CN108998560A - Identify SNP marker, ApoE gene method and the application of rhizoma corydalis - Google Patents
Identify SNP marker, ApoE gene method and the application of rhizoma corydalis Download PDFInfo
- Publication number
- CN108998560A CN108998560A CN201811013860.3A CN201811013860A CN108998560A CN 108998560 A CN108998560 A CN 108998560A CN 201811013860 A CN201811013860 A CN 201811013860A CN 108998560 A CN108998560 A CN 108998560A
- Authority
- CN
- China
- Prior art keywords
- rhizoma corydalis
- pcr
- sequence
- sample
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of SNP marker, ApoE gene method and applications for identifying rhizoma corydalis, are related to field of biotechnology, are proposed based on the specificity mirror method for distinguishing not to rhizoma corydalis.The present invention includes for identifying the application of the SNP marker of rhizoma corydalis, SNP marker, the specific primer based on allele PCR detection rhizoma corydalis to Y1, the method based on ApoE gene detection rhizoma corydalis, the beneficial effects of the present invention are: to the precise Identification of rhizoma corydalis and its fabricated product true and false, have the advantages that good accuracy height, stability, high specificity, without being sequenced and not influenced by medicinal part.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to a kind of to identify the SNP marker of rhizoma corydalis, allele-specific
PCR method and application.
Background technique
Rhizoma corydalis is version " Chinese Pharmacopoeia " conventional Chinese medicine for recording in 2015, derives from papaveraceae plant corydalis
Corydalis yanhusuo W.T.Wang ex Z.Y.Su et C.Y.Wu dry tuber.Rhizoma corydalis have apparent promoting blood circulation,
Promoting the circulation of qi, analgesic effect, modern pharmacological studies have shown that rhizoma corydalis also have anti-gastric-ulcer, antidepression, protect cardiac muscle cell from
Ischemic injuries and treatment coronary heart disease isoreactivity, at least 100 plurality of Chinese formulas are primary raw material for delaying using rhizoma corydalis at present
Solve pain.
Since the nearly edge species medicinal part of rhizoma corydalis is quite similar in form and chemical component, in the market when have
Report doping situation is especially organized interior species replacement and is more difficult to, is unfavorable for drug safety.Although having at present based on ITS
The rhizoma corydalis specific molecular marker of sequence, but show ITS sequence in Corydalis concerted evolution according to our early-stage study
Inconsistent, there are multiple and different copies, therefore are not suitable as identifying the molecular labeling of rhizoma corydalis.It is therefore desirable to establish one
The reliable method of kind realizes the accurate identification of rhizoma corydalis and sibling species medicinal material.
Summary of the invention
Present invention solves the technical problem that being the not specificity mirror method for distinguishing to rhizoma corydalis.
The present invention adopts the following technical solutions solves above-mentioned technical problem:
For identifying the SNP marker of rhizoma corydalis, the SNP marker is SNP1 as shown in SEQ ID NO.1
And/or SNP2, wherein SNP1 is the 493rd bit base of the sequence as shown in SEQ ID NO.1, and base is G herein, then is accredited as and prolongs
Hu Suo；Wherein SNP2 is the 746th bit base of the sequence as shown in SEQ ID NO.1, and base is G herein, then is accredited as and prolongs recklessly
Rope.
The present invention also provides the applications of the SNP marker, are any one following of (a1) into (a3):
A1: the application in the identification or auxiliary identification rhizoma corydalis of the rhizoma corydalis molecular labeling is detected；
A2: substance the answering in preparation identification or auxiliary identification rhizoma corydalis product of the rhizoma corydalis molecular labeling is detected
With；
A3: application of the SNP marker in rhizoma corydalis molecular mark.
The present invention also provides the specific primers based on allele PCR detection decumbent corydalis tuber to Y1: including upstream primer
YAN-1F:5 '-TCACTGCGATTAGTGTCTTAG-3 ', the upstream primer YAN-1F sequence as shown in SEQ ID NO.2, under
Swim primer YAN-1R:5 '-TCTTTGATTCTCTTTTGAAAAAGC-3 ', the downstream primer YAN-1R sequence such as SEQ ID
Shown in NO.3.
The present invention also provides the applications of the primer pair, are any one following of (b1) into (b3):
B1: identify untested medicinal material whether be or sample to be tested in whether contain rhizoma corydalis；
B2: preparation for identify untested medicinal material whether be or sample to be tested in whether the kit containing rhizoma corydalis；
B3: the application in rhizoma corydalis breeding.
It preferably, further include archaeal dna polymerase, PCR buffer, dNTPs in the kit.
The present invention also provides the methods based on ApoE gene detection rhizoma corydalis, comprising the following steps:
(1) sample to be tested genomic DNA is extracted；
(2) using the genomic DNA of sample to be tested as template, pcr amplification reaction is carried out using above-mentioned primer pair, amplification contains
The segment of the sequence as shown in SEQ ID NO.1；
(3) pcr amplification product is detected.
Preferably, PCR reaction system includes the primer pair, archaeal dna polymerase, PCR buffer, institute in the step (2)
State sample to be tested genomic DNA, dNTPs and water.
Preferably, the minimum template detection limit of primer pair Y1 is respectively 60ng in the step (2), the primer pair YAN-
The molar ratio of 1F and YAN-1R is 1:1.
Preferably, PCR amplification program includes denaturation, annealing and extends in the step (2), and the annealing temperature is 42
DEG C -60 DEG C, the cycle-index of 3 steps is 20.
Preferably, in detecting step (3) pcr amplification product sequence, the PCR product contains SEQ ID NO.1 sequence
Shown in DNA fragmentation, the sample to be tested is or candidate is rhizoma corydalis；The PCR product does not contain SEQ ID NO.1 sequence
Shown in DNA fragmentation, the sample to be tested it is non-or it is candidate be non-rhizoma corydalis.
The beneficial effects of the present invention are:
The present invention devises 1 primer pair according to SNP site, establishes a kind of fast and accurately based on allele specific
The rhizoma corydalis identification method of property PCR.The method of the results show, identification provided by the invention or auxiliary identification rhizoma corydalis has
Stable specificity and sensitivity can successfully identify certified products, minimum DNA profiling limit of detection from 72 parts of 14 species
For 6ng.Using the rhizoma corydalis identification method provided by the invention based on ApoE gene, can be realized to rhizoma corydalis
And its precise Identification of the fabricated product true and false, there is good accuracy height, stability, high specificity, without sequencing and not by medicine
The advantages that being influenced with position.
Detailed description of the invention
Fig. 1 universal primer is to sample DNA templates quality measurements, and wherein MarD is DNA Marker D；
Fig. 2 is influence of the different condition to rhizoma corydalis and its mixed adulterant decumbent corydalis tuber, Corydalis remota AS-PCR amplification,
Wherein A is annealing temperature optimum results, and B is cycle-index optimum results, and C is different enzyme type experimental results；1 is rhizoma corydalis
(sample number into spectrum: C283), 2 be Corydalis remota (sample number into spectrum: C316), and 3 be decumbent corydalis tuber (sample number into spectrum: C286)；MarD is
DNA Marker D；R Taq is r Taq archaeal dna polymerase, and Ex Taq is Ex Taq archaeal dna polymerase, and SpeedSTAR is
SpeedSTARTMHS archaeal dna polymerase；
Fig. 3 is minimum template limit testing result, wherein 1 is rhizoma corydalis (sample number into spectrum: C283), 2 be Corydalis remota
(sample number into spectrum: C316), 3 be decumbent corydalis tuber (sample number into spectrum: C286), and Y1 is rhizoma corydalis specificity diagnostic primers to title；
Fig. 4 is the verification result after expanding sample to specific diagnostic primers reliability, and wherein Y1 is rhizoma corydalis specificity
Diagnostic primers are to title.
Specific embodiment
In order to be easy to understand the technical means, the creative features, the aims and the efficiencies achieved by the present invention, tie below
Specific embodiment is closed, the present invention is further explained.
Experimental method in following embodiments is unless otherwise specified conventional method.
Test material and reagent as used in the following examples etc., unless otherwise specified, commercially obtain.
The source of main material used in following embodiments are as follows:
Genus Corydalis material and its source in embodiment 1 are shown in Table 1.Botanical name in table 1 is documented in document
(Zhang Mingli,Su Zhiyun,Magnus Lidén.Corydalis DC.[M]//Wu Z Y,Raven P H,Hong
D Y.Flora of China.Vol.7.Bei-jing:Sciences Press,St.Louis:Missouri Botanical
Garden Press, 2008:295-428.) and (Ki keman Zoku.Corydalis DC.In:Flora of Japan
[M] .Washington:Smithsonian Institution.1965:476.) in.14 kinds of plant samples are 72 parts total, collect
From the plant of the distributing regions different populations such as Anhui, Jiangsu, Zhejiang, Henan, Shandong, Heilungkiang, Jilin, Liaoning and Xinjiang,
In addition to the produced rhizoma corydalis of Jinhua, Zhejiang is cultivated species, other is wild.All samples are by Anhui University of Chinese Medecine Peng
Pharmaceutical college of Anhui University of Chinese Medecine is stored in professor's Hua Sheng identification, plant voucher specimen.
Table 1 is wild plant material and source
Note: * is sequencing sample
Medicinal material material and its source in embodiment 2 are shown in Table 2.Medicine elementary source botanical name in table 2 is documented in document
(Zhang Mingli,Su Zhiyun,Magnus Lidén.Corydalis DC.[M]//Wu Z Y,Raven P H,Hong
D Y.Flora of China.Vol.7.Bei-jing:Sciences Press,St.Louis:Missouri Botanical
Garden Press, 2008:295-428.).Total 14 parts of medicinal material samples are purchased from Hui nationality's medicinal material market and pharmacy's (table 2).
2 medicinal material material of table
10 × PCR Buffer, dNTP and Ex Taq enzyme: it is purchased from Takara company；
Wherein AS-PCR is ApoE gene.
Embodiment 1
The acquisition of rhizoma corydalis SNP marker
For the matK of the sequencing gained solid rhizoma corydalis group of Corydalis and 14 species of storied rhizoma corydalis group totally 56 samples
Sequence carries out homologous alignment using BioEdit 7.2.2 software, observes SNP site specific to rhizoma corydalis after correction manually.I
Find that corresponding to the 493rd G of sequence shown in SEQ ID NO.1 in rhizoma corydalis genomic DNA is SNP1, the 746th G be
SNP2, and the 493rd for corresponding to sequence shown in SEQ ID NO.1 in the non-rhizoma corydalis genomic DNA of Corydalis is non-G, the 746th
Position is non-G, and Corydalis rhizoma corydalis genomic DNA is compared with non-rhizoma corydalis genomic DNA, in addition to corresponding to SEQ ID NO.1 institute
Show that other positions have identical base in the DNA fragmentation of sequence except the 493rd and the 746th.
Embodiment 2
Design of primers
Rhizoma corydalis specific PCR amplimer is exactly the same with SNP1 to the 3 ' of Y1 ends, and with SNP2 strictly complementary, because
This, 3 ' ends and the SNP1 phase of primer YAN-1F is all G, and the 3 ' ends of primer YAN-1R complementary with SNP2 are C.
There is phase by YAN-1F by the substitution and/or deletion and/or addition of one or several nucleotide and with YAN-1F
The DNA molecular of congenerous, YAN-1R is by the substitution and/or deletion and/or addition of one or several nucleotide and and YAN-1R
DNA molecular with the same function.
Each primer is subjected to preliminary experiment, compares the performances such as sensitivity and specificity, finally obtains for identifying rhizoma corydalis
1 set of primer pair.
Be made of for identifying the primer pair (primer pair Y1) of rhizoma corydalis upstream primer YAN-1F and primer YAN-1R (5 ' →
3 '):
YAN-1F:TCACTGCGATTAGTGTCTTAG；
YAN-1R:TCTTTGATTCTCTTTTGAAAAAGC；
Each equal independent packaging of primer.Each primer is added in PCR reaction system in the form of primer solution, each primer
Initial concentration in primer solution is 10pmoL/ μ L, and the molar ratio of primer pair YAN-1F and YAN-1R are 1:1.
Embodiment 3
Template obtains and quality inspection
DNA is extracted: vegetable material takes the blade 20mg of silica dehydrator, and medicinal powder takes 100mg after crossing No. 5 sieves, according to changing
Good CTAB method extracts total DNA；
Quality inspection: using the concentration and purity of the ultraviolet absorption method measurement double-stranded DNA template of nucleic acid-protein analyzer, and
With universal primer trnH (sequence CGCGCATGGTGGATTCACAATCC) and psbA, (sequence is
GTTATGCATGAACGTAATGCTC) sample is expanded to examine template DNA quality.PCR reaction system is 25 μ L, including
60ng DNA profiling, upstream primer and each 0.5 μ L of downstream primer (10pmoL/ μ L), 0.125 μ L Ex Taq archaeal dna polymerase
(5U/ μ L), 2.5 μ 10 × PCR of L Buffer, 2 μ L dNTP, 20 μ L H2O.Reaction exists96 gradient pores PCR instruments are enterprising
Row.Response procedures are 94 DEG C of 4min；30 circulations: 94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 1min；72℃3min.After reaction,
Each sample takes 5 μ L amplified productions and 2 μ 6 × loading of L buffer to mix, and point sample is in containing 0.01%EB and 1% agarose
Gel on, electrophoresis about 30min under conditions of 200V voltage observes and records knot in JY04S-3E type gel imaging system
Fruit.
As shown in Figure 1, the results showed that the concentration of each sample to be tested DNA profiling is that 0.5ng/ μ L to 4000ng/ μ L is differed,
DNA profiling extraction quality is good, can be used for being tested, and respectively picks out a sample at random from 14 species and is shown.
Embodiment 4
Reaction system and amplified conditions optimization
Sample to be tested is rhizoma corydalis (sample number into spectrum is C283 in table 1)
(1) annealing temperature optimizes
Gradient is investigated with 2 DEG C of interval setting annealing temperature between 42 DEG C to 60 DEG C, therefrom finds optimum annealing temperature
Value.
Reaction system: 60ng DNA profiling, YAN-1F and each 0.5 μ L of YAN-1R (10pmoL/ μ L), 0.125 μ L r Taq
Archaeal dna polymerase (5U/ μ L), 2.5 μ 10 × PCR of L Buffer, 2 μ L dNTP, 20 μ L H2O。
Reaction existsIt is carried out in 96 gradient pores PCR instruments, response procedures are as follows: 94 DEG C of 4min；30 circulations: 94 DEG C of 30s,
52 DEG C of 30s, 72 DEG C of 1min；72℃3min.After reaction, each sample takes 5 μ L amplified productions and 26 × loading of μ L
Buffer is mixed, and point sample is on the gel containing 0.01%EB and 1% agarose, electrophoresis about 30min under conditions of 200V voltage,
Result is observed and recorded in JY04S-3E type gel imaging system.
(2) cycle-index optimizes
Using all reaction systems of step 1, the cycle-index of each reaction system is respectively set to 15 times, 20
Secondary, 22 times, 25 times and 30 times,PCR is carried out in 96 gradient pores PCR instruments reacts determining optimum cycle number.
(3) determination of best archaeal dna polymerase
Using all reaction systems in step (1), the r Taq archaeal dna polymerase in each reaction system is replaced respectively
Change Ex Taq archaeal dna polymerase and SpeedSTAR intoTMHS archaeal dna polymerase,PCR is carried out in 96 gradient pores PCR instruments
Reaction determines best archaeal dna polymerase type.
Reflect program 1:Ex Taq archaeal dna polymerase: 94 DEG C of 4min；30 circulations: 94 DEG C of 30s, 52 DEG C of 30s, 72 DEG C
1min；72℃3min；
Reflect program 2:SpeedSTARTMHS archaeal dna polymerase: 94 DEG C of 2min；30 circulations: 94 DEG C of 5s, 52 DEG C of 15s, 72
℃10s；72℃2min.
(4) optimal Template amount and template limit
Using all reaction systems of step (1), by the template quantity of each reaction system replace with respectively 1200ng,
600ng, 60ng, 6ng and 0.6ng,In 96 gradient pores PCR instruments carry out PCR reaction with determine optimal Template amount with most
Small DNA profiling detection limit.
As a result, it has been found that cycle-index, which identifies the AS-PCR of rhizoma corydalis, influences maximum, enzyme patterns affect is smaller, and temperature of annealing
Degree and template quantity have little effect.The result shows that annealing temperature DEG C each primer from 42 DEG C to 60 can detect certified products band, and
Adulterant is detected without band, and the band brightness of DEG C each primer pair amplifies item gradually increases from 42 DEG C to 50 or 52, from 50 or 52 DEG C to 60
DEG C gradually weaken (A in Fig. 2), therefore selects the optimum annealing temperature of primer pair Y1 for 50 DEG C to 52 DEG C；When cycle-index is reduced to
At 20 times, primer pair Y1 can Successful amplification go out certified products band, and adulterant is without band (B in Fig. 2), and optimum cycle number is
20；In 3 kinds of selected enzymes, r Taq enzyme, Ex Taq enzyme and SpeedSTARTMHS archaeal dna polymerase can successfully identify just
Product, preferred r Taq enzyme；When template quantity is 1200ng, 600ng, 60ng, 6ng, primer pair Y1 energy Successful amplification goes out certified products item
Band, adulterant is without band, and when wherein template quantity is 6ng, certified products band is shallower；But when template quantity is 0.6ng, as shown in figure 3,
Primer pair Y1 is unable to Successful amplification and goes out certified products band, thus primer pair Y1 be suitble to detection template quantity be more than or equal to 60ng,
Minimum template detection limit is 6ng.
Embodiment 5
Identify the specificity (application of SNP marker) of primer pair
To from 67 population 72 plants of plant samples (table 1) and 14 parts of medicinal material samples (table 2) respectively use primer pair Y1
It is detected.
According to optimum reaction condition obtained in embodiment 4, i.e. optimum annealing temperature is 52 DEG C, and optimum cycle number is 20
Secondary and archaeal dna polymerase is r Taq enzyme.It utilizesThe base of 96 gradient pores PCR instruments pair sample different from above-mentioned test individual
Because of a group DNA profiling, examine primer pair Y1 to the identification specificity of rhizoma corydalis.
All samples are expanded using primer pair Y1 as the result is shown, as shown in figure 4, only rhizoma corydalis sample is (in table 1
Sample number into spectrum is C283 and C275) there is purpose band, and remaining 13 sibling species is generated without band.Show to utilize primer pair
Y1 can be realized the AS-PCR specificity identification to rhizoma corydalis, and identify adaptable.
The above is only the preferred embodiment of the present invention, protection scope of the present invention is not limited in above-described embodiment, with
The various process programs of present inventive concept indifference are within the scope of the invention.
SEQUENCE LISTING
<110>Anhui University of Chinese Medecine
<120>SNP marker, ApoE gene method and the application of rhizoma corydalis are identified
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 842
<212> DNA
<213>rhizoma corydalis Corydalis yanhusuo
<400> 1
cctaaccaat tgggtggaaa aagagaggat ccattgatta gcttatctgt tgtcaccgag 60
gtattttatt ttttattttc ttactatata ccctgttttg actgtatcgt actatgtatc 120
atttgctaac ccaataaacc ctttgccttt gtttcaaagc gaatttcaaa tgaaggaatt 180
acaaggatat ttagaaatgg agagatccca gcaacaagac ttcctctatc cacttctttt 240
tcaggagtct ctttatgcac ttgctcatga ttatggttta aagggatcca gtccttacga 300
acccgtggaa aatgtaggtt atgataataa atccagttca ctgcttgtga aacgtttaat 360
tactcgaatg tatcaacaga agttgttgat tatttcggct aatgctttta caaaaaaaaa 420
ttattatcaa atggtatctg ccggattttc agtcattttg gaaatgaaat tctcactgcg 480
attagtgtct tcgcaagaag ggaaagatct acaaaaatat caaaatttac gctcaattca 540
ttcaacattt tcctttttag aggataaatt ataccattta aataatgtat cagagatact 600
aataccctac cccattcatc tggaaatctt ggttcaaaat ctccgctctt ggatacaaga 660
tgccccctct ttacatttat tccgactctt tctccacgag tctcgtaatt ggactagtct 720
gattactaaa aagaaatcca tctctgtttt ttcaaaagag aatcaaagat tcttcttgtt 780
cctatataat tctcatgtat atgaatggga atccctattc atgtttctcc gtaaacaatc 840
tt 842
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<400> 2
tcactgcgat tagtgtctta g 21
<210> 3
<211> 24
<212> DNA
<213>artificial sequence
<400> 3
tctttgattc tcttttgaaa aagc 24
Claims (10)
1. for identifying the SNP marker of rhizoma corydalis, it is characterised in that: the SNP marker such as SEQ ID NO.1 institute
Show, is SNP1 and/or SNP2, wherein SNP1 is the 493rd bit base of the sequence as shown in SEQ ID NO.1, and base is G herein,
Then it is accredited as rhizoma corydalis；Wherein SNP2 is the 746th bit base of the sequence as shown in SEQ ID NO.1, and base is G herein, then reflects
It is set to rhizoma corydalis.
2. the application of SNP marker according to claim 1, it is characterised in that: be following (a1) appointing into (a3)
It anticipates one kind:
A1: the application in the identification or auxiliary identification rhizoma corydalis of the rhizoma corydalis molecular labeling is detected；
A2: application of the substance of the rhizoma corydalis molecular labeling in preparation identification or auxiliary identification rhizoma corydalis product is detected；
A3: application of the SNP marker in rhizoma corydalis molecular mark.
3. the specific primer based on allele PCR detection rhizoma corydalis is to Y1, it is characterised in that: including upstream primer YAN-
1F:5 '-TCACTGCGATTAGTGTCTTAG-3 ', the upstream primer YAN-1F sequence as shown in SEQ ID NO.2, draw by downstream
Object YAN-1R:5 '-TCTTTGATTCTCTTTTGAAAAAGC-3 ', the downstream primer YAN-1R sequence such as SEQ ID NO.3 institute
Show.
4. the application of primer pair according to claim 3, it is characterised in that: any one into (b3) for following (b1)
Kind:
B1: identify untested medicinal material whether be or sample to be tested in whether contain rhizoma corydalis；
B2: preparation for identify untested medicinal material whether be or sample to be tested in whether the kit containing rhizoma corydalis；
B3: the application in rhizoma corydalis breeding.
5. the application of the primer pair according to 4, it is characterised in that: further include archaeal dna polymerase, PCR buffering in the kit
Liquid, dNTPs.
6. the method based on ApoE gene detection rhizoma corydalis, it is characterised in that: the following steps are included:
(1) sample to be tested genomic DNA is extracted；
(2) using the genomic DNA of sample to be tested as template, pcr amplification reaction is carried out using above-mentioned primer pair, amplification is containing such as
The segment of sequence shown in SEQ ID NO.1；
(3) pcr amplification product is detected.
7. the method according to claim 6 based on ApoE gene detection rhizoma corydalis, it is characterised in that: institute
Stating PCR reaction system in step (2) includes the primer pair, archaeal dna polymerase, PCR buffer, the sample to be tested genome
DNA, dNTPs and water.
8. the method according to claim 6 based on ApoE gene detection rhizoma corydalis, it is characterised in that: institute
Stating the minimum template detection limit of primer pair Y1 in step (2) is respectively 60ng, mole of the primer pair YAN-1F and YAN-1R
Than for 1:1.
9. the method according to claim 6 based on ApoE gene detection rhizoma corydalis, it is characterised in that: institute
It states PCR amplification program in step (2) to include denaturation, annealing and extend, the annealing temperature is 42 DEG C -60 DEG C, 3 steps
Cycle-index be 20.
10. the method according to claim 6 based on ApoE gene detection rhizoma corydalis, it is characterised in that: inspection
The sequence of pcr amplification product in step (3) is surveyed, the PCR product contains DNA fragmentation shown in SEQ ID NO.1 sequence, institute
Stating sample to be tested is rhizoma corydalis；The PCR product is described to be measured without containing DNA fragmentation shown in SEQ ID NO.1 sequence
Sample is non-rhizoma corydalis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811013860.3A CN108998560A (en) | 2018-08-31 | 2018-08-31 | Identify SNP marker, ApoE gene method and the application of rhizoma corydalis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811013860.3A CN108998560A (en) | 2018-08-31 | 2018-08-31 | Identify SNP marker, ApoE gene method and the application of rhizoma corydalis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108998560A true CN108998560A (en) | 2018-12-14 |
Family
ID=64591393
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811013860.3A Pending CN108998560A (en) | 2018-08-31 | 2018-08-31 | Identify SNP marker, ApoE gene method and the application of rhizoma corydalis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108998560A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111378777A (en) * | 2018-12-27 | 2020-07-07 | 株式会社津村 | Primer set for identifying crude drug and crude drug identification method using the same |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101440401A (en) * | 2008-12-18 | 2009-05-27 | 浙江大学 | Method for identifying Rhizoma Corydalis Repentis |
| CN105624305A (en) * | 2016-02-18 | 2016-06-01 | 广东省第二中医院（广东省中医药工程技术研究院） | Quick identifying method of Rhizoma corydalis |
-
2018
- 2018-08-31 CN CN201811013860.3A patent/CN108998560A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101440401A (en) * | 2008-12-18 | 2009-05-27 | 浙江大学 | Method for identifying Rhizoma Corydalis Repentis |
| CN105624305A (en) * | 2016-02-18 | 2016-06-01 | 广东省第二中医院（广东省中医药工程技术研究院） | Quick identifying method of Rhizoma corydalis |
Non-Patent Citations (3)
| Title |
|---|
| JIANG,L., LI,M., ZHAO,F，等: "Corydalis yanhusuo isolate C283 maturase K (matK) gene, partial cds; chloroplast GenBank: MF573617.1", 《GENBANK》 * |
| LU JIANG, MEIHUI LI, FENGXI ZHAO等: "Molecular Identification and Taxonomic Implication of Herbal Species in Genus Corydalis (Papaveraceae)", 《MOLECULES》 * |
| 林万明: "《PCR技术操作和应用指南》", 30 September 1993, 人民军医出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111378777A (en) * | 2018-12-27 | 2020-07-07 | 株式会社津村 | Primer set for identifying crude drug and crude drug identification method using the same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105385778A (en) | Primers and method for detecting SNP gene typing of AhFAD2B genes of peanuts in high throughput | |
| CN107201410A (en) | ARMS qPCR methods and kit for helicobacter pylori individuation genetic test | |
| Reunova et al. | Polymorphism of RAPD, ISSR and AFLP markers of the Panax ginseng CA Meyer (Araliaceae) genome | |
| CN110628944A (en) | Duck type-3 adenovirus and duck novel reovirus differential diagnosis kit | |
| CN106282373A (en) | A kind of Herba Dendrobii and the contrast authentication method of Henan Herba Dendrobii | |
| CN104073550A (en) | SCAR molecular mark for performing sex identification of siraidia grosvenorii | |
| CN107236819A (en) | The method of high throughput identification muskmelon purity of hybrid | |
| CN106498037B (en) | Dendrobium officinale identification method based on double-block site specificity PCR | |
| CN103993089B (en) | A kind of multiple fluorescence quantitative PCR detection kit and detection method thereof of vancomycin-resistant enterococcus | |
| CN108998560A (en) | Identify SNP marker, ApoE gene method and the application of rhizoma corydalis | |
| CN108866205A (en) | Identify the specific primer of hiruto based on molecular biology method | |
| Jiang et al. | Conventional octaplex PCR for the simultaneous identification of eight mainstream closely related Dendrobium species | |
| CN108998559A (en) | Identify SNP marker, ApoE gene method and the application of Corydalis remota | |
| CN107475462B (en) | Kit for identifying common serotype chicken inclusion body hepatitis infection and application thereof | |
| CN104593510A (en) | Primer, probe and method for detecting SNP allele variation of peanut FAD2 genes | |
| CN108866236A (en) | Identify SNP marker, ApoE gene method and the application of decumbent corydalis tuber | |
| CN110885898B (en) | Molecular specific marker primer and method for identifying amaranthus rugosus and 2 common confused products | |
| KR101346261B1 (en) | Sets of primers and TaqMan MGB probes for real-time PCR-based assays to discriminate ginseng cultivars | |
| CN106755389A (en) | Gene order and its application for identifying tapiscia sinensis sex | |
| CN106282372A (en) | Herba Dendrobii and the comparison authentication method of Dendrobium loddigesii | |
| CN106148560A (en) | A kind of comparison authentication method for Herba Dendrobii with weight lip Herba Dendrobii | |
| KR20160057021A (en) | HRM Primer sets for discriminating Korean and American ginseng and uses thereof | |
| CN108950015A (en) | Identify the multiple PCR detection kit and its detection method of Pomacea canaliculata hybrid | |
| CN111485031A (en) | Rice molecular marker DOF8 and application thereof, and method for identifying japonica rice and indica rice by using rice molecular marker DOF8 | |
| CN107760801A (en) | Differentiate the RT PCR primers and its detection method of H5N6 hypotype AIV neuraminidase NA genes Asia branch |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181214 |