RU2413767C1 - Thermostable dna-ligase from archaea of genus acidilobus - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention represents recombinant thermostable DNA-ligase Acidilobus sp 1904, demonstrating ligase activity in presence of magnesium ions, in the range of pH values from 6.8 to 7.4, sodium chloride concentrations from 0 to 100 mM. DNA-ligase consists of 607 amino acids and has weigh 68 kDa, determined by method of electrophoresis in polyacryl gel and has amino acid sequence SEQ ID N0:2. Invention also relates to DNA, coding DNA-ligase Acidilobus sp 1904, and method of obtaining said ligase.

EFFECT: invention makes it possible to extend assortment of DNA-ligases.

3 cl, 4 dwg, 6 ex

Description

Application area

The invention relates to the field of molecular diagnostics and genetic engineering and relates to thermostable enzymes with DNA ligase activity. A new DNA ligase from archaea of the genus Acidilobus and a method for its isolation are proposed.

Relevance

Biocatalyst enzymes are widely used in various industries, agriculture and medicine. One of the fastest growing markets is the production of enzymes for molecular biological research in a wide variety of fields, from medicine to forensics. An example is the thermophilic DNA polymerases used in the polymerase chain reaction (PCR), the introduction of which into practice in the 1990s essentially revolutionized the diagnosis of infectious diseases.

Along with PCR, a number of other methods for detecting and amplifying specific DNA sequences are known. These include the ligase chain reaction (LCR) method, which is effective for detecting DNA polymorphisms, mutations, and genetic abnormalities. Despite the fact that the LCR method has been known for a long time and is actively used in diagnostic practice, for example in the USA, it is practically not used in Russia, largely due to the lack of thermostable DNA ligases in the Russian market. Another area of use of thermostable ligases is their use for the "assembly" of synthetic genes from oligonucleotides, carried out at elevated temperatures to reduce the likelihood of formation of non-specific ligation products.

The growing demand for thermostable DNA ligases with different characteristics stimulates the interest of the largest research centers and leading biotechnological companies around the world in the search and creation of new DNA ligases with improved or new properties - high thermal stability, specific activity, resistance to inhibitors, etc. .

State of the art

DNA ligases play an important role in DNA replication, recombination, and repair [Lehman, 1974]. They are present in eukaryotes, bacteria, and archaea and can be divided into two families according to the high-energy cofactors used: ATP-dependent DNA ligases (EC 6.5.1.1) and NAD-dependent ligases (EC 6.5.1.2). DNA ligases catalyze the attachment of the 5'-P donor end to the 3'-OH acceptor end as a result of three sequential transfer reactions [Lehman, 1974; Engler and Richardson, 1983]. All currently known eukaryotic and archaeal DNA ligases, as well as ligases from bacteriophages and viruses, are ATP-dependent and contain specific motifs in their amino acid sequences [Georlette et al., 2000].

ATP-dependent DNA ligases from various hyperthermophilic archaea are known, including Thermococcus kodakaraensis [Nakatani et al., 2000], Thermococcus fumicolanus [Rolland et al., 2004], Staphylothermus marinus [Seo et al., 2007], Sulfolobus shibatae [Lai et al., 2002] and Sulfophobococcus zilligii [Sun et al., 2008].

Thermostable ligases isolated from the archaea Pyrococcus furiosus are known. The enzyme can be used for amplification of DNA in a ligase chain reaction (LCR) [US Patent 6280998, publ. 2001.08.28]. Recombinant thermostable proteins having DNA ligase activity are also known. The protein is isolated from Thermococcus sp. (Strain 9 ⁰ N-7), is ATP-dependent, and remains active at 100 ° C [WO 2007035439, publ. 2007-03-29].

The present invention relates to the isolation and characterization of a new LigAc1904 DNA ligase from a hyperthermophilic archaea isolated from a hot spring in the area of Mutnovsky volcano in Kamchatka, characterized by an acidic pH value, and also to develop a method for its preparation.

Using the polymerase chain reaction method, the DNA ligase gene from the thermophilic archaea of the genus Acidilobus (strain 1904) with the nucleotide sequence of SEQ ID NO1 was identified and then sequenced. By culturing a recombinant E. coli strain DLT1270 containing the pRARE plasmid transformed with the pQE30 vector containing the nucleotide sequence of SEQ ID NO 1, a new recombinant thermostable DNA ligase exhibiting ligase activity in the presence of magnesium ions was isolated and purified by metal affinity chromatography. a pH in the range from 6.8 to 7.4, in a wide range of concentrations of sodium chloride (0-100 mm), consisting of 607 amino acids, having a mass of 68 kDa, determined by polyacrylic gel electrophoresis, and containing the amino acid sequence of SEQ ID NO 2 obtained from a recombinant E. coli strain.

Disclosure of invention

Ligase LigAc1904 was isolated from Archaea Acidilobus strain 1904 and is characterized in that it consists of 607 amino acids and has a mass of 68 kDa, determined by polyacrylic gel electrophoresis. The amino acid sequence of LigAc1904 differs significantly from other known DNA ligases; the closest homologs are ATP-dependent DNA ligases of archaea Staphylothermus marinus (63% identity) and Sulfolobus shibatae (57% identity). Analysis of the amino acid sequence of LigAc1904 revealed three characteristic domains of ATP-dependent DNA ligases. The first domain, the N-terminal region of DNA ligase (DNA_Ligase_A_N), is found in most, but not all, ATP-dependent DNA ligases. This region is necessary for binding of the enzyme to DNA and is involved in catalysis of the reaction. The second domain, DNA_Ligase_A_M, is found in DNA ligases; its exact functional properties are unknown. The third, C-terminal domain (DNA_Ligase_A_C), makes up the bulk of the catalytic center of ATP-dependent DNA ligases.

One of the main areas of practical application of thermostable DNA ligases is the amplification of DNA in a ligase chain reaction (LCR). Carrying out LCR requires the high thermal stability of the enzyme, which possesses LigAc1904, which retains more than 50% of its activity after incubation for 30 minutes at a temperature of 94 ° C. In addition, the new enzyme unexpectedly reveals a number of useful properties: it provides ligation of only DNA fragments that have extended (12-nt in the case of BstEII fragments of phage lambda), but not short (4-nt ends of HindIII fragments of phage lambda) sticky ends, and is not able to ligate DNA fragments with blunt ends. Therefore, one of the promising applications of the new enzyme may be the "assembly" of synthetic genes from oligonucleotides. The ligation reaction at elevated temperature (60-70 ° C) should increase the efficiency of the "assembly" of a DNA fragment from oligonucleotides by reducing the likelihood of the formation of non-specific ligation products. Such products can be formed using conventional mesophilic DNA ligase (eg, T4 phage ligase DNA) as a result of annealing of randomly coalesced short complementary portions of oligonucleotides used for gene synthesis. The thermal stability of LigAc1904 and its ability to ligate only extended sticky ends should reduce the likelihood of the formation of nonspecific products during gene assembly with its use.

Brief Description of the Drawings

Figure 1. Expression of LigAc1904 in E. coli and protein purification.

The results of electrophoretic analysis of protein preparations are presented:

1 and 4 are molecular weight markers, dimensions are indicated in kDa,

2 - total protein preparation isolated from cells of strain DLT1270 / pRARE containing the plasmid pQE30 - LigAc1904, before induction of the synthesis of LigAc1904,

3 - the same as in lane 2, but 3 hours after the induction of LigAc1904 synthesis by adding 1 mM isopropyl-beta-D-thiogalactoside (IPTG) to the medium,

5 - protein preparation LigAc1904 after purification.

Figure 2. Analysis of the ability of LigAc1904 to ligate fragments formed by processing of phage λ DNA with BstEII endonuclease.

The results of the analysis of DNA preparations using gel electrophoresis in agarose gel are presented.

1 - molecular weight marker for DNA (fragment lengths are indicated in kb).

2 - DNA of phage λ after treatment with restriction enzyme BstEII.

3 - preparation of BstEII phage DNA fragments (after incubation for 1.5 h at 45 ° C with 500 ng of LigAc1904 ligase in reaction buffer (40 mM Tris-HCl pH 7.0, 5 mM MgCl ₂ ) that does not contain ATP.

4 - 9, - the same as in lane 3, but the ligation buffer additionally contained ATP in various concentrations: dor. 4 - 1000 μM, dor. 5 - 100 µM, dor. 6 - 10 µM, dor. 7 - 1 µM, dor. 8 - 0.1 µM, dor. 9 - 0.01 µM ATP.

10 - preparation of BstEII phage λ DNA fragments after incubation for 1.5 hours at 37 ° C with T4 DNA ligase in a buffer without ATP.

11 - the same as on dor. 5, but the ligation buffer additionally contained 100 μM ATP. The arrows on the right show the terminal BstEII fragments A (5678 bp) and B (8453 bp), as well as the product of their ligation, C (14131 bp).

Figure 3. Enzymatic characterization of LigTh1519 ligase DNA.

A is the structure of the synthetic substrate used to determine the effectiveness of ligation of a single strand break. The position of the γ32P radioactive label inserted at the 5 ′ end of the LA30 oligonucleotide is indicated by an asterisk.

Panels BE present the results of electrophoretic analysis of ligation products.

B - the effect of NaCl concentration on the activity of LigTh1519.

In - the effect of the concentration of MgCl ₂ on the activity of LigTh1519.

G - the effect of the pH of the reaction buffer on the activity of LigTh1519.

D is the effect of the temperature of the reaction on the activity of LigTh1519.

E - characteristic of thermal stability LigTh1519. The effect of the pre-incubation time of LigTh1519 at 94 ° C on the enzyme activity was shown.

In panels BE, the products of the control reaction (without enzyme addition) are shown on track “k”.

Figure 4. The dependence of the activity of DNA ligase LigAc1904 from ATP.

(A) Results of electrophoretic analysis of ligation products.

1 and 2 - control reactions without enzyme.

3 - ligase reaction carried out without the addition of ATP.

4-7, - ligase reactions carried out in the presence of ATP: dor. 4 - 1000 μM, dor. 5 - 100 µM, dor. 6 - 10 µM, dor. 7 - 1 µM ATP.

(B) is a diagram showing the relative activity of LigAc1904 ligase DNA under various conditions, determined by the ratio of the intensities of the bands corresponding to LA70 (product) and LA30 (substrate).

The implementation of the invention

Example 1. Molecular identification of strain 1904.

Strain 1904 was isolated from a hot spring in the area of Mutnovsky volcano in Kamchatka, characterized by an acidic pH, and was maintained in the collection of the Laboratory of Hyperthermophilic Microbial Communities of the INMI RAS. Strain 1904 is an obligate anaerobic organotroph using peptone or starch as growth substrates. The presence in the environment of elemental sulfur, which the microorganism restores into hydrogen sulfide, stimulates growth. The optimum growth temperature is 85 ° C; the optimal pH is 3.8. Cultivation was carried out in 15 ml Hangate tubes on a medium of the following composition (g / l): NH ₄ Cl - 0.33, KCl - 0.33, KH ₂ PO ₄ - 0.33, CaCl ₂ * 2H ₂ O - 0.33, MgCl ₂ * 6H ₂ O - 0.33, yeast extract - 2.0, elemental sulfur - 10.0; Na ₂ S * 9H ₂ 0 - 0.5, a solution of trace elements [Kevbrin and Zavarzin, 1992] - 1 ml / l, vitamins [Wolin et al., 1963] - 1 ml / l. An anaerobically prepared medium (pH 3.8) was poured under the current of an oxygen-purified N ₂ / CO ₂ mixture (80:20) in 10 ml portions and autoclaved at an overpressure (0.5 atm), the incubation temperature was 85 ° C.

The genomic DNA of strain 1904 was isolated by standard methods [Ausubel et al., 1997], the 16S rRNA gene sequence was determined as described in [Sokolova et al., 2002]. Comparison of the sequence of the 16S rRNA gene of strain 1904 with the sequences presented in GenBank showed that strain 1904 belongs to the Crenarchaeota division, the Thermoprotei class, the Desulfurococcales order, the Desulfurococcaceae family, and the Acidilobus genus.

Example 2. Isolation of the Acidilobus sp 1904 DNA ligase gene.

Analysis of the nucleotide sequences of archaea DNA ligases in the GenBank database revealed several conserved regions, two of which were used to create a pair of specific primers for DNA ligase genes: BO-2F [GA (t / g) TA (t / c) AAATA (t / c) GATGG (a / g) GA (g / a) (a / c) G] and BO-3R [T (g / t) ACTT (t / c) CT (c / t) TT ( t / c) CT (g / a) TGCAT]. Using these primers, a fragment of about 250 bp was amplified on the total DNA of Acidilobus sp 1904. The following PCR program was used: 94 ° C - 1 min, 45 ° C - 140 s and 72 ° C - 1.5 min, a total of 40 cycles. The nucleotide sequence of the obtained fragment had high homology with the gene sequences of ATP-dependent archaea DNA ligases. For cloning the full-sized gene of the LigAC1904 DNA ligase, the “inverse" PCR method was used.

To determine the sequence of the 5'-end of the gene, we used a pair of opposite-directed primers 1904-1R (AGCCTTCTGGA-GAATATCTTTATC) and 1904-2F (CTATGTACCCTGATATAGCTGA) located in a 250-nt sequenced fragment. Acidilobus sp 1904 DNA was treated with SacI, the resulting fragments were closed in a ring, treated with T4 DNA ligase and used as a template for PCR with primer pairs 1904-1R and 1904-2F. The resulting PCR fragment is 1.2 kb in length. has been sequenced; as it turned out, it contained the complete sequence of the 5'-region of the gene to the start codon and the adjacent region of genomic DNA.

To determine the sequence of the 3'-region of the LigAC1904 gene, genomic DNA was treated with HindIII restriction enzyme, the obtained fragments were closed in a ring, treated with T4 DNA ligase and used as a template for PCR with primer pairs 1904-1R and 1904-2F. The resulting PCR fragment is 1.1 kb in length. has been sequenced; however, it did not include the entire sequence of the 3'-region of the gene. Therefore, at the next stage, primer 1904-4F (TCGGACACTGTGGACCTAGT) oriented to the 3'-end of the gene was selected near the right end of a certain sequence of the 3'-region, with which PCR was performed on Acidilobus sp 1904 genomic DNA. The resulting PCR fragment of about 1.1 tbp was the result of specific binding of primer 1904-4F to a selected region of the ligase DNA gene and non-specific binding to the genome region located beyond the 3'-end of the gene. Sequencing of this fragment determined the sequence of the 3'-region of the ligase DNA gene to the termination codon and adjacent genomic DNA.

As a result of combining the three obtained sequences, the complete nucleotide sequence of the 1824 nt Acidilobus sp 1904 DNA ligase gene was determined, which is shown in SEQ ID NO 1.

Example 3. Obtaining a strain of E. coli - producer of DNA ligase Acidilobus sp 1904, isolation and purification of the enzyme.

Primers 1904-BamHI (GAGGATCCTTGCCCTCAGACATGATGTTCG) and 1904-SphI (CAGCATGCTTAGGCCTCGCCCTCC) were used for PCR amplification of the full-size LigAC1904 gene, and the genomic DNA was obtained with the Acidilobus B1 fragment I and B4 sp4. pQE30 vector (Qiagen), allowing expression of the target protein fused to 6 amino acid residues of histidine at the N-terminus. As a result, a recombinant expression vector pQE30-LigAc1904 was obtained.

The E. coli strain DLT1270, which is a derivative of strain DH10B [Grant et al., 1990], contains the lacI lactose operon repressor gene integrated into the chromosome. The DLT1270 / pRARE strain containing the plasmid pRARE-2 (Novagen) encoding “rare” for E. coli t-RNA was used to express LigAc1904 DNA ligase. For this, pQE30-LigAc1904 was introduced into the E. coli strain DLT1270 / pRARE.

The indicated strain containing the recombinant plasmid pQE30-LigAc1904 was grown on a shaker at 37 ° C until OD ₆₀₀ ~ 0.5 was reached, then the synthesis of the recombinant protein was induced by introducing isopropyl-β-D-thiogalactopyranoside (IPTG) to 1 mM, and the culture was continued to grow for 18 h at 37 ° C. Isolation and purification of LigAc1904 ligase was carried out by metal-affinity chromatography using a Spin-NTA KIT kit (Qiagen, Germany). The result was a homogeneous preparation of the protein LigAc1904 (Fig. 1).

Example 4. Determination of the activity of DNA ligase LigAc1904.

Two methods were used to determine ligase activity in vitro. First, the method described in [Muerhoff et al., 2004], which is based on the ligation of BstEII - DNA fragments of phage λ. End fragments 8453 bp long and 5678 bp containing cohesive ends with a length of 12 nucleotides form a stable duplex at a temperature of 45 ° C. Analysis of ligase activity was carried out in a buffer containing 40 mm Tris-HCl (pH 7.0), 5 mm MgCl ₂ and ATP (in the range from 0 to 1 mm). 0.5 μg of phage λ DNA treated with BstEII was incubated with 500 ng of LigAc1904 protein in 50 μl of the indicated buffer, the reaction was carried out at 45 ° C for 1 h. If the test enzyme has ligase activity, then of the two terminal BstEII fragments 8453 nt long and 5678 nt, a fragment of 14131 nt is formed. The ligation reaction was stopped by the addition of 50 mM EDTA and heated for 10 min at 70 ° C to denature non-ligated ends. Samples were analyzed by electrophoresis in a 0.7% agarose gel (FIG. 2).

The results presented in figure 2 show that the recombinant protein LigAc1904 really has the activity of DNA ligase. High ligation efficiency was observed, including in the absence of ATP introduced into the reaction (Fig. 2, lane 5), which indicates the presence of a significant fraction of the pre-adenylated enzyme in the preparation. It was also found that a high concentration of ATP (1 mm, lane 6 in figure 2) inhibits ligase activity, the optimum of which was achieved at ATP concentrations from 1 to 100 μM.

Note that the ligation of the remaining (non-terminal) restriction fragments was not observed either in the described experiment with BstEII or in the case of DNA processing of phage λ with the HindIII restriction enzyme, which forms sticky ends with a length of 4 nt.

The second method described in [Nakatani et al., 2000] made it possible to quantify ligase activity by “suturing” a single-stranded break in a double-stranded DNA fragment. Duplex formed by annealing three synthetic oligonucleotides was used as a substrate:

LA-30 (CAGAGGATTGTTGACCGGCCC GTTTGTCAG), LA-40 (CGCACCGTGACGCCA AGCTTGCATTCCTACAGGTCGACTC) and LA-80 (CGTTGCTGACAAACGGGCCGGTCA ACAATCCTCGGGGGGGGGGGGGGGGGGTCGGGGGTCGGGGGGTCGGGGGGTCGGGGGTCGGGGGTCGGGGGGTCGGGGGTCGGGGTCGGGGTCGGGGTC

A radioactive label was introduced into the 5'-end of the oligonucleotide LA-30 using the T4 polynucleotide kinase. The ligase reaction was carried out at 70 ° C for 15 min, the composition of the buffer and the temperature were changed to determine the optimal reaction conditions, at the end of the reaction, DNA was denatured by heating for 15 min at 94 ° C. The reaction products were analyzed by denaturing polyacrylamide gel electrophoresis and radioautography. As a result of the “suturing” of a single-stranded DNA ligase rupture, the radiolabeled LA30 primer binds to LA40, which leads to the formation of an oligonucleotide of 70 nucleotides in length, detected by electrophoresis followed by radioautography.

Example 5. The effect of temperature, pH, salt concentration and ATP concentration on the activity of DNA ligase LigAc1904.

A semi-quantitative determination of the ligase activity of LigAc1904 was carried out on a DNA fragment obtained by annealing three oligonucleotides containing a single-stranded gap in one of the chains (Fig. 3A). Ligation efficiency was determined by the ability of the enzyme to “sew up” this gap and the formation of a ligation product, an oligonucleotide of 70 nt in length [Nakatani et al., 2000]. The dependence of the activity of LigTh1519 on the pH of the buffer, the concentrations of ATP, NaCl and MgCl ₂ , as well as temperature, was determined.

The results presented in figure 3 show that LigAc1904 is active in a wide range of NaCl concentrations (0-100 mm) at pH values in the range from 6.8 to 7.4. We found that the ligase activity of LigAc1904 requires the presence of a divalent cation (Mg +) in the medium, and the enzyme is active in the concentration range of MgCl ₂ from 5 to 25 mM. LigAc1904 ligase DNA was active over a wide temperature range. Although the optimal reaction temperature was 65-70 ° C (Fig. 3), the enzyme is active at temperatures from 50 to 70 ° C, and possibly even higher, since at temperatures above 70 ° C the denaturation of the substrate does not allow the determination of the activity of the enzyme.

The thermal stability of LigAc1904 was evaluated by incubating the enzyme in the reaction buffer (without ATP) at 94 ° С, then the enzyme activity was determined in the standard reaction (40 mM Tris-HCl buffer (pH 7.0), 5 mM MgCl ₂ , 1 mM ATP) at 70 ° С . We found that the enzyme lost half of its activity as a result of incubation for 30 min at 94 ° C (figure 3). Thus, the level of thermal stability of LigAc1904 is higher than that of Sulfolobus shibatae DNA ligase (50% inactivation time 10 min at 90 ° С) [Lai et al., 2002], but lower than that of Staphylothermus marinus ligase (50% inactivation time 2.8 hours at 100 ° C) [Seo et al., 2007].

Example 6. The DNA ligase activity of LigAcl904 is dependent on ATP.

The enzymatic activity of all DNA ligases requires a high-energy cofactor as an energy source, which can be ATP (for DNA ligases of eukaryotes, archaea, and viruses) or NAD + (bacterial DNA ligases). Archaea DNA ligases are known that can use, in addition to ATP, also one or several other cofactors - ADP, dADP, GTP and NAD +.

The experiments presented in example 4 showed that LigAc1904 shows ligase activity even without the addition of ATP, which is probably due to the presence of a pre-adenylated protein fraction in the protein preparation isolated from the E. coli strain, producer. Therefore, to test the dependence of LigAc1904 activity on ATP, the enzyme was preincubated under standard reaction conditions (method 2 in Example 4), but with an unlabeled oligonucleotide substrate, so that the pre-adenylated ligase fraction would use up the AMP covalently bound in the active center of the enzyme. Then, radioactively labeled substrate and ATP in various concentrations were added to the reaction mixture. The results obtained (figure 4) showed that the activity of LigAc1904 depends on ATP, with the optimal concentration of this cofactor being from 10 to 100 μM (lanes 5 and 6 in figure 4), and higher concentrations of ATP inhibit ligase activity.

BIBLIOGRAPHY

Claims (3)

1. Recombinant thermostable DNA ligase Acidilobus sp 1904, showing ligase activity in the presence of magnesium ions, in the pH range from 6.8 to 7.4, sodium chloride concentrations from 0 to 100 mm, consisting of 607 amino acids, having a mass of 68 kDa determined by polyacrylic gel electrophoresis and containing the amino acid sequence of SEQ ID NO: 2, obtained from a recombinant E. coli strain. 2. The selected nucleotide sequence of DNA encoding the thermostable DNA ligase according to claim 1, including the nucleotide sequence of SEQ ID NO: 1. 3. The method of obtaining thermostable DNA ligase according to claim 1, comprising culturing a recombinant E. coli strain DLT1270 containing the plasmid pRARE transformed with the pQE30 vector containing the nucleotide sequence of SEQ ID NO: 1 encoding the Acidilobus sp 1904 DNA ligase, isolation and purification DNA ligases by metal affinity chromatography.

Images