CN108998468A - A kind of screening technique of transgenic positive tissue - Google Patents
A kind of screening technique of transgenic positive tissue Download PDFInfo
- Publication number
- CN108998468A CN108998468A CN201810733940.XA CN201810733940A CN108998468A CN 108998468 A CN108998468 A CN 108998468A CN 201810733940 A CN201810733940 A CN 201810733940A CN 108998468 A CN108998468 A CN 108998468A
- Authority
- CN
- China
- Prior art keywords
- transgenic
- dsred
- binary vector
- screening
- screening technique
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The promoter for introducing Kpn I and Xba I restriction enzyme site third step is connected to this application discloses a kind of screening technique of transgenic positive tissue to have connected on the binary vector of upper DsRED gene；Fusion plasmid containing the promoter and the binary vector of DsRED gene is imported into Agrobacterium, the engineering bacteria that can be used for mediated transformation plant cell is formed；Utilize the callus of above-mentioned engineering bacteria rice transformation.Whether successfully the method for the present invention can be observed that a kind of transgenosis efficiently reporter gene detection method at plant transgene initial stage, provide foundation for subsequent efficient positive plant screening.
Description
Technical field
The present invention relates to genetic engineering genetic thremmatology and biological heredity improving technology field, in particular to a kind of transgenosis
The screening technique of assaypositive tissue.
Background technique
Rice is one of most important cereal crops at past half as the staple food for being in the world more than half population
In more centuries, the specific yield that rice breeding achieves huge success rice realizes multiplication, and some areas are even improved extremely
3 times, this is to ensure that world food has made safely huge contribution but in recent ten years the yield stagnation of rice, this
Aspect is another party since do not have new breakthrough and genetic diversity in cultivar on breeding technique gradually narrows
Face is also in that the natural calamities such as pest and disease damage and drought frequently occurred make Rice Production suffer heavy losses however, world
The sustainable growth of mouth and the fast development of social economy cause to be continuously increased the demand of grain.
For these problems, Chinese scholar proposes the imagination for cultivating green super hybridization rice, around Rice Resistance disease pest, drought resisting,
The five big important characters such as nutrient efficient utilization, high-quality, high yield carry out improvement comprehensively to rice varieties to realize the sustainable of agricultural
Develop and transgenic technology as a kind of emerging breeding technique, will play a significant role on realizing green super hybridization rice target
The transgenic research of rice starts from phase late 1980s, has a large amount of transgenic paddy rice research so far and is reported
Road.
Transgenic Rice technology starts from Protoplast cuhnre, and 1985 successfully complete from rice protoplast regeneration for the first time
Plant；First transgenic rice plant is obtained in japonica rice variety within 1988；Nineteen ninety is from rice variety Chinsurah
First case transgenic indica type rice plant is obtained in Boro II；Nineteen ninety Li Baojian etc. infects rice tissue with Agrobacterium and is converted
Callus；Transgenic plant is successfully obtained with particle bombardment using Rice Young Embryo as acceptor material, and is turned within 1991
Change efficiency to significantly improve.
From this, rataria is widely studied application as transgenic acceptor.1993 with agrobacterium co-cultivation in japonica rice product
Transgenic plant is obtained on kind, hereafter, particle bombardment and agrobacterium-mediated transformation are wide as the path for transformation of most worthy
It is general to be studied for Transgenic Rice.
Using transgenic method obtain transgenic plant and its generation offspring, how to prove foreign gene be transferred to by
Body, or stablize heredity.Mainly divide following level to identify: 1) identification of exogenous origin gene integrator mainly has Southern hybridization
It is detected with PCR method positive.2) identification of transcription of foreign genes level has Northern hybridization and RT-PCR (reverse
Transcribed PCR) detection method.3) detection of exogenous gene expression protein, there are mainly three types of: 1. biochemical reaction detection method:
Mainly detected by enzyme reaction；2. immunological detection: by the specific binding of destination protein (antigen) and its antibody into
Row detection, as Western hybridizes；3. the detection of biological activity.4) the enzyme process detection of reporter gene, common reporter gene
Have: gus, no, ocs etc..
Certainly last transgenic plant must be transplanted in crop field, carry out field test, not only will also be to it to Ameliorative character
Its economical character is evaluated, the excellent strain of breeding Comprehensive Traits.A large amount of financial resources and manpower can be spent in this way, and can be spent
Take longer time.
CaMV35S promoter refers to the 35S promoter from cauliflower mosaic virus (CaMV).This promoter is in plant
During being infected by CaMV, 35S RNA is instructed to synthesize, and be allowed to the high efficient expression in the tissue of many dicotyledons, but it
It is a kind of monocotyledonous weaker promoter.CaMV35S promoter as a kind of constitutive promoter in all organizations
Can promotor gene expression, have duration, do not show Space-time speciality；RNA and protein expression quantity are also relative constant.
Summary of the invention
Technical problem to be solved by the present invention lies in the present invention provides one kind based on DsRED fluorescence protein gene is
The transformation of the engineered strain of reporter gene, the method for the present invention can plant transgene initial stage be observed that transgenosis whether at
A kind of efficiently reporter gene detection method of function provides foundation for subsequent efficient positive plant screening.
In order to solve the above technical problems, the present invention provides a kind of screening technique of transgenic positive tissue, including it is following
Step:
The first step is expanded using the plasmid containing DsRED segment as template using primer, and DsRED segment is obtained；
Second step, using binary vector plasmid as template, amplification obtains both ends and contains opening for Kpn I and X ba I restriction enzyme site
Promoter fragment；
The DsRED segment for introducing X ba I and BamH I restriction enzyme site is inserted on the binary vector by third step；
The promoter for introducing Kpn I and X ba I restriction enzyme site is connected to third step and has connected upper DsRED by the 4th step
On the binary vector of gene；
Fusion plasmid containing the promoter and the binary vector of DsRED gene is imported into Agrobacterium by the 5th step,
Form the engineering bacteria that can be used for mediated transformation plant cell；
6th step utilizes the callus of above-mentioned engineering bacteria rice transformation；
7th step, after to the callus tissue culture converted in the 6th step, the successful cell of screening transgenic.
The method further includes:
8th step detects the regrowth induced.
The method further includes:
8th step detects positive seedling by the regrowth induced by detecting using red fluorescence amplification and irradiation
With false positive seedling.
The third step further comprises: the DsRED segment for introducing X ba I and BamH I restriction enzyme site is inserted into
On pCAMBIA1300 binary vector.
In the third step, linked system further comprises:
Connect a stay overnight under the conditions of 16 DEG C.
In order to solve the above technical problems, the present invention also provides used in a kind of screening of transgenic positive tissue by enzyme
The genetic fragment of enzyme site is inserted into the linked system on binary vector, and the linked system includes:
Connect a stay overnight under the conditions of 16 DEG C.
In order to solve the above technical problems, the present invention also provides the screenings of the transgenic positive tissue as described in aforementioned any one
Application of the method in Transgenic Rice engineering.
In order to solve the above technical problems, the present invention also provides as the screening technique of the transgenic positive tissue screens
Plant transgene assaypositive tissue.
It is reporter gene that beneficial effect of the present invention, which includes: that the present invention provides a kind of based on DsRED fluorescence protein gene,
The transformation of engineered strain, the method for the present invention can be observed that whether transgenosis is successfully a kind of fast at plant transgene initial stage
Prompt reporter gene detection method provides foundation for subsequent efficient positive plant screening.
Detailed description of the invention
Fig. 1 is that DsRED gene PCR described in the embodiment of the present invention expands detected through gel electrophoresis figure；
Fig. 2 is 35S promoter PCR amplification detected through gel electrophoresis figure described in the embodiment of the present invention；
Fig. 3 is fluorescence irradiating and detecting transgenic cell figure described in the embodiment of the present invention.
Specific embodiment
The present invention is described in detail below with reference to embodiment.To keep the objectives, technical solutions, and advantages of the present invention clearer, bright
Really, the present invention is described in more detail below, but the invention is not limited to these embodiments.
In order to solve the above technical problems, the present invention provides a kind of screening technique of transgenic positive tissue, including it is following
Step:
The first step is expanded using the plasmid containing DsRED segment as template using primer, and DsRED segment is obtained；
Second step, using binary vector plasmid as template, amplification obtains both ends and contains opening for Kpn I and X ba I restriction enzyme site
Promoter fragment；
The DsRED segment for introducing X ba I and BamH I restriction enzyme site is inserted on the binary vector by third step；
The promoter for introducing Kpn I and X ba I restriction enzyme site is connected to third step and has connected upper DsRED by the 4th step
On the binary vector of gene；
Fusion plasmid containing the promoter and the binary vector of DsRED gene is imported into Agrobacterium by the 5th step,
Form the engineering bacteria that can be used for mediated transformation plant cell；
6th step utilizes the callus of above-mentioned engineering bacteria rice transformation；
7th step, after to the callus tissue culture converted in the 6th step, the successful cell of screening transgenic.
The method further includes:
8th step detects the regrowth induced.
The method further includes:
8th step detects positive seedling by the regrowth induced by detecting using red fluorescence amplification and irradiation
With false positive seedling.
The third step further comprises: the DsRED segment for introducing X ba I and BamH I restriction enzyme site is inserted into
On pCAMBIA1300 binary vector.
In the third step, linked system further comprises:
Connect a stay overnight under the conditions of 16 DEG C.
In order to solve the above technical problems, the present invention also provides used in a kind of screening of transgenic positive tissue by enzyme
The genetic fragment of enzyme site is inserted into the linked system on binary vector, and the linked system includes:
Connect a stay overnight under the conditions of 16 DEG C.
In order to solve the above technical problems, the present invention also provides the screenings of the transgenic positive tissue as described in aforementioned any one
Application of the method in Transgenic Rice engineering.
In order to solve the above technical problems, the present invention also provides as the screening technique of the transgenic positive tissue screens
Plant transgene assaypositive tissue.
35S promoter is carried out chain rear rice transformation mature embryo with red fluorescent gene (DsRed) gene and lured by the present invention
The callus led can quickly carry out transgenosis successful in the callus cell stage from the appearance and be verified.
For achieving the above object, the present invention is achieved by the following scheme:
A, the acquisition of DsRed gene；
B, the acquisition of 35S promoter；
C, the connection of each gene expression element
The acquisition of each gene expression element and Connection Step include:
The first step is expanded using the pGDR plasmid containing DsRED segment as template using above-mentioned primer, and DsRED is obtained
Segment.Amplification system is as follows:
Amplification program:
Second step, using commercialized pCAMBIA1300 binary vector plasmid as template, by utilizing 35S-F 5 '
gggactctagaggatcc TGGTGGC-3′；5 ' AAGCTCCGAGGAGGTTTCCGGATA-3 ' amplification of 35S-R obtains 35S and opens
Mover obtains the 35S promoter segment that Kpn I and X ba I restriction enzyme site is contained at both ends；Amplification system is as follows:
Amplification program:
The DsRED segment for introducing X ba I and BamH I restriction enzyme site is inserted into pCAMBIA1300 double base and carried by third step
On body；
Linked system are as follows:
Connect a stay overnight under the conditions of 16 DEG C
The 35S promoter for introducing Kpn I and X ba I restriction enzyme site is connected to third step and connected by the 4th step
On the pCAMBIA1300 carrier of DsRED gene；
Linked system are as follows:
Connect a stay overnight under the conditions of 16 DEG C
Fusion plasmid containing 35S promoter and the pCAMBIA1300 carrier of DsRED gene is imported into agriculture by the 5th step
In bacillus, the engineering bacteria that can be used for mediated transformation plant cell is formed；
6th step utilizes the callus of above-mentioned engineering bacteria rice transformation.
Its laboratory operating procedures are as follows:
1) it induces: after rice paddy seed decladding disinfection, mature embryo being inoculated in induced medium, induces embryo callus subculture group
It knits；
2) it infects: callus obtained by step 1) being separated with endosperm, bud, is inoculated in agrobacterium suspension and infects, it
After dry it is stand-by；
3) it co-cultures: the callus dried being gone to and is co-cultured in base, thallus occurs in culture to callus surface；
4) it screens: carrying out resistance screening for being inoculated into screening and culturing medium after the callus cleaning after co-cultivation, obtain
Resistant calli；
5) break up: the resistant calli of acquisition being inoculated on differential medium and is cultivated to differentiating seedling；
6) it takes root: will take root on seedling inoculation to root media, and carry out PCR detection, select the plant of test positive
The japonica rice plant that strain is obtained as conversion；
The specific formula of involved culture medium is as follows:
YEB culture medium: yeast extract 0.8-1.2g/L；Peptone 4.5-5.0g/L；Beef extract 4.5-5.0g/L；Sucrose
4.0-6.0g/L；Magnesium sulfate 0.3-0.5g/L；Agar 12-15g/L；pH 6.8-7.2；
Induced medium: NB；2,4-D 1.8-2.0mg/mL；6-BA 0.1-0.2mg/mL；Agar powder 10-15g/L；
Subculture medium: NB；2,4-D 1.8-2.0mg/mL；CH 0.2-0.3g/L；Sucrose 28-30g/L；Agar powder 10-
15g/L；
Co-culture medium: NB；AS 100-200umol/L；
Screening and culturing medium: NB；2,4-D 1.8-2.0mg/mL；6-BA 0.1-0.2mg/mL；Hyg 20-25mg/L,
Timentin 200-400mg/L, agar powder 10-15g/L；
Differential medium: NB；Pro 0.3-0.5g/L；CH 0.2-0.3g/L；6-BA 1.8-2.0mg/mL；KT 0.8-
1.0mg/mL；NAA 0.3-0.5mg/mL, IAA 0.4-0.5mg/mL；Hyg 20-25mg/L；Timentin 200-400mg/
L；Sucrose 25-30g/L；Agar powder 10-15g/L；
Root media: NB；NAA 0.4-0.7mg/L；Sucrose 25-30g/L；The 7th step of agar powder 10-15g/L, passes through
It behind callus tissue culture 7-10 days converted in the 6th step, is irradiated using fluorescence, observes the part to fluoresce in callus,
The successful cell of screening transgenic.The part to fluoresce taken off with scalpel, is transferred on new culture medium, is trained
It supports.
8th step detects positive seedling by the regrowth induced by detecting using red fluorescence amplification and irradiation
With false positive seedling.
Other explanations:
1, primer needed for DsRED gene magnification
DsRED-F5′TCTAGAGCCATGGCCTCCTCCGAGAA-3′；
DsRED-R 5′-GGATCCTTACAGGAACAGGTGGTGGC-3′
2, primer needed for 35S promoter expands
35S-F 5′gggactctagaggatcc TGGTGGC-3′；
35S-R 5′AAGCTCC GAGGAGGTTTCCGGATA-3′
3, DsRED gene order
TTATAAGACGGAGCTCATTGTCGCTCGTCAGCGGGTTGATGCTGAAACTTCCTATTGTGGGTTTGTATG
CCTCCTCCCGTCCGACCTGAGCGTTAAAATCTCCGATAACTATCTGCACATGGGCAGCAGATGTGCTCCATCTCCAA
CTGCGTATAGAAGATCTCCGTCTCGTCATCGGAGTTTCCAAGGTGCGGACTGTACACATTAATAATGCTGAGGTTGA
AGAACCTGCCACGGATTCTTAGCCTGCACATTCGCTCATTGATCGATCACCATCCGATCACCCACTTTCGCATCTCC
CCTATGATCAGGAACACCGAACCGAGCTCATGCTTTTCAACCCCTGCTCTGGTAGATTATGCAGTCACTGCGATGGA
GGCGCTCCGAAACCCCTTTCCAGCGCAACTCTTGTAGTGCTACTATTTCGAAGCCGTCCTCGTCCATAAGAATGCGG
GTGCTTTCAGGTGCCGTGAGTGATCTGCAGTTCCATGTCTCGAGTTTCCAATCGTGTGTTTTGTTTCGCAGCATTGG
TCTATAATCGTTGAATCCGATTCGAAACTTCATGGTTTTCGATCGTTGCGTTTATATTGAGGGAGGCTTGCAAGGCT
GCTTCCCCGACACCTCATCTCGTCGGAGGGACCCGTAGGACAGGAGGGACGACCAGCCGCCCCTAACAAGGAGAACA
GAGGCTAGCTATCCCCCTCCACTCAATTTAGCCATATCACCCATCTTCCCAAGGGATTGGGTTTTCACGTTTACCCA
AGCTCAGATATTTGGAGAGACATGTTACCATTCTATACGCCGGGAACGTATTGAATTGAAGTGAGGTGGAGAGTCTA
TGTTAATCTTCAAGAGGCTTCGGATCCATACTATATACAATATGAGAGATGGTTTTCATAATATTGGGAAAAATTCA
TCTGAGCATCTCCATCTCAAACGCAGCTTAGGAAGGACAAAGCTAAGATGTCTCAAAGACGTATTTGAAGTACTGGG
GACTATACATGTCTGTCAGTCCAGCATCGTCCGCGGCGGACAAGTATTTTGAAGTGGAGAACTTTCTCATGACCAGT
TGACAGCCAGCACAACTCAACATCAATGTTGGTGTCGGACTTGATTTTTGATCCCTGATAAGTGAGTTTTGAACGAT
TTCAAAGATACGATCACCTCGCCCAAGTTGGTGGTTTTCGGCCCCTTTAACTTCAACCCGAGGCTAAGTGCCGATCG
CTCGATCCTTTGGAAAGCTAGGATAGAAGAGCCTCAAACCAATGATGTCTATGTCATCTATGTTTGGTGCGGATACA
CCGCCAGTGAAACAAGTGTAATAAGAATAAACTTTGATTATTTAATATTTTTTTACCTTCGCATAATGTATTTGACG
AACTTACCATGATTTATATCTGTTGGCAAAATGAGACAATTTATTCATGTTCTGCGTATACTTTAATGATCATCGTA
TTGCAACATGCTTGTTTAACCATTATTTATCAAACATTACTTTTCTCTCTACTTGTGCACAGTAAAGCAGGTGCCAT
TTGCTTAACACTAACAAAAGCTGTACAAATACTGGGGACGGTTCCGAGGTCCGACGATCGTCCGAGTTTTCCCTTAT
AAAAGCGCCGCGATCGTAACGTAAAGATCATCAGTAGAATTTGCTCTTTTCCACAGTTCACAGGTGAATAAACGATG
AAGCTTGCCTCCTCCGAGAACGTCATCACCGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCA
CGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGG
GCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCC
GCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGG
CGGCGTGGCGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGA
ACTTCCCCTCCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGC
GACGGCGTGCTGAAGGGCGAGACCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTC
CATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACGCCAAGCTGGACATCACCTCCCACA
ACGAGGACTACACCATCGTGGAGCAGTACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTGAGATCTCGAGCACCA
CCACCACCACCACTAACCTAGGTAGCTGAGCGCATGCGATCTCGGCTTCAAAACGGTACTGGATTTTGGATTCAAAC
GAAAGCCATCGCTACAACAGAACAAATAAAAGAACATTAATCAAAACGCATAAAAGATGGGTTAATTGTATTCAATA
AGGAGAAAAGTAATTCCTACTAGATAGTTTACTATCACGCGAAAGGATGGCCAGTCTTCACTACGGGAAGACAACCT
CGCTGGGAATCGAAACTCTGTCAACGCTGGAGGTGCCAACACATCTTCGTAATAAACATTTTTACATTTATCCAGGC
GTAAAGAAACACGATTTAGTTATCAATTTGTATTTTTGGTTCTTATGAAGAATAAACTTCTTCAAATTCACTTCCAC
GAATATTCCGTCCCGTTCCGCCAGTTCCATTCGAGCTC
4,35S promoter sequence
GGATCCTCTAGAGTCCCCCGTGTTCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGC
GAAGGAIAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATTCCAGATAGGCCTAACGCTTGTCCAAGATCTAT
TCAGGATTCCAGATAGGCCTAACGCTTGTCCAAGATCTATTCAGGATATCACATCAATCCACTTGCTTTGAAGACGT
GGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCAT
CTTCAACGATGGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATA
AAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATA
1 transgenic seedling qualification result of table
The above is only several embodiments of the present invention, not any type of limitation is done to the present invention, although this hair
It is bright to be disclosed as above with preferred embodiment, however be not intended to limit the invention, any person skilled in the art, it is not taking off
In the range of technical solution of the present invention, a little variation or modification are made using the technology contents of the disclosure above and is equal to
Case study on implementation is imitated, is belonged in technical solution of the present invention protection scope.
Claims (8)
1. a kind of screening technique of transgenic positive tissue, which comprises the following steps:
The first step is expanded using the plasmid containing DsRED segment as template using primer, and DsRED segment is obtained；
Second step, using binary vector plasmid as template, amplification obtains the promoter that Kpn I and X ba I restriction enzyme site is contained at both ends
Segment；
The DsRED segment for introducing X ba I and BamH I restriction enzyme site is inserted on the binary vector by third step；
The promoter for introducing Kpn I and X ba I restriction enzyme site is connected to third step and has connected upper DsRED gene by the 4th step
Binary vector on；
Fusion plasmid containing the promoter and the binary vector of DsRED gene is imported into Agrobacterium by the 5th step, is formed
It can be used for the engineering bacteria of mediated transformation plant cell；
6th step utilizes the callus of above-mentioned engineering bacteria rice transformation；
7th step, after to the callus tissue culture converted in the 6th step, the successful cell of screening transgenic.
2. the screening technique of transgenic positive tissue according to claim 1, which is characterized in that the method is further wrapped
It includes:
8th step detects the regrowth induced.
3. the screening technique of transgenic positive tissue according to claim 2, which is characterized in that the method is further wrapped
It includes:
8th step detects positive seedling and vacation by the regrowth induced by detecting using red fluorescence amplification and irradiation
Positive seedling.
4. the screening technique of transgenic positive tissue according to claim 1, which is characterized in that the third step, further
It include: that the DsRED segment for introducing X ba I and BamH I restriction enzyme site is inserted on pCAMBIA1300 binary vector.
5. the screening technique of transgenic positive tissue according to claim 1, which is characterized in that in the third step, connection
System further comprises:
Connect a stay overnight under the conditions of 16 DEG C.
6. the genetic fragment of restriction enzyme site is inserted on binary vector used in a kind of screening of transgenic positive tissue
Linked system, which is characterized in that the linked system includes:
Connect a stay overnight under the conditions of 16 DEG C.
7. the screening technique of transgenic positive tissue is in Transgenic Rice engineering as described in any one of Claims 1 to 5
Using.
8. the plant transgene of the screening technique screening of transgenic positive tissue is positive as described in any one of Claims 1 to 5
Tissue.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810733940.XA CN108998468A (en) | 2018-07-05 | 2018-07-05 | A kind of screening technique of transgenic positive tissue |
| PCT/CN2018/124188 WO2020007001A1 (en) | 2018-07-05 | 2018-12-27 | Method for obtaining third-generation maintainer line and method for screening positive transgenic tissue |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810733940.XA CN108998468A (en) | 2018-07-05 | 2018-07-05 | A kind of screening technique of transgenic positive tissue |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108998468A true CN108998468A (en) | 2018-12-14 |
Family
ID=64598460
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810733940.XA Pending CN108998468A (en) | 2018-07-05 | 2018-07-05 | A kind of screening technique of transgenic positive tissue |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108998468A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020007001A1 (en) * | 2018-07-05 | 2020-01-09 | 青岛袁策集团有限公司 | Method for obtaining third-generation maintainer line and method for screening positive transgenic tissue |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063083A (en) * | 2015-07-16 | 2015-11-18 | 湖南杂交水稻研究中心 | Method for creating rice engineering maintainer lines preventive against gene flow and application of rice engineering maintainer lines |
| CN107455256A (en) * | 2017-09-29 | 2017-12-12 | 江苏丘陵地区镇江农业科学研究所 | A kind of hybrid rice breeding method |
| CN108148855A (en) * | 2017-12-31 | 2018-06-12 | 青岛袁策生物科技有限公司 | A kind of rice genetic engineering sterile line breeding method |
-
2018
- 2018-07-05 CN CN201810733940.XA patent/CN108998468A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063083A (en) * | 2015-07-16 | 2015-11-18 | 湖南杂交水稻研究中心 | Method for creating rice engineering maintainer lines preventive against gene flow and application of rice engineering maintainer lines |
| CN107455256A (en) * | 2017-09-29 | 2017-12-12 | 江苏丘陵地区镇江农业科学研究所 | A kind of hybrid rice breeding method |
| CN108148855A (en) * | 2017-12-31 | 2018-06-12 | 青岛袁策生物科技有限公司 | A kind of rice genetic engineering sterile line breeding method |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020007001A1 (en) * | 2018-07-05 | 2020-01-09 | 青岛袁策集团有限公司 | Method for obtaining third-generation maintainer line and method for screening positive transgenic tissue |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105063083B (en) | Prevent method for creating and its application of the Rice Engineering maintainer of genetic drift | |
| CN107988229A (en) | A kind of method for obtaining the rice that tiller changes using CRISPR-Cas modification OsTAC1 genes | |
| CN108103092A (en) | System and its application for downgrading rice are obtained using CRISPR-Cas systems modification OsHPH genes | |
| CN103444524B (en) | Method for quickly building genetic transformation regeneration system of grapes | |
| CN104846009B (en) | A kind of construction method of Rice Engineering maintainer and its application | |
| CN107338266A (en) | A kind of VIGS silencing systems for identifying mulberry tree MmPDS genes and its construction method and application | |
| CN105543268B (en) | Plant is improved to the method for resistance to verticillium wilt using verticillium wilt pathogen VdP4-ATPase gene | |
| CN104928318B (en) | Application of 1 genes of rice Os LEA5c in preventing from heavy metal rice varieties are cultivated | |
| CN105695461B (en) | A kind of specifically expressed promoter of wheat flag leaf and its application | |
| CN108823240A (en) | A kind of method and its application for formulating anti-tomato yellow leaf curl virus disease tomato new germ plasm by gene editing | |
| CN108998468A (en) | A kind of screening technique of transgenic positive tissue | |
| CN108396035A (en) | A kind of agriculture bacillus mediated rice transformation method | |
| CN109022468A (en) | The preparation method of plant callus | |
| CN108977458A (en) | Plant transgene cell preparation method | |
| CN109022479A (en) | A kind of screening technique of callus phase | |
| CN107435044A (en) | The promoter of paddy rice stamen specifically expressing and its application | |
| CN109022446A (en) | Transgenic Rice cell preparation method | |
| CN109136255A (en) | A kind of method that Transgenic Rice positive cell quickly screens | |
| CN110106171A (en) | Long-chain non-coding RNA and its application in regulation plant frigostabile | |
| CN106397558A (en) | Application of protein and encoding gene of protein in regulation of verticillium wilt resistance of plants | |
| CN106434689A (en) | Plant disease-resistant essential gene ShORR-1 and application thereof | |
| CN105968178A (en) | Application of rice OsRAD1 protein or encoding gene thereof in regulating pollen fertility | |
| CN106244595B (en) | China fir phytosulfokine-α CLPSK1 gene and its application | |
| CN106866802B (en) | PSF protein related to plant photosynthesis as well as encoding gene and application thereof | |
| CN109652445A (en) | A kind of construction method of high frequency zone transgenic plant carrier |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181214 |