CN109055332B - Mutant exonuclease, coding gene and application thereof - Google Patents

Abstract

The invention discloses a mutant exonuclease, and a coding gene and application thereof. The amino acid sequence of the mutant exonuclease is shown as a sequence 1 in a sequence table. The nucleotide sequence of the gene for coding the mutant exonuclease is shown as a sequence 2 in the sequence table. The mutant exonuclease provided by the invention can improve the PCR amplification efficiency.

Description

Mutant exonuclease, coding gene and application thereof

Technical Field

The invention relates to a mutant exonuclease, a coding gene and application thereof, in particular to the mutant exonuclease, the coding gene and the application thereof.

Background

PCR has wide application in scientific research, medicine, clinical diagnosis, forensic medicine, agriculture, and public safety fields. The key to ensure the specificity of PCR amplification is that the added primer is specifically combined with the DNA (template) to be amplified. However, due to the diversity of DNA sequences, uncontrolled non-specific binding of DNA often occurs, which results in primer extension using non-target sequences, non-specific amplification, reduced yield of desired product, and even PCR failure.

Escherichia coli Exonase iii (ExoIII) is an Exonuclease that specifically binds to double strands of DNA and degrades one of the single strands in the 3 '-5' direction. Wild-type ExoIII degrades only single strands Of a double strand Of DNA, but not double strands Of DNA or free single strands Of DNA (J Biol chem.1964 Jan; 239:251-8.A Deoxyribonucleolytic Acid plasmid-Exonase From Escherichia coli.II. Characterisation Of The Exonase activity. Richardson CC, Lehman Ir, Kornberg A). The wild type ExoIII can degrade a primer and a template to form a primer template complex, and also can degrade a primer dimer formed by non-specific binding of the primer and the primer.

The use of wild-type ExoIII protein to enhance PCR reaction efficiency has been reported in the literature. In this document, wild-type ExoIII is used which has nuclease activity and facilitates fragment extension by degrading damaged template DNA, thus containing damaged PCR reaction products.

Disclosure of Invention

The object of the present invention is to provide a mutant exonuclease which can improve the efficiency of PCR reaction.

The amino acid sequence of the mutant exonuclease (ExoIIIM) provided by the invention is shown as sequence 1 in a sequence table.

The invention also aims to provide a gene for coding ExoIIIM, and the nucleotide sequence of the gene is shown as a sequence 2 in a sequence table.

It is still another object of the present invention to provide a recombinant bacterium comprising the recombinant expression vector.

Wherein the recombinant bacterium is escherichia coli.

Another object of the present invention is to provide the use of the ExoIIIM in PCR reactions.

It is still another object of the present invention to provide a method for obtaining a gene of interest, which comprises the steps of:

designing a primer according to the sequence of the target gene,

using DNA fragment or genome DNA containing the target gene as a template, and performing PCR reaction by using the designed primer and the ExoIIIM,

separating PCR product to obtain the target gene.

Another object of the present invention is to provide a PCR reaction kit comprising the ExoIIIM.

Wherein the kit further comprises a buffer solution for PCR, and the buffer solution for PCR consists of the following components: 0.2mM dNTP, 2mM MgCl₂、10mM(NH₄)₂SO₄20mM KCl and 25mM Tris pH8.5.

The ExoIIIM disclosed by the invention can reduce non-specific amplification and increase the yield of a target product, so that the PCR amplification efficiency is improved.

Drawings

FIG. 1 shows the principle of ExoIIIM construction in vitro, four fragments were amplified separately, and 4 mutation sites were introduced.

FIG. 2 shows an electrophoretic picture of amplified four fragments.

FIG. 3 shows the nucleotide sequence of ExoIIIM obtained by overlap extension PCR.

Figure 4 shows the alignment of predicted ExoIIIM and sequencing feedback results.

FIG. 5 shows SDS-PAGE analysis of purified ExoIIIM; wherein, the loading amounts of the proteins of the 1 st to 7 th lanes are respectively 10 mug, 5 mug, 2.5 mug, 1.25 mug, 625ng, 300ng and 150 ng; lane 8 shows wild-type ExoIII protein loaded at 5. mu.g.

FIG. 6 shows the comparative degradation activity of wild type ExoIII wt and ExoIIIM on DNA.

FIG. 7 shows the effect of ExoIIIM of example 1 in PCR amplification;

wherein, Lane 1 is a PCR reaction without addition of ExoIIIM; lane 2 is a PCR reaction supplemented with wild-type ExoIII (125 ng); the PCR reactions in lanes 3-10 were performed by adding 4. mu.g, 2. mu.g, 1. mu.g, 500ng, 250ng, 125ng, 60ng, and 30ng of ExoIIIM, respectively.

FIG. 8 shows the effect of ExoIIIM of example 2 in PCR amplification;

wherein, Lane 1 is a PCR reaction without addition of ExoIIIM; lane 2 is supplemented with wild type ExoIII (125ng) PCR reaction. The PCR reactions in lanes 3-10 were performed by adding 4. mu.g, 2. mu.g, 1. mu.g, 500ng, 250ng, 125ng, 60ng and 30ng of ExoIIIM, respectively.

FIG. 9 shows the effect of ExoIIIM of example 3 in PCR amplification;

wherein, Lane 1 is a PCR reaction without addition of ExoIIIM; lane 2 with addition of wild type ExoIII (125 ng); the PCR reactions in lanes 3-10 were performed by adding 4. mu.g, 2. mu.g, 1. mu.g, 500ng, 250ng, 125ng, 60ng, 30ng, 15ng and 8ng of ExoIIIM, respectively.

FIG. 10 shows the effect of ExoIIIM of example 4 in PCR amplification;

wherein, Lane 1 is a PCR reaction without addition of ExoIIIM; lane 2 is a PCR reaction supplemented with wild-type ExoIII (125 ng); ExoIIIM reactions in lanes 3-10 were performed in the presence of 4. mu.g, 2. mu.g, 1. mu.g, 500ng, 250ng, 125ng, 60ng, 30ng, 15ng, and 8ng, respectively.

FIG. 11 shows the effect of ExoIIIM of example 5 in PCR amplification;

wherein, Lane 1 is a PCR reaction without addition of ExoIIIM; lane 2 is a PCR reaction supplemented with wild-type ExoIII (125 ng); ExoIIIM reactions in lanes 3-10 were performed in the presence of 4. mu.g, 2. mu.g, 1. mu.g, 500ng, 250ng, 125ng, 60ng, 30ng, 15ng, and 8ng, respectively.

Detailed Description

Through the sequence alignment and the information guidance provided by the structural biology, the ExoIII protein sites H62, Q112, S115 and D151 of the wild type are presumed to have important roles in DNA binding and nucleic acid cleavage activity. In the present invention, the amino acids at the four amino acid positions are replaced with positively charged Lys, i.e., the mutation positions are H62K, Q112K, S115K and D151K, which presumably results in loss of nucleic acid cleavage activity and enhancement of the ability of ExoIII to bind DNA. The mutated ExoIII is named as ExoIIIM, the amino acid sequence of the mutated ExoIII is shown as a sequence 1 in a sequence table, and the nucleotide sequence of the mutated ExoIII is shown as a sequence 2 in the sequence table.

Preparation of ExoIIIM nuclease

Obtaining of ExoIIIM nucleotide sequence: primer pairs P1148 and 1465; p1466, 1467; p1468, 1469; the P1470 and 1149 amplified the genome of E.coli BL21 (ACT 28942.1/ECBD _1895), and the sizes of the obtained target fragments were 208bp, 172bp, 134bp and 365bp, respectively, and the agarose gel electrophoresis analysis chart is shown in FIG. 1. The four fragments were purified and recovered and mixed as a template, and the full-length primer pair P1148, 1149 was used for amplification to obtain the full-length sequence of the ExoIIIM nucleotide sequence, as shown in fig. 3.

TABLE 1 primer sequences for amplification of EcoIIIM

P1148	gatatacatATGGCAGCGACTATGAAATTTG
		P1149	gctgtagtcgacTTAGCGGCGGAAGGTCGCCCAGACGGGGGC
P1465	CCACGCCATACTTGCCTTTCTGCCCGTGATA
		P1466	AGAAAGGCAAGTATGGCGTGGCGCTGCTGAC
P1467	CGGCTCTTACCCCGCGGGAAGTAACCGTTGATCACG
		P1468	TCCCGCGGGGTAAGAGCCGCGACCATCCGATAAAAT
P1469	GATATTCATCCGGCCCATAATCAGTACCGGAT
		P1470	TTATGGGCCGGATGAATATCAGCCCTACAGA

The full-length sequence is recovered and purified, then is connected into a pET15b vector linearized by the same restriction enzyme by utilizing NdeI/SalI double enzyme digestion to construct a recombinant vector, DH5a competent cells are transformed by the recombinant vector, a single clone is picked up and sequenced by a sanger method. The nucleotide sequences obtained were aligned and confirmed to be identical to the nucleotide sequence of ExoIIIM, as shown in FIG. 4.

The recombinant expression vector constructed above was transformed into competent cells of E.coli BL21(DE 3). After transformation, the cells were cultured with shaking, and 100. mu.l of the resulting bacterial suspension was spread on LB plates containing 100. mu.g/ml ampicillin. A single colony was inoculated in 50ml of LB liquid medium containing 100. mu.g/ml ampicillin and cultured at 37 ℃ for 12 hours at 250 rpm/min. 40ml of the cell suspension was inoculated into 2.5L of LB liquid medium containing 100. mu.g/ml ampicillin. The bacterial solution was cultured at 37 ℃ at 250rpm/min until OD600 became 0.8, IPTG was added to give a final concentration of 0.5mM to induce gene expression, and the culture was shaken at 37 ℃ at 250rpm/min for 6 hours. The cells were centrifuged at 12000rpm/min for 5min to collect the cells. And (4) carrying out ultrasonic crushing, centrifuging and taking the supernatant to obtain a crude recombinant protein solution.

To obtain an ultra-pure protein of interest, it is further purified using a series of chromatographic systems.

Firstly, purifying by using a nickel ion affinity chromatography column, and removing the hybrid protein by utilizing the specific combination of the affinity label carried by the target protein and the resin, so that the target protein can be further purified. Then, ion exchange chromatography was performed, and the protein obtained in the previous step was dialyzed into A buffer (50mM Tris-hydrochloric acid, pH8.0, 50mM sodium chloride), followed by purification through a HiTrap Q anion column. The column was pre-equilibrated with an A buffer, and the salt ion concentration was increased by a B buffer (50mM Tris HCl, pH8.0, 1M sodium chloride), to gradually separate the target protein from various hetero-proteins by utilizing the difference in ion binding ability. Finally, the final purification step was carried out by molecular sieve chromatography, 4ml of protein sample was loaded onto a column for molecular sieve chromatography XK16-100 packed with Sephacryl TM S-200HR, and a molecular sieve buffer (50mM Tris-HCl pH8.0, 100mM NaCl) was previously equilibrated with the molecular sieve buffer before loading the column. The flow rate used for loading and elution was 1 ml/min. After the purification procedure, the target ExoIIIM protein (31kDa) with high purity and 12mg/ml concentration is finally obtained.

And (4) carrying out SDS-PAGE electrophoretic analysis for identification. The purified protein ExoIIIM was subjected to 1/2-fold gradient dilution and subjected to SDS polyacrylamide gel electrophoresis analysis. Wherein, the loading amount of the lanes 1-7 is 800. mu.g, 400. mu.g, 200. mu.g, 100. mu.g, 50. mu.g, 25. mu.g and 12. mu.g respectively; lane 8 is a commercially available wild-type Ecoli ExoIII wt protein loaded at 400. mu.g. The results of SDS-PAGE analysis are shown in FIG. 5.

ExoIIIM nuclease Activity assay

As shown in FIG. 6A, a fluorescent dye Cy5 was prepared to label the DNA at the 5' end (top strand) and mixed with the other DNA (bottom strand) to give a final concentration of 10pmol/ul of DNA in a solution of 0.5mM EDTA pH 8.0. Boiling the mixture in 500ml boiling water for 5min, stopping heating, and naturally cooling the mixture to room temperature in dark environment. The obtained annealing product was a substrate for detection of ExoIII wt/ExoIIIM exonuclease activity as shown in fig. 6A. ExoIIIM nuclease activity assays were performed by treating the above substrate with ExoIII wt/ExoIIIM in a standard PCR reaction system (37 ℃, 30 min). ExoIII wt/ExoIIIM treated DNA substrate was analyzed by 8% polyacrylamide electrophoresis (1 XTBE running buffer) and imaged using a Typhoon 9410(GE) scanner, and the image obtained is shown in FIG. 6. Wherein lanes 1-8 used wild protein ExoIII wt concentrations of 0.3pmol/ul, 0.5pmol/ul, 1pmol/ul, 2pmol/ul, 4pmol/ul, 8pmol/ul, 16pmol/ul, 32pmol/ul, respectively; lanes 9-16 used ExoIIIM protein concentrations of 0.3pmol/ul, 0.5pmol/ul, 1pmol/ul, 2pmol/ul, 4pmol/ul, 8pmol/ul, 16pmol/ul, 32pmol/ul, respectively; all the lane DNA concentrations were 1 pmol/ul.

It can be seen that ExoIIIM, at concentrations below 16pmol, had no degradation capability on the DNA substrate described above. Is suitable for being used as a blocking agent to combine with DNA to be extended (including double-stranded/single-stranded DNA substrate formed by non-specific annealing) before PCR is started.

PCR reaction

Examples 1-5 the following PCR reaction systems were used:

25mM Tris pH8.5

0.2mM dNTP

2mM MgCl₂

10mM(NH₄)₂SO₄

20mM KCl

200pmol primer

100ng genome template

Primer sequences for PCR reactions

P1054	GATATACATATGGGAGTACTGACCAAGGAGCAGATTA
		P1055	GCTGTAGTCGACTCACTCACCACCCTCAAGCTCCATTATG
P1144	GATATACATATGGCCAGCAGAGGCGTAAACAAG
		P1145	GCTGTAGTCGACTCAGAACGGAATGTCATCATCAAAG
P1082	GATATACATATGCCGAATGTCGCGTTCCACGCGGT
		P1083	GCTGTAGTCGACTCACTCCTGGTGAGCCAGCCAGAGGA
P1239	TAAGAAGGAGATATACATATGGAATATGCAGAGCTTTTTTG
		P1240	TCAGTGGTGGTGGTGGTGGTGATGAAATTCCCGCGACTGAGTTT
P1074	GATATACATATGGAGCGTATTAGCGATGTTCATATCAAG
		P1075	GCTGTAGTCGACTCACTCCAGCGGCTCCCTCCCATAGCG

As shown in FIGS. 7-11, the EXOIIIM significantly improved the efficiency of PCR amplification compared to wild-type ExoIII.

Sequence listing

<110> national oceanic agency third oceanic institute

<120> mutant exonuclease for enhancing efficiency of PCR reaction

<141> 2018-08-16

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 272

<212> PRT

<213> Artificial Sequence

<400> 1

Met Ala Ala Thr Met Lys Phe Val Ser Phe Asn Ile Asn Gly Leu Arg

1 5 10 15

Ala Arg Pro His Gln Leu Glu Ala Ile Val Glu Lys His Gln Pro Asp

20 25 30

Val Ile Gly Leu Gln Glu Thr Lys Val His Asp Asp Met Phe Pro Leu

35 40 45

Glu Glu Val Ala Lys Leu Gly Tyr Asn Val Phe Tyr His Gly Gln Lys

50 55 60

Gly Lys Tyr Gly Val Ala Leu Leu Thr Lys Glu Thr Pro Ile Ala Val

65 70 75 80

Arg Arg Gly Phe Pro Gly Asp Asp Glu Glu Ala Gln Arg Arg Ile Ile

85 90 95

Met Ala Glu Ile Pro Ser Leu Leu Gly Asn Val Thr Val Ile Asn Gly

100 105 110

Tyr Phe Pro Arg Gly Lys Ser Arg Asp His Pro Ile Lys Phe Pro Ala

115 120 125

Lys Ala Gln Phe Tyr Gln Asn Leu Gln Asn Tyr Leu Glu Thr Glu Leu

130 135 140

Lys Arg Asp Asn Pro Val Leu Ile Met Gly Arg Met Asn Ile Ser Pro

145 150 155 160

Thr Asp Leu Asp Ile Gly Ile Gly Glu Glu Asn Arg Lys Arg Trp Leu

165 170 175

Arg Thr Gly Lys Cys Ser Phe Leu Pro Glu Glu Arg Glu Trp Met Asp

180 185 190

Arg Leu Met Ser Trp Gly Leu Val Asp Thr Phe Arg His Ala Asn Pro

195 200 205

Gln Thr Ala Asp Arg Phe Ser Trp Phe Asp Tyr Arg Ser Lys Gly Phe

210 215 220

Asp Asp Asn Arg Gly Leu Arg Ile Asp Leu Leu Leu Ala Ser Gln Pro

225 230 235 240

Leu Ala Glu Cys Cys Val Glu Thr Gly Ile Asp Tyr Glu Ile Arg Ser

245 250 255

Met Glu Lys Pro Ser Asp His Ala Pro Val Trp Ala Thr Phe Arg Arg

260 265 270

<210> 2

<211> 819

<212> DNA

<213> Artificial Sequence

<400> 2

atggcagcga ctatgaaatt tgtctctttt aatatcaacg gcctgcgcgc cagacctcac 60

cagcttgaag ccatcgtcga aaagcaccaa ccggatgtga ttggcctgca ggagacaaaa 120

gttcatgacg atatgtttcc gctcgaagag gtggcgaagc tcggctacaa cgtgttttat 180

cacgggcaga aaggcaagta tggcgtggcg ctgctgacca aagagacgcc gattgccgta 240

cgtcgcggct ttcccggtga cgacgaagag gcgcagcggc ggattattat ggcggaaatc 300

ccctcactgc tgggtaatgt caccgtgatc aacggttact tcccgcgggg taagagccgc 360

gaccatccga taaaattccc ggcaaaagcg cagttttatc agaatctgca aaactacctg 420

gaaaccgaac tcaaacgtga taatccggta ctgattatgg gccggatgaa tatcagccct 480

acagatctgg atatcggcat tggcgaagaa aaccgtaagc gctggctgcg taccggtaaa 540

tgctctttcc tgccggaaga gcgcgaatgg atggacaggc tgatgagctg ggggttggtc 600

gataccttcc gccatgctaa tccgcaaaca gcagatcgtt tctcatggtt tgattaccgc 660

tcaaaaggtt ttgacgataa ccgtggtctg cgcatcgacc tgctgctcgc cagccaaccg 720

ctggcagaat gttgcgtaga aaccggcatc gactatgaaa ttcgcagcat ggaaaaaccg 780

tccgatcacg cccccgtctg ggcgaccttc cgccgctaa 819

Claims (9)

1. A mutant exonuclease, the amino acid sequence of which is shown as sequence 1 in a sequence table.

2. A gene of coding mutant exonuclease, the nucleotide sequence of which is shown as sequence 2 in a sequence table.

3. A recombinant expression vector having the mutant exonuclease-encoding gene of claim 2 inserted into a multiple cloning site thereof.

4. A recombinant bacterium comprising the recombinant expression vector according to claim 3.

5. The recombinant bacterium according to claim 4, wherein the recombinant bacterium is Escherichia coli.

6. Use of a mutant exonuclease according to claim 1 in a PCR reaction.

7. A method for obtaining a gene of interest, comprising the steps of:

designing a primer according to the sequence of the target gene,

performing PCR using a DNA fragment or genomic DNA containing the target gene as a template, using the designed primer and the mutant exonuclease described in claim 1,

separating PCR product to obtain the target gene.

8.A PCR reaction kit comprising the mutant exonuclease of claim 1.

9. The PCR reaction kit according to claim 8, characterized in that the kit further comprises a buffer for PCR consisting of: 0.2mM dNTP, 2mM MgCl₂、10mM(NH₄)₂SO₄20mM KCl and 25mM Tris pH8.5.

Images