims to provide a primer and a method for qualitatively detecting streptococcus thermophilus S10, so that whether a fermented product contains streptococcus thermophilus S10 can be rapidly and qualitatively detected by taking the fermented product as a sample.
The purpose of the application is realized by the following technical scheme:
the Streptococcus thermophilus S10(Streptococcus thermophilus S10) is separated from traditional fermented dairy products in China, and is specifically obtained by separation and screening through the following method:
streptococcus thermophilus S10(Streptococcus thermophilus S10) is separated from natural fermented sour milk of Qinghai in China, separated by TPY selective medium, and obtained by picking single strain and expanding.
This strain is deposited by the agency of patent approval for the deposit of microorganisms having the following accession numbers: CGMCC No. 16129; the classification is named as: streptococcus thermophilus (Streptococcus thermophilus S10); the preservation unit: china general microbiological culture Collection center (national patent office assigned patent microbiological Collection center); preservation time: 7 month 17, 2018; and (4) storage address: western road No.1 institute 3, institute of microbiology, china academy of sciences, north chen, chaoyang, china.
S10 of Streptococcus thermophilus (Streptococcus thermophilus) isolated in the present application has the following biological properties: streptococcus thermophilus (Streptococcus thermophilus) is a gram-positive bacterium belonging to the genus Streptococcus. The cells are arranged in a round or oval shape and in a chain shape, have no spores and flagella, are 0.7-1.1 mu m long and 0.6-0.9 mu m wide, appear in pairs or short chains, and are optimally grown at the temperature of 38-43 ℃ and the pH value of 6.0-7.0.
The fermentation method of the streptococcus thermophilus S10 comprises the following steps: inoculating Streptococcus thermophilus (Streptococcus thermophilus S10) into M17 liquid medium, culturing at 42 deg.C for 24 hr, subculturing for 3 generations, recovering strain activity, and diluting the bacterial liquid by 10 times to obtain 10-1～10-7Dilution gradient, pipetting 200. mu.L of 10-4、10-5、10-6、10-7Uniformly coating the gradient diluent in an M17 solid culture medium plate, performing anaerobic culture at 42 ℃ for 24h, selecting monoclonals with different shapes, sizes and colors, inoculating the monoclonals in a liquid culture medium, performing culture in a constant-temperature anaerobic incubator at 37 ℃ for 24h, performing gram staining and microscopic examination after the strains grow well, and storing the isolates.
The specific primers for qualitatively detecting the streptococcus thermophilus S10, which are provided by the application, specifically design a pair of PCR primers having a specific amplification effect on the streptococcus thermophilus S10 according to the gene sequence characteristics of the streptococcus thermophilus S10, namely, specific molecular detection primers, wherein the specific primers comprise an upstream primer S10F and a downstream primer S10R, or are complementary strand sequences of the upstream primer S10F/the downstream primer S10R, and the sequence of the upstream primer S10F is shown as SEQ No. 1; the sequence of the downstream primer S10R is shown in SEQ No.2, specifically,
upstream primer S10F: 5'-ATGTTTGAACGAACTACCAAGAT-3', respectively;
downstream primer S10R: 5'-TCACTAACTGTTCTCCCTGTCTC-3' are provided.
Further, the microorganism preservation number of the streptococcus thermophilus S10 is CGMCC No. 16129.
The application also provides application of the specific primer in preparing a kit for PCR qualitative detection of S10.
The application also provides a kit for PCR qualitative detection of S10, which comprises the specific primer.
Further, the kit further comprises: standard substance, specific primer and PCR system.
Optionally, the working procedure is denaturation at 95 ℃ for 5 min; denaturation at 95 deg.C for 1min, annealing at 58 deg.C for 45s, extension at 72 deg.C for 1min, and circulating for 30 times; finally, extension is carried out for 7min at 72 ℃ and storage is carried out at 4 ℃.
The application also provides application of the specific primer or the kit in a fluorescent PCR method for qualitatively detecting the streptococcus thermophilus S10.
The present application also provides a method for qualitatively detecting streptococcus thermophilus S10, comprising:
and 3, carrying out gel electrophoresis detection on the PCR amplification product prepared in the step 2, wherein the conditions of the gel electrophoresis are as follows: the voltage is 5V/cm, the electrophoresis time is 20-30min, and the position of the characteristic band is about 298 bp.
The specific primer provided by the application is based on a section of specific fragment in the whole genome sequence of Streptococcus thermophilus S10, the specific primer for the Streptococcus thermophilus is designed, the specificity is good, the sensitivity is high, the stability is good, the repeatability is good, the specific primer is used for carrying out PCR analysis on the target strain Streptococcus thermophilus S10, and therefore the rapid and accurate qualitative detection of Streptococcus thermophilus S10 is achieved, and particularly the qualitative detection of Streptococcus thermophilus S10 in a fermented dairy product is achieved.
Drawings
FIG. 1: s10 specific primer specific test of Streptococcus thermophilus (Streptococcus thermophilus);
FIG. 2: s10 specific amplified bands for 4 samples of Streptococcus thermophilus (Streptococcus thermophilus), band 1 was the S10 fermented dairy sample, band 2 was the positive control, band 3 was the negative control, and band 4 was the non-S10 fermented dairy sample.
Detailed Description
The present application is further described below with reference to the following figures and examples, which are illustrative only and the present application is not limited to these examples.
Example 1 extraction of metagenomic DNA in fermented Dairy product samples
Washing 1.0g of sample, placing the washed thallus in a 1.5mL centrifuge tube, immediately placing the thallus in liquid nitrogen for complete freezing, taking out the thallus, placing the thallus in a 65 ℃ water bath for 5min, repeatedly freezing and thawing for 3 times, adding 0.1mL of SDS and 10.0 mu L of 10mg/mL proteinase K, shaking for 2h in a constant temperature shaking table at 37 ℃ at 200r/min, centrifuging for 10min at the room temperature of 12000 Xg, collecting supernatant, transferring the supernatant into another centrifuge tube, centrifuging the supernatant and isometric chloroform for 10min at 12000 Xg, absorbing the supernatant, transferring the supernatant into another centrifuge tube for phenol chloroform extraction for 2 times, precipitating total DNA by 0.1-time volume of glacial isopropyl acid, washing and precipitating twice by 70% ethanol, and re-dissolving for later use.
Example 2 detection of S10 specificity of primers for Streptococcus thermophilus (Streptococcus thermophilus)
Based on a specific fragment in the whole genome sequence of S10 of Streptococcus thermophilus (Streptococcus thermophilus), the following primer sequences are designed:
S10R：TCACTAACTGTTCTCCCTGTCTC；
S10F：ATGTTTGAACGAACTACCAAGAT。
after designing a Streptococcus thermophilus S10 specific primer, the specificity of the primer was verified, and 20 Streptococcus thermophilus strains (excluding Streptococcus thermophilus S (Streptococcus thermophilus) S10) which have high homology with Streptococcus thermophilus (Streptococcus thermophilus) ST10 in taxonomic position and good fermentability were selected and subjected to PCR amplification as controls.
The species used as controls were purchased from ATCC, JSM or DSM strain resource pools, and the numbering in the corresponding strain resource pools was, in order, (1) Streptococcus thermophiles ATCC19258T、(2)Streptococcus thoraltensis ATCC700865T、(3)Streptococcus tigurinus DSM24864T、(4)Streptococcus suis ATCC43765T、(5)Streptococcus sobrinus ATCC33478T、(6)Streptococcus sinensis DSM14990T、(7)Streptococcus shiloi ATCC51499T、(8)Streptococcus sanguinis ATCC10556T、(9)Streptococcus saliviloxodontae JSM19288T、(10)Streptococcus salivarius ATCC7073T、(11)Streptococcus saccharolyticus ATCC43076T、(12)Bacteroides fragilis JCM 11019T、(13)Bifidobacterium animalis DSM 10140、(14)Bifidobacterium breve ATCC 15700、(15)Bifidobacterium longum ATCC 15697、(16)Clostridium coccoides JCM 1395T、(17)Enterococcus faecalis ATCC 19433T(18) Enterococcus faecalis ATCC 19434, (19) Escherichia coli JCM 1649 and (20) Lactobacillus acidophilus ATCC 4356TIn total, 20 strains were subjected to PCR amplification and alignment analysis.
An amplification system:
reaction system 50 μ L: 10 XPCR mix10 uL, 10mol/L upstream and downstream primers 0.4 uL each, DNA template 100ng, ddH2O is supplemented to 20 mu L;
amplification conditions:
denaturation at 95 deg.C for 5 min; denaturation at 95 deg.C for 1min, annealing at 58 deg.C for 45s, extension at 72 deg.C for 1min, and circulating for 30 times; finally, extension is carried out for 7min at 72 ℃ and storage is carried out at 4 ℃.
Performing electrophoresis on the PCR product and 1% agarose gel at a voltage of 5V/cm for 20-30min, dyeing, performing ultraviolet photography, and detecting the amplification effect; wherein the positive control using the DNA of S10 strain containing the desired amplified fragment as a template and the negative control using sterilized water as a template are used to qualitatively determine whether the sample contains S10S in accordance with the presence or absence of the expected characteristic band at 298bp, as shown in FIG. 1, wherein H is used2O as a negative control.
The analysis result shows that the primer can only amplify S10 of Streptococcus thermophilus (Streptococcus thermophilus) and can not amplify the other 20 strains of Streptococcus thermophilus.
The comparison amplification experiment shows that the primer designed by the invention has good specificity.
Example 3 qualitative detection of Streptococcus thermophilus S10
1. Extraction of metagenomic DNA from fermented dairy product samples
A yogurt sample fermented by Streptococcus thermophilus (Streptococcus thermophilus) S10 is used as a sample 1 to be tested, and yogurt fermented by other Streptococcus thermophilus is used as a sample 2 to be tested.
Adopting a liquid nitrogen freeze thawing-CTAB method: washing 1.0g of sample, putting the eluted thallus into a 1.5mL centrifuge tube, immediately putting the centrifuge tube into liquid nitrogen for complete freezing, taking out the thallus, putting the thallus into a 65 ℃ water bath for thawing (about 5min), repeatedly freezing and thawing for 3 times, adding 0.1mL 10% SDS and 10.0 mu L10 mg/mL proteinase K, shaking the thallus in a 37 ℃ constant temperature shaking table at 200r/min for 2h, centrifuging the thallus at room temperature for 10min at 10000g, and collecting supernatant and transferring the supernatant into another centrifuge tube. Centrifuging the supernatant with equal volume of chloroform at 10000g for 10min (to separate the precipitate, aqueous phase and organic phase), sucking the supernatant and transferring to another centrifuge tube to perform phenol chloroform extraction for 2 times, precipitating total DNA with 0.1 times volume of sodium acetate and 1 time volume of ice isopropanol, washing the precipitate with 70% ethanol for 2 times, and re-dissolving for later use.
2. S10 specific primer of Streptococcus thermophilus (Streptococcus thermophilus) is specifically amplified.
2.1 amplification System:
reaction system 50 μ L: 10 XPCRmix 10. mu.L, 10mol/L upstream and downstream primers 0.4. mu.L each, DNA template 100ng, ddH2O to 20. mu.L;
2.2 amplification conditions:
denaturation at 95 deg.C for 5 min; denaturation at 95 deg.C for 1min, annealing at 58 deg.C for 45s, extension at 72 deg.C for 1min, and circulating for 30 times; finally, extension is carried out for 7min at 72 ℃ and storage is carried out at 4 ℃.
2.3 primer sequence:
S10R：TCACTAACTGTTCTCCCTGTCTC；
S10F：ATGTTTGAACGAACTACCAAGAT。
3. agarose gel electrophoresis
Performing electrophoresis on the PCR product and 1% agarose gel at a voltage of 5V/cm for 20-30min, dyeing, performing ultraviolet photography, and detecting the amplification effect; wherein the presence or absence of S10 in the sample is determined based on the presence or absence of a band of the expected characteristics at 298bp, using the DNA of S10 strain, which contains the desired amplified fragment, as a positive control for the template, and sterilized water as a negative control for the template.
As shown in FIG. 2, it can be seen from FIG. 2 that sample 1 is sample 1 to be tested, sample 2 is a positive control using a strain DNA containing a target amplified fragment as a template, sample 3 is a negative control using sterilized water as a template, and sample 4 is sample 2 to be tested. As can be seen from FIG. 2, the positive control amplified a clear and bright target band, while the negative control did not have the corresponding amplification product.
Sample 1 (sample 1 to be tested) contained S10 and sample 4 (sample 2) contained no S10.
The present application has been described in detail with reference to specific embodiments and illustrative examples, but the description is not intended to limit the application. Those skilled in the art will appreciate that various equivalent substitutions, modifications or improvements may be made to the presently disclosed embodiments and implementations thereof without departing from the spirit and scope of the present disclosure, and these fall within the scope of the present disclosure. The protection scope of this application is subject to the appended claims.
Sequence listing
<110> Beijing Ke Tuhentong Biotechnology Ltd
<120> primer and method for qualitatively detecting streptococcus thermophilus
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2629
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
acaccgaaga acattcataa tctacttcta aagaagcaca agtaatctgg atgaaggcct 60
tcaaaaacta agtaggtcgt cagcctcttc ctgaggaatt tcttataggt aggtcttcag 120
gttatgatgt gtcgatcatc tatcagttta tctcatatgg taaggctgct aaactggcca 180
atccagccat ggcaaaagga aagaaaatcc tgattattgc tggtattgtt gtggtagtct 240
tagcgcttgc tggttatgga tttggttttt attattactc acgtggtcaa gtagcagatc 300
gttatgaagc agcaacttat ggtaagtttg atagttatgc ctcaaatcat aacacaacac 360
cagatggtgt atccgacatt ttccttaatg gtactgatga taccatgtac aaggatgtaa 420
cggctgatat tgatagaaat actacgggtg ctaaaaaccg tgccgctgat agtattactt 480
tctcggacgt tgacgtcaca gaagtcgttc agactggtga gaagaccttc aaggtgacct 540
tcactgcagt ttatgatttc tactatggtt ataattcgaa attcaagtca tcaggagata 600
ttaaagacaa aatttcatgg tcatgtaatg tggaatatgt tggtgacgat agtgactcta 660
gtggtagcag ttctaactac agcgactacc atatcaatgg taaagctatc gaatcacaaa 720
aagtgagtcg tgaagatact gtgaaatagt agttgttttc tcatagagct agtcattgtt 780
aaactgatta caattaggag ggtagtcctc tctactaaaa atgagagcct ggtaattgcc 840
aggttctttt gtttgtctgt ttttacctct tagggtctaa actttaccac ttacctaaaa 900
ggccttgttt agtttaaagc agctgttata atagaagaac catcaaaagg acaggaaagg 960
agtattatga aagttagaat cgaattggac ccatccatgg atgagcctga aatcttgatt 1020
cgagctcctc ggttaacaca ggaattggcc cagctccaag aatctattct aaagaaaaag 1080
ttagttcctt tagcctttta caaggatcga agcgaatatt ttctggattt ggcaaatatt 1140
ctcttttttg aaacagacgg ggaaaagatt tttggacata ccaaggatga ggcctatgag 1200
gtgaagcaaa agctctacga attagaagag ttgctcccga ttgccttttg tcggatttcc 1260
aaatcgacga ttgttaatgc taagcagatt tattctttag agaagtcttt ttcggggact 1320
agtacggtga atttctatca gacccacaag caggtccatg tatcaagacg ctactatcaa 1380
gttttaaaag aacgactaaa cgaaatgagg taagataatg agaaagaaat taattgggat 1440
cctcttgatc cttttggcag ctttggtaat tgtacaagac tattttataa aatgggaaat 1500
tagtatttgg atgttggcct gggtagtctt attggcaatt ttgtcccttt ctagtctttt 1560
gaagcgacat tttggtcttg gtttcgccta tggcattgtg gctctatttt cacttaatgg 1620
acagttccat tttcttccag tatctaactc ggtccttatc ttctcttcca ttcttgcagt 1680
tattggcttg aacattctct tcaattcttc tagtaaaaca aagaatcgct ttggactggg 1740
ttctactggc tcagacgcta ataatggtgg aaatgatatt gatgtcactt tttcagtagt 1800
gaccaaatat ctcaatgacc agcaatttac acatgggagt gcggatgtta gtttaggaca 1860
ggcttccgtt tattttgata attgccgtat tgaggggcca tctgctcagt ttgatgtgga 1920
cgtttctctt ggaagtctta gcctctatgt gcccagtgat tggcgggtgc atgtgaatgt 1980
ggataactct ctttcagctg tacagcatga ggaaaatcct agcaacttaa ctaacaagga 2040
cttctacatc aaaggtgatg tttccttggg taatttagaa attatttatg ttggtgagag 2100
ttcgattgat taagttagtg tagggaacct ctgattaata taatacctat tgttttatct 2160
caatccctgt gataagatag gctcaatcta ttttcaagag ggacaagagc tctgggattc 2220
ctaacgtcat caagtctttt aaatcaacta atactcgagg gagtaggaca agggagagtt 2280
tttgaaaagc tgttcggtat cactctcttt tttcctacta gaacaggaat taatttttaa 2340
ataaagttgt ggtgctaaat cttttgattt ggttcttttt ttggctagag gaccagatat 2400
tttgggcttt tcctgtagga gataagctta tgcctggccc ataggccaga gggctagaaa 2460
gggatgaggg aggagtctga ttgtttgtta attctgtgtt ataatagcaa ggattagtgg 2520
ttgttagtgc taagtgaatg gaaattcttg cttagtccga cttagtccga acgactggtg 2580
tagagacaag aaagggacgt cttatgaaat tactttatac ggatatgtc 2629
Claims (8)
1. Specific primers for qualitatively detecting streptococcus thermophilus S10, wherein the specific primers comprise an upstream primer S10F and a downstream primer S10R or are complementary strand sequences of the upstream primer S10F/the downstream primer S10R, and the sequence of the upstream primer S10F is 5'-ATGTTTGAACGAACTACCAAGAT-3'; the sequence of the downstream primer S10R is 5'-TCACTAACTGTTCTCCCTGTCTC-3', wherein the microorganism preservation number of the streptococcus thermophilus S10 is CGMCC No. 16129.
2. Use of the specific primers of claim 1 for preparing a kit for PCR qualitative detection of S10.
3. A kit for PCR qualitative detection of S10, characterized in that it comprises the specific primers of claim 1.
4. The kit of claim 3, further comprising: standard substance, specific primer and PCR system.
5. The kit according to claim 3 or 4, characterized in that the working procedure is denaturation at 95 ℃ for 5 min; denaturation at 95 deg.C for 1min, annealing at 58 deg.C for 45s, extension at 72 deg.C for 1min, and circulating for 30 times; finally, extension was carried out at 72 ℃ for 7 min.
6. Use of the specific primers according to claim 1 or the kit according to claim 3 in a fluorescent PCR method for the qualitative detection of S10S.
7. A method for qualitatively detecting streptococcus thermophilus S10, comprising:
step 1, extracting DNA fragments of all bacteria in a sample to be detected as template DNA for further amplification;
step 2, performing PCR amplification by using the template DNA prepared in the step 1 by using the specific primer in the claim 1;
and 3, carrying out gel electrophoresis detection on the PCR amplification product prepared in the step 2.
8. The method of claim 7,
extracting DNA of all bacteria by using a CTAB method or a kit method in the step 1 to be used as template DNA; and/or
In step 2, the conditions for PCR amplification are as follows: denaturation at 95 deg.C for 5 min; denaturation at 95 deg.C for 1min, annealing at 58 deg.C for 45s, extension at 72 deg.C for 1min, and circulating for 30 times; finally, extending for 7min at 72 ℃, and storing at 4 ℃; and/or
In step 3, the conditions of gel electrophoresis are as follows: the voltage is 5V/cm, the electrophoresis time is 20-30min, and the position of the characteristic band is about 298 bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811179187.0A CN109055590B (en) | 2018-10-10 | 2018-10-10 | Primer and method for qualitatively detecting streptococcus thermophilus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811179187.0A CN109055590B (en) | 2018-10-10 | 2018-10-10 | Primer and method for qualitatively detecting streptococcus thermophilus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055590A CN109055590A (en) | 2018-12-21 |
| CN109055590B true CN109055590B (en) | 2022-03-01 |
Family
ID=64763673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811179187.0A Active CN109055590B (en) | 2018-10-10 | 2018-10-10 | Primer and method for qualitatively detecting streptococcus thermophilus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055590B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005245395A (en) * | 2004-03-08 | 2005-09-15 | Ehime Prefecture | Anti-streptococcus thermophilus monoclonal antibody, cells producing the same, detection method and detecting reagent for streptococcus thermophilus |
-
2018
- 2018-10-10 CN CN201811179187.0A patent/CN109055590B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005245395A (en) * | 2004-03-08 | 2005-09-15 | Ehime Prefecture | Anti-streptococcus thermophilus monoclonal antibody, cells producing the same, detection method and detecting reagent for streptococcus thermophilus |
Non-Patent Citations (3)
| Title |
|---|
| LEE, M.等.Production of the Isoflavone Aglycone and Antioxidant Activities in Black Soymilk Using Fermentation with Streptococcus thermophilus S10.《Food Sci. Biotechnol.》.2015,第24卷(第2期),第537页摘要，第538页右栏第2段. * |
| Production of Sesaminol and Antioxidative Activity of Fermented Sesame with Lactobacillus plantarum P8, Lactobacillus acidophilus ATCC 4356, Streptococcus thermophilus S10;BAE，J.J.等;《Food Sci. Biotechnol.》;20160229;第25卷(第1期);第199-204页 * |
| Production of the Isoflavone Aglycone and Antioxidant Activities in Black Soymilk Using Fermentation with Streptococcus thermophilus S10;LEE, M.等;《Food Sci. Biotechnol.》;20150430;第24卷(第2期);第537页摘要，第538页右栏第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055590A (en) | 2018-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mainville et al. | Polyphasic characterization of the lactic acid bacteria in kefir | |
| Ercolini et al. | Behavior of variable V3 region from 16S rDNA of lactic acid bacteria in denaturing gradient gel electrophoresis | |
| Masco et al. | Culture-dependent and culture-independent qualitative analysis of probiotic products claimed to contain bifidobacteria | |
| Cocconcelli et al. | Use of RAPD and 16S rDNA sequencing for the study of Lactobacillus population dynamics in natural whey culture | |
| Dal Bello et al. | Increased complexity of the species composition of lactic acid bacteria in human feces revealed by alternative incubation condition | |
| El-Baradei et al. | Bacterial biodiversity of traditional Zabady fermented milk | |
| TAŞ et al. | Identification of microbial flora in kefir grains produced in Turkey using PCR | |
| Madoroba et al. | Diversity and dynamics of bacterial populations during spontaneous sorghum fermentations used to produce ting, a South African food | |
| Hao et al. | Identification of the bacterial biodiversity in koumiss by denaturing gradient gel electrophoresis and species-specific polymerase chain reaction | |
| CN105713853A (en) | Lactic Bacterium For Texturizing Food Products Selected On Basis Of Phage Resistance | |
| Ongol et al. | Main microorganisms involved in the fermentation of Ugandan ghee | |
| Machielsen et al. | Molecular description and industrial potential of Tn 6098 conjugative transfer conferring alpha-Galactoside metabolism in Lactococcus lactis | |
| US8741622B2 (en) | Stress tolerant Bifidobacteria | |
| CN113564272B (en) | Rapid identification and detection method for cheese lactobacillus in fermented milk | |
| CN108220219B (en) | Lactobacillus plantarum food-grade expression system and application thereof in heterologous protein expression | |
| CN109468397B (en) | Gene for specifically detecting lactococcus lactis strain IMAU11823 and primer pair, kit and method for amplification of gene | |
| Hassanzadazar et al. | Identification and molecular characterisation of lactobacilli isolated from traditional Koopeh cheese | |
| Ninane et al. | Identification of lactic acid bacteria within the consortium of a kefir grain by sequencing 16S rDNA variable regions | |
| CN109055590B (en) | Primer and method for qualitatively detecting streptococcus thermophilus | |
| RoushanZadeh et al. | Phenotypic and genotypic diversity of dominant lactic acid bacteria isolated from traditional yoghurts produced by tribes of Iran | |
| Zhang et al. | Isolation and identification of dominant microorganisms involved in naturally fermented goat milk in Haixi region of Qinghai, China | |
| Jafari et al. | Molecular characterization of isolated lactic acid bacteria from different traditional dairy products of tribes in the Fars Province, Iran. | |
| Flint et al. | Development of a strain-specific assay for detection of viable Lactobacillus sp. HOFG1 after application to cattle feed | |
| Jeong et al. | Characterization of pFMBL1, a small cryptic plasmid isolated from Leuconostoc mesenteroides SY2 | |
| Markiewicz et al. | Identification of Lactobacillus and Bifidobacterium species with PCR applied to quality control of fermented dairy beverages. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230423 Address after: No. 1, Yard 31, Mangniuhe Road, Yanqi Economic Development Zone, Huairou District, Beijing 101408 Patentee after: Beijing Dadihaiteng Industry and Trade Co.,Ltd. Address before: 101407 No.1-2, yard 31, yiniuhe Road, Yanqi Economic Development Zone, Huairou District, Beijing Patentee before: BEIJING SCITOP BIO-TECH CO.,LTD. |
|
| TR01 | Transfer of patent right |