CN109055590A - A kind of primer and method of qualitative detection streptococcus thermophilus - Google Patents
A kind of primer and method of qualitative detection streptococcus thermophilus Download PDFInfo
- Publication number
- CN109055590A CN109055590A CN201811179187.0A CN201811179187A CN109055590A CN 109055590 A CN109055590 A CN 109055590A CN 201811179187 A CN201811179187 A CN 201811179187A CN 109055590 A CN109055590 A CN 109055590A
- Authority
- CN
- China
- Prior art keywords
- streptococcus thermophilus
- primer
- specific primer
- kit
- qualitative detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application provides a kind of specific primer for qualitative detection streptococcus thermophilus S10 (Streptococcus thermophilus S10) and the method using primer qualitative detection streptococcus thermophilus S10, the microbial preservation number of the streptococcus thermophilus S10 is CGMCC No.16129, shown in the sequence SEQ No.1 of the specific primer middle and upper reaches primer;The sequence of downstream primer S10R is as shown in SEQ No.2, primer specificity provided by the present application is good, high sensitivity, stability are good, reproducible, PCR analysis is carried out using specific primer purpose strain streptococcus thermophilus S10, to realize to streptococcus thermophilus S10 rapidly and accurately qualitative detection, the especially qualitative detection to streptococcus thermophilus S10 in fermented dairy product.
Description
Technical field
The application belongs to gene engineering technology field, in particular to a kind of primer of qualitative detection streptococcus thermophilus S10, examination
Agent box and qualitative checking method.
Background technique
Streptococcus thermophilus (Streptococcus thermophilus) is that (G/C content refers in DNA for a kind of low G/C content
4 kinds of bases in, ratio shared by guanine and cytimidine), amphimicrobian, negative catalase, not form gemma, leather blue
Albert'stain Albert positive non-pathogenic, homo-fermentative lactic acid bacteria.Streptococcus thermophilus is " generally recognized as safe (GRAS) " bacterial strain, extensive
It is second important industry cream after Lactococcus lactis in industrial production applied to some important fermented dairy products
Sour bacterium, about 40,000,000,000 dollars of market value.Streptococcus thermophilus is often widely used in lactobacillus bulgaricus together as leavening
In the industrial production of Yoghourt, cheese and other dairy products.
Streptococcus thermophilus has souring ability, and hydrolase of proteolysis increases quickly, can generate exocellular polysaccharide, bacterium
The features such as element, flavor substance and antiphagin, the quality of acidified milk is directly or indirectly affected, wherein souring ability, albumen water
The generation ability of solution enzymatic activity, exocellular polysaccharide and flavor substance is the key characteristic of screening production bacterial strain.
Streptococcus thermophilus S10, which is one plant, is isolated from the lactic acid bacteria that fermenting property is excellent in China's traditional zymotic dairy product.It is thermophilic
Hot streptococcus S10 rate of producing acid is very fast, and fermentation can make the pH of acidified milk reach 4.6 for 7 hours.The fermentation of streptococcus thermophilus S10
It has excellent performance, is suitable as leavening in industrial application.
Streptococcus thermophilus includes up to thousand plants or more of specific bacterial strain, therefore, is needed in a kind of qualitative detection fermented product
Whether the method containing streptococcus thermophilus S10 bacterial strain.
Summary of the invention
The purpose of the application is to provide the primer and method of a kind of qualitative detection streptococcus thermophilus S10, so as to hair
Ferment product is whether to contain streptococcus thermophilus S10 in sample fast qualitative detection fermented product.
The purpose of the application is achieved by the following technical solution:
Herein described streptococcus thermophilus S10 (Streptococcus thermophilus S10) is isolated from China's tradition
Fermented dairy product, specifically separation screening obtains by the following method:
Streptococcus thermophilus S10 (Streptococcus thermophilus S10) is isolated from China Qinghai natural fermented sourdough
It in cow's milk, is separated by TPY selective medium, is matched by the single bacterial strain expansion of picking and obtained.
The mechanism that the bacterial strain is submitted patent to approve by the application carries out preservation, microbial preservation number are as follows: CGMCC
No.16129;Classification naming are as follows: streptococcus thermophilus Streptococcus thermophilus (Streptococcus
thermophilus S10);Depositary institution: China Committee for Culture Collection of Microorganisms's General Microbiological Culture collection
(State Patent Office specifies patent Organism Depositary);The preservation time: on July 17th, 2018;Preservation address: city of BeiJing, China
The institute 3 of Chaoyang District North Star West Road 1, Institute of Microorganism, Academia Sinica.
The separated streptococcus thermophilus of the application (Streptococcus thermophilus) S10 has following biology
Characteristic: streptococcus thermophilus (Streptococcus thermophilus) is under the jurisdiction of streptococcus, gram-positive bacteria.Cell shape
State is presented spheroidal or ellipse, catenation, and without gemma atrichia, 0.7~1.1 μm long, 0.6~0.9 μm wide, at
Right or short chain occurs, and optimum growing condition is 38~43 DEG C, pH6.0~7.0.
The fermentation process of the streptococcus thermophilus S10 includes: by streptococcus thermophilus (Streptococcus
Thermophilus S10) it is linked into M17 fluid nutrient medium, for 24 hours, in 3 generation of squamous subculture, restores bacterial strain vigor, right for 42 DEG C of cultures
Bacterium solution carries out 10 doubling dilutions, obtains 10-1~10-7Dilution gradient draws the 10 of 200 μ L respectively-4、10-5、10-6、10-7Gradient
Dilution is spread evenly across in M17 solid medium plate, and for 24 hours, picking form, size, color are different for 42 DEG C of Anaerobic culturels
Monoclonal is inoculated in fluid nutrient medium, is cultivated for 24 hours in 37 DEG C of constant-temperatureanaerobic anaerobic incubators, after strain growth is good, is carried out
Gram's staining, microscopy save separation strains.
Specific primer provided by the present application for qualitative detection streptococcus thermophilus S10, the specific primer according to
The gene order characteristic of streptococcus thermophilus S10, specific designs have a pair of specific amplified effect to streptococcus thermophilus S10
PCR primer, that is, special molecular detection primer, the specific primer include upstream primer S10F and downstream primer S10R, or
For the complementary strand sequence of the upstream primer S10F/ downstream primer S10R, wherein the sequence of upstream primer S10F such as SEQ No.1
It is shown;The sequence of downstream primer S10R is as shown in SEQ No.2, specifically,
Upstream primer S10F:5 '-ATGTTTGAACGAACTACCAAGAT-3 ';
Downstream primer S10R:5 '-TCACTAACTGTTCTCCCTGTCTC-3 '.
Further, the microbial preservation number of the streptococcus thermophilus S10 is CGMCC No.16129.
The application also provides aforementioned specific primer in the kit for preparing PCR qualitative detection streptococcus thermophilus S10
Using.
The application also provides a kind of kit for PCR qualitative detection streptococcus thermophilus S10, before the kit includes
The specific primer stated.
Further, the kit further include: standard items, specific primer and PCR system.
Optionally, working procedure is 95 DEG C of denaturation 5min;95 DEG C of denaturation 1min, 58 DEG C of annealing 45s, 72 DEG C extend
1min is recycled 30 times;Last 72 DEG C of extensions 7min, 4 DEG C of preservations.
It is thermophilic to qualitative detection in fluorescence PCR method that the application also provides specific primer or kit above-mentioned
The application of streptococcus S10.
The application also provides the method for qualitative detection streptococcus thermophilus S10 a kind of, which comprises
Step 1, the germy DNA of institute is extracted from sample to be tested, as the template DNA further expanded, wherein mention
Take the total DNA of bacterial strain method and reagent well known to a person skilled in the art, such as can using CTAB method or kit etc. come
DNA is extracted as template DNA;Wherein, the kit can be any one DNA of bacteria extracts kit.
Step 2, PCR amplification is carried out using template DNA made from specific primer step 1 described in claim 1, wherein
The condition of PCR amplification are as follows: 95 DEG C of denaturation 5min;95 DEG C of denaturation 1min, 58 DEG C of annealing 45s, 72 DEG C of extension 1min are recycled 30 times;
Last 72 DEG C of extensions 7min, 4 DEG C of preservations;
Step 3, detected through gel electrophoresis is carried out to pcr amplification product made from step 2, wherein the condition of gel electrophoresis are as follows:
Voltage is 5V/cm, and electrophoresis time 20-30min, the position of characteristic bands is about at 298bp.
Specific primer provided by the present application is complete with streptococcus thermophilus (Streptococcus thermophilus) S10's
One section of specific segment is foundation in genome sequence, and design is directed to the specific primer of the bacterium, specific good, sensitivity
Height, stability are good, reproducible, carry out PCR analysis using specific primer purpose strain streptococcus thermophilus S10, thus real
Now to streptococcus thermophilus S10 rapidly and accurately qualitative detection, the especially qualitative inspection to streptococcus thermophilus S10 in fermented dairy product
It surveys.
Detailed description of the invention
Fig. 1: streptococcus thermophilus (Streptococcus thermophilus) S10 specific primer specific assay;
Streptococcus thermophilus (Streptococcus thermophilus) S10 specific amplification band of Fig. 2: 4 samples,
Band 1 is S10 fermented dairy product sample, and band 2 is positive control, and band 3 is negative control, and band 4 is non-S10 acidified milk system
Product sample.
Specific embodiment
The application is described further with reference to the accompanying drawings and examples, following embodiment is only illustrative, this Shen
It is not limited to these examples please.
Macro genome DNA in 1 fermented dairy product sample of embodiment extracts
1.0g sample carrying out washing treatment is taken, the thallus of washing is placed in 1.5mL centrifuge tube, is immediately placed in liquid nitrogen and freezes completely
Knot, is put into 65 DEG C of water-bath 5min, multigelation 3 times, adds 0.1mL%SDS and 10.0 μ L 10mg/mL Proteinase Ks after taking-up, in
200r/min shakes 2h in 37 DEG C of constant-temperature tables, and 12000 × g is centrifuged 10min at room temperature, collects supernatant and is transferred to another centrifugation
Guan Zhong, supernatant and isometric chloroform are centrifuged 10min in 12000 × g, collect supernatant and are transferred in another centrifuge tube, on
In 12000 × g centrifugation 10min, Aspirate supernatant is transferred to progress phenol chloroform in another centrifuge tube for clear liquid and isometric chloroform
Extracting 2 times, the ice isopropyl acid through 0.1 times of volume precipitate total DNA, and then twice, back dissolving is spare for 70% ethanol washing precipitating.
2 streptococcus thermophilus of embodiment (Streptococcus thermophilus) S10 specific primer specific detection
With one section of specificity in the whole genome sequence of streptococcus thermophilus (Streptococcus thermophilus) S10
Segment be foundation, design following primer sequence:
S10R:TCACTAACTGTTCTCCCTGTCTC;
S10F:ATGTTTGAACGAACTACCAAGAT.
After designing streptococcus thermophilus S10 specific primer, the specificity of the primer is verified, sort
It is higher with streptococcus thermophilus (Streptococcus thermophilus) ST10 homology and fermenting property is good on status
20 plants of streptococcus thermophilus (not including streptococcus thermophilus (Streptococcus thermophilus) S10) carried out PCR expansion
Increase, as control.
Strain as control is purchased from ATCC, JSM or DSM strain resource library, in corresponding strain resource library
Number be followed successively by, (1) Streptococcus thermophiles ATCC19258T、(2)Streptococcus
thoraltensis ATCC700865T、(3)Streptococcus tigurinus DSM24864T、(4)Streptococcus
suis ATCC43765T、(5)Streptococcus sobrinus ATCC33478T、(6)Streptococcus sinensis
DSM14990T、(7)Streptococcus shiloi ATCC51499T、(8)Streptococcus sanguinis
ATCC10556T、(9)Streptococcus saliviloxodontae JSM19288T、(10)Streptococcus
salivarius ATCC7073T、(11)Streptococcus saccharolyticus ATCC43076T、(12)
Bacteroides fragilis JCM 11019T、(13)Bifidobacterium animalis DSM 10140、(14)
Bifidobacterium breve ATCC 15700、(15)Bifidobacterium longum ATCC 15697、(16)
Clostridium coccoides JCM 1395T、(17)Enterococcus faecalis ATCC 19433T、(18)
Enterococcus faecium ATCC 19434, (19) Escherichia coli JCM 1649 and (20)
Lactobacillus acidophilus ATCC 4356T, amount to 20 plants of bacterium and carried out PCR amplification comparison analysis.
Amplification system:
50 μ L:10 × PCR mix of reaction system 10 μ L, 10mol/L upstream and downstream primer each 0.4 μ L, DNA profiling 100ng,
ddH2O is supplemented to 20 μ L;
Amplification condition:
95 DEG C of denaturation 5min;95 DEG C of denaturation 1min, 58 DEG C of annealing 45s, 72 DEG C of extension 1min are recycled 30 times;Last 72 DEG C
Extend 7min, 4 DEG C of preservations.
By, with the voltage of 5V/cm, electrophoresis 20-30min, dyeing is ultraviolet to take pictures, inspection in PCR product and 1% Ago-Gel
Survey expanding effect;Wherein, there is positive control of the streptococcus thermophilus S10 bacterial strain DNA of purpose amplified fragments as template to contain, with
Negative control of the aqua sterilisa as template, according to whether occurring expected characteristic bands at 298bp, in qualitative determining sample whether
Containing streptococcus thermophilus S10, as a result as shown in Figure 1, wherein with H2O is as negative control.
Analysis the result shows that, which can only expand streptococcus thermophilus (Streptococcus thermophilus) S10,
Remaining 20 plants of streptococcus thermophilus cannot be amplified.
Above-mentioned comparison amplification experiment shows that the primer that the present invention designs has good specificity.
3 streptococcus thermophilus S10 qualitative detection of embodiment
1. the extraction of macro genome DNA in fermented dairy product sample
Using the yoghurt example that streptococcus thermophilus (Streptococcus thermophilus) S10 ferments as sample to be tested
1, using Yoghourt made of other streptococcus thermophilus fermentations as sample to be tested 2.
Using frozen-thawed-CTAB method: taking 1.0g sample carrying out washing treatment, by the thallus of elution in 1.5mL centrifuge tube, stand
It is placed in fully charge in liquid nitrogen, thawing (about 5min) in 65 DEG C of water-baths is put into after taking-up, multigelation 3 times, adds 0.1mL
10%SDS and 10.0 μ L 10mg/mL Proteinase Ks, in 37 DEG C of constant-temperature tables 200r/min shake 2h, at room temperature 10000g from
Heart 10min collects supernatant and is transferred in another centrifuge tube.Supernatant and isometric chloroform in 10000g be centrifuged 10min (for
Make precipitating, water phase and organic phase layering), Aspirate supernatant is transferred in another centrifuge tube and carries out phenol chloroform 2 times, passes through
The sodium acetate of 0.1 times of volume, the ice isopropanol precipitating total DNA of 1 times of volume, then 70% ethanol washing precipitates 2 times, and back dissolving is standby
With.
Streptococcus thermophilus 2. (Streptococcus thermophilus) S10 specific primer specific amplification.
2.1 amplification systems:
Reaction system 50 μ L:10 ×× PCRmix10 μ L, 10mol/L upstream and downstream primer each 0.4 μ L, DNA profiling 100ng,
DdH2O is supplemented to 20 μ L;
2.2 amplification conditions:
95 DEG C of denaturation 5min;95 DEG C of denaturation 1min, 58 DEG C of annealing 45s, 72 DEG C of extension 1min are recycled 30 times;Last 72 DEG C
Extend 7min, 4 DEG C of preservations.
2.3 primer sequences:
S10R:TCACTAACTGTTCTCCCTGTCTC;
S10F:ATGTTTGAACGAACTACCAAGAT.
3. agarose gel electrophoresis
By, with the voltage of 5V/cm, electrophoresis 20-30min, dyeing is ultraviolet to take pictures, inspection in PCR product and 1% Ago-Gel
Survey expanding effect;Wherein there is positive control of the streptococcus thermophilus S10 bacterial strain DNA of purpose amplified fragments as template to contain, with
Negative control of the aqua sterilisa as template determines in sample whether contain according to whether occurring expected characteristic bands at 298bp
Streptococcus thermophilus (Streptococcus thermophilus) S10.
For expanding effect as shown in Fig. 2, as shown in Figure 2, sample 1 is sample to be tested 1, and sample 2 is containing there is purpose amplified fragments
Positive control of the bacterial strain DNA as template, sample 3 is the negative control using aqua sterilisa as template, and sample 4 is sample to be tested
2.From figure 2 it can be seen that positive control can amplify the purpose band that band clearly becomes clear, and negative control expands without corresponding
Increase production object.
Contain streptococcus thermophilus (Streptococcus thermophilus) S10, and sample in sample 1 (sample to be tested 1)
Streptococcus thermophilus (Streptococcus thermophilus) S10 is not contained in product 4 (sample to be tested 2).
Combine detailed description and exemplary example that the application is described in detail above, but these explanations are simultaneously
It should not be understood as the limitation to the application.It will be appreciated by those skilled in the art that without departing from the application spirit and scope,
A variety of equivalent substitution, modification or improvements can be carried out to technical scheme and embodiments thereof, these each fall within the application
In the range of.The protection scope of the application is determined by the appended claims.
Sequence table
<110>Beijing Ke Tuo Heng Tong Biotechnology Ltd.
<120>a kind of primer and method of qualitative detection streptococcus thermophilus
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2629
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
acaccgaaga acattcataa tctacttcta aagaagcaca agtaatctgg atgaaggcct 60
tcaaaaacta agtaggtcgt cagcctcttc ctgaggaatt tcttataggt aggtcttcag 120
gttatgatgt gtcgatcatc tatcagttta tctcatatgg taaggctgct aaactggcca 180
atccagccat ggcaaaagga aagaaaatcc tgattattgc tggtattgtt gtggtagtct 240
tagcgcttgc tggttatgga tttggttttt attattactc acgtggtcaa gtagcagatc 300
gttatgaagc agcaacttat ggtaagtttg atagttatgc ctcaaatcat aacacaacac 360
cagatggtgt atccgacatt ttccttaatg gtactgatga taccatgtac aaggatgtaa 420
cggctgatat tgatagaaat actacgggtg ctaaaaaccg tgccgctgat agtattactt 480
tctcggacgt tgacgtcaca gaagtcgttc agactggtga gaagaccttc aaggtgacct 540
tcactgcagt ttatgatttc tactatggtt ataattcgaa attcaagtca tcaggagata 600
ttaaagacaa aatttcatgg tcatgtaatg tggaatatgt tggtgacgat agtgactcta 660
gtggtagcag ttctaactac agcgactacc atatcaatgg taaagctatc gaatcacaaa 720
aagtgagtcg tgaagatact gtgaaatagt agttgttttc tcatagagct agtcattgtt 780
aaactgatta caattaggag ggtagtcctc tctactaaaa atgagagcct ggtaattgcc 840
aggttctttt gtttgtctgt ttttacctct tagggtctaa actttaccac ttacctaaaa 900
ggccttgttt agtttaaagc agctgttata atagaagaac catcaaaagg acaggaaagg 960
agtattatga aagttagaat cgaattggac ccatccatgg atgagcctga aatcttgatt 1020
cgagctcctc ggttaacaca ggaattggcc cagctccaag aatctattct aaagaaaaag 1080
ttagttcctt tagcctttta caaggatcga agcgaatatt ttctggattt ggcaaatatt 1140
ctcttttttg aaacagacgg ggaaaagatt tttggacata ccaaggatga ggcctatgag 1200
gtgaagcaaa agctctacga attagaagag ttgctcccga ttgccttttg tcggatttcc 1260
aaatcgacga ttgttaatgc taagcagatt tattctttag agaagtcttt ttcggggact 1320
agtacggtga atttctatca gacccacaag caggtccatg tatcaagacg ctactatcaa 1380
gttttaaaag aacgactaaa cgaaatgagg taagataatg agaaagaaat taattgggat 1440
cctcttgatc cttttggcag ctttggtaat tgtacaagac tattttataa aatgggaaat 1500
tagtatttgg atgttggcct gggtagtctt attggcaatt ttgtcccttt ctagtctttt 1560
gaagcgacat tttggtcttg gtttcgccta tggcattgtg gctctatttt cacttaatgg 1620
acagttccat tttcttccag tatctaactc ggtccttatc ttctcttcca ttcttgcagt 1680
tattggcttg aacattctct tcaattcttc tagtaaaaca aagaatcgct ttggactggg 1740
ttctactggc tcagacgcta ataatggtgg aaatgatatt gatgtcactt tttcagtagt 1800
gaccaaatat ctcaatgacc agcaatttac acatgggagt gcggatgtta gtttaggaca 1860
ggcttccgtt tattttgata attgccgtat tgaggggcca tctgctcagt ttgatgtgga 1920
cgtttctctt ggaagtctta gcctctatgt gcccagtgat tggcgggtgc atgtgaatgt 1980
ggataactct ctttcagctg tacagcatga ggaaaatcct agcaacttaa ctaacaagga 2040
cttctacatc aaaggtgatg tttccttggg taatttagaa attatttatg ttggtgagag 2100
ttcgattgat taagttagtg tagggaacct ctgattaata taatacctat tgttttatct 2160
caatccctgt gataagatag gctcaatcta ttttcaagag ggacaagagc tctgggattc 2220
ctaacgtcat caagtctttt aaatcaacta atactcgagg gagtaggaca agggagagtt 2280
tttgaaaagc tgttcggtat cactctcttt tttcctacta gaacaggaat taatttttaa 2340
ataaagttgt ggtgctaaat cttttgattt ggttcttttt ttggctagag gaccagatat 2400
tttgggcttt tcctgtagga gataagctta tgcctggccc ataggccaga gggctagaaa 2460
gggatgaggg aggagtctga ttgtttgtta attctgtgtt ataatagcaa ggattagtgg 2520
ttgttagtgc taagtgaatg gaaattcttg cttagtccga cttagtccga acgactggtg 2580
tagagacaag aaagggacgt cttatgaaat tactttatac ggatatgtc 2629
Claims (9)
1. a kind of specific primer for qualitative detection streptococcus thermophilus S10, which is characterized in that the specific primer includes
Upstream primer S10F and downstream primer S10R, or be the complementary strand sequence of the upstream primer S10F/ downstream primer S10R,
In, the sequence of upstream primer S10F is as shown in SEQ No.1;The sequence of downstream primer S10R is as shown in SEQ No.2.
2. specific primer according to claim 1, which is characterized in that the microbial preservation of the streptococcus thermophilus S10
Number is CGMCC No.16129.
3. application of the specific primer described in claim 1 in the kit for preparing PCR qualitative detection streptococcus thermophilus S10.
4. a kind of kit for PCR qualitative detection streptococcus thermophilus S10, which is characterized in that the kit includes right
It is required that specific primer described in 1.
5. kit according to claim 4, which is characterized in that the kit further include: standard items, specific primer
And PCR system.
6. kit according to claim 4 or 5, which is characterized in that its working procedure is 95 DEG C of denaturation 5min;95 DEG C of changes
Property 1min, 58 DEG C of annealing 45s, 72 DEG C of extension 1min, recycle 30 times;Last 72 DEG C of extensions 7min.
7. specific primer described in claim 1 or kit as claimed in claim 2 are in fluorescence PCR method to fixed
Property detection streptococcus thermophilus S10 application.
8. a kind of method of qualitative detection streptococcus thermophilus S10, which is characterized in that the described method includes:
Step 1, from the germy DNA fragmentation of institute in the sample is extracted in sample to be tested, as the template further expanded
DNA;
Step 2, PCR amplification is carried out using template DNA made from specific primer step 1 described in claim 1;
Step 3, detected through gel electrophoresis is carried out to pcr amplification product made from step 2.
9. according to the method described in claim 8, it is characterized in that,
The germy DNA of institute is extracted using CTAB method or RNA isolation kit in step 1, as template DNA;And/or
In step 2, the condition of PCR amplification are as follows: 95 DEG C of denaturation 5min;95 DEG C of denaturation 1min, 58 DEG C of annealing 45s, 72 DEG C extend
1min is recycled 30 times;Last 72 DEG C of extensions 7min, 4 DEG C of preservations;And/or
In step 3, the condition of gel electrophoresis are as follows: voltage 5V/cm, electrophoresis time 20-30min, the position of characteristic bands is about
At 298bp.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811179187.0A CN109055590B (en) | 2018-10-10 | 2018-10-10 | Primer and method for qualitatively detecting streptococcus thermophilus |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811179187.0A CN109055590B (en) | 2018-10-10 | 2018-10-10 | Primer and method for qualitatively detecting streptococcus thermophilus |
Publications (2)
Publication Number | Publication Date |
---|---|
CN109055590A true CN109055590A (en) | 2018-12-21 |
CN109055590B CN109055590B (en) | 2022-03-01 |
Family
ID=64763673
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811179187.0A Active CN109055590B (en) | 2018-10-10 | 2018-10-10 | Primer and method for qualitatively detecting streptococcus thermophilus |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109055590B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2005245395A (en) * | 2004-03-08 | 2005-09-15 | Ehime Prefecture | Anti-streptococcus thermophilus monoclonal antibody, cells producing the same, detection method and detecting reagent for streptococcus thermophilus |
-
2018
- 2018-10-10 CN CN201811179187.0A patent/CN109055590B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2005245395A (en) * | 2004-03-08 | 2005-09-15 | Ehime Prefecture | Anti-streptococcus thermophilus monoclonal antibody, cells producing the same, detection method and detecting reagent for streptococcus thermophilus |
Non-Patent Citations (2)
Title |
---|
BAE,J.J.等: "Production of Sesaminol and Antioxidative Activity of Fermented Sesame with Lactobacillus plantarum P8, Lactobacillus acidophilus ATCC 4356, Streptococcus thermophilus S10", 《FOOD SCI. BIOTECHNOL.》 * |
LEE, M.等: "Production of the Isoflavone Aglycone and Antioxidant Activities in Black Soymilk Using Fermentation with Streptococcus thermophilus S10", 《FOOD SCI. BIOTECHNOL.》 * |
Also Published As
Publication number | Publication date |
---|---|
CN109055590B (en) | 2022-03-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Masco et al. | Culture-dependent and culture-independent qualitative analysis of probiotic products claimed to contain bifidobacteria | |
Fasoli et al. | Bacterial composition of commercial probiotic products as evaluated by PCR-DGGE analysis | |
Gueimonde et al. | Viability and diversity of probiotic Lactobacillus and Bifidobacterium populations included in commercial fermented milks | |
de Melo Pereira et al. | Spontaneous cocoa bean fermentation carried out in a novel-design stainless steel tank: Influence on the dynamics of microbial populations and physical–chemical properties | |
Tadesse et al. | Isolation and molecular identification of lactic acid bacteria using 16s rRNA genes from fermented Teff (Eragrostis tef (Zucc.)) dough | |
CN109536406B (en) | Weak post-acidification streptococcus thermophilus JMCC16, separation and purification method and application | |
US20080274085A1 (en) | Probiotic Bifidobacterial Species | |
Ongol et al. | Main microorganisms involved in the fermentation of Ugandan ghee | |
CN107974420B (en) | Lactobacillus bulgaricus JMCC0018 for high yield of acetaldehyde, and separation and purification method and application thereof | |
US8741622B2 (en) | Stress tolerant Bifidobacteria | |
CN109576175A (en) | Streptococcus thermophilus JMCC0022, its isolation and purification method and application | |
CN106399195B (en) | A kind of Lactobacillus casei and its application | |
CN110272846A (en) | Lactobacillus plantarum and its application with ABTS free radical and PTIO free radical scavenging activity | |
Oyeniran et al. | A modified reinforced clostridial medium for the isolation and enumeration of Lactobacillus delbrueckii ssp. bulgaricus in a mixed culture | |
Negm El-Dein et al. | Probiotic properties and bile salt hydrolase activity of some isolated lactic acid bacteria | |
CN107058159A (en) | There are the Lactobacillus plantarum JMCC0017, its screening technique and application of good survival in milk beverage | |
CN109468397A (en) | The gene and its amplification primers of one specific detection Lactococcus lactis bacterial strain IMAU11823 is to, kit and method | |
Ma et al. | Cracking Streptococcus thermophilus to stimulate the growth of the probiotic Lactobacillus casei in co-culture | |
CN102242193A (en) | Application of DGGE (Denaturing Gradient Gel Electrophoresis) method to microorganism quick sort | |
Binetti et al. | Spontaneous phage-resistant mutants of Streptococcus thermophilus: Isolation and technological characteristics | |
CN109055590A (en) | A kind of primer and method of qualitative detection streptococcus thermophilus | |
KR101744529B1 (en) | Bacillus subtilis 1-d-5, method for growth stimulation of bifidobacteria and method for manufacturing of enzyme food using thereof | |
Andeta et al. | Development and validation of lactic acid starter cultures for enset (Ensete ventricosum) fermentation | |
CN103619184A (en) | Use of nisin resistant mutant strains of lactobacilli for reducing the post acidification in food products | |
CN109943655A (en) | Qualitative and/or quantitative detection Lactobacillus rhamnosus specific primer, kit and method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
TR01 | Transfer of patent right | ||
TR01 | Transfer of patent right |
Effective date of registration: 20230423 Address after: No. 1, Yard 31, Mangniuhe Road, Yanqi Economic Development Zone, Huairou District, Beijing 101408 Patentee after: Beijing Dadihaiteng Industry and Trade Co.,Ltd. Address before: 101407 No.1-2, yard 31, yiniuhe Road, Yanqi Economic Development Zone, Huairou District, Beijing Patentee before: BEIJING SCITOP BIO-TECH CO.,LTD. |