CN108998466A - The construction method of high-efficient cloning carrier and application in one primary yeast - Google Patents
The construction method of high-efficient cloning carrier and application in one primary yeast Download PDFInfo
- Publication number
- CN108998466A CN108998466A CN201810882165.4A CN201810882165A CN108998466A CN 108998466 A CN108998466 A CN 108998466A CN 201810882165 A CN201810882165 A CN 201810882165A CN 108998466 A CN108998466 A CN 108998466A
- Authority
- CN
- China
- Prior art keywords
- carrier
- xcm
- follows
- pyes2
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
Abstract
The present invention relates to the construction method of high-efficient cloning carrier in a primary yeast, the carrier is pYES2-T, has used a pair of adapter-primer specifically added and the host cell containing pYES2-T in the method.The method of the present invention is by constructing the high-efficient cloning carrier applied in yeast, carrier is set to generate two ends T outstanding after I digestion of Xcm, on the one hand TA clone can be directly carried out in such a way that PCR product adds A, the carrier remains the multiple cloning sites of original vector, the use for facilitating downstream to test；On the other hand it utilizes under the regulation of galactolipin evoked promoter, the inducing expression in yeast of the gene after being cloned to TA.Using this transformation carrier, can with high throughput a large amount of cDNA libraries be carried out with the screening of target gene；The Yeast expression carrier of the method for the present invention building is easy to use, and high-efficient, at low cost, application prospect is extensive.
Description
Technical field
The invention belongs to the construction method of high-efficient cloning carrier in technical field of bioengineering, especially a primary yeast and answer
With.
Background technique
In molecular biology experiment, the building of carrier is to study the basic work of gene function.Most of purpose base
Because being all to carry out PCR amplification by designing the specific primer of different demands, it is connected on corresponding carrier.In connection type
On, have an In-Fusion, the connection of the homologous recombination techniques such as Gateway, and the cohesive end that is mediated by DNA ligase and
The connection of flat end.Homologous recombination mode connects price costly, carries out clone's joint efficiency for different target fragments
It fluctuates also larger；The mode of digestion connection is relatively simple, however restriction enzyme site has selection limitation, be by containing corresponding enzyme
Primer amplified clone's target gene of enzyme site carries out next step amplification again, and operation increases cumbersome.
The carrier T of linearisation respectively has a dT outstanding at its both ends, the PCR product warp after being expanded by high fidelity enzyme
Cross plus A reaction after at its both ends can respectively generate a dA outstanding, dT and dA outstanding in the carrier T of PCR product and linearisation
Complementary pairing completes clone's connection under the action of ligase.In TA cloning procedure, linearized vector will not be to target gene
It is selected, therefore carries out TA clone's connection simultaneously for a large amount of, different target gene, clone's base can be greatly increased
The quantity of cause.The connection of target gene and carrier is carried out in such a way that TA is cloned, cost is relatively low, easy to operate, connection effect
Rate is high, can carry out high-throughput gene cloning.
PYES2 Yeast expression carrier is a kind of shuttle plasmid, has prokaryotic replions and eukaryon replicon, can reside in
In two kinds of host strains of saccharomyces cerevisiae and Escherichia coli, genetic manipulation and eukaryotic expression can be carried out simultaneously.PYES2 has GAL1 half
The eukaryotic promoter of lactose induction, therefore under the induction of galactolipin, target gene on the one hand can be made to stablize table in yeast
It reaches, gene function is verified by different Yeast Cultivation substrates, it is on the other hand anti-present in TA cloning procedure
To the available Effective selection of connection.
By retrieval, patent publication us relevant to present patent application is not yet found.
Summary of the invention
It is an object of the invention to provide the structure of high-efficient cloning carrier in a primary yeast in place of overcome the deficiencies in the prior art
The Yeast expression carrier of construction method and application, this method building is easy to use, and high-efficient, at low cost, application prospect is extensive, the party
Method can in saccharomyces cerevisiae inducing expression target gene expression and high throughput screening target gene.
The present invention solves its technical problem and adopts the following technical solutions to achieve:
The construction method of high-efficient cloning carrier in one primary yeast, the carrier are pYES2-T, have used one in the method
To the adapter-primer specifically added and contain the host cell of pYES2-T.
Moreover, steps are as follows:
(1) I restriction enzyme site of Xcm original in pYES2 carrier URA3 is carried out by fixed point same sense mutation by rite-directed mutagenesis；
(2) poly- using DNA by a pair of of specific primer containing I restriction enzyme site of Xcm using pFGC5941 carrier as template
Synthase carries out PCR amplification and obtains the Intron containing 761bp；
(3) with Sca I and BamH I, to step, (1) resulting vehicle carries out digestion, electrophoresis, and glue recycling linearized vector；
(4) I-Intron-Xcm of Xcm, I segment of amplification is connected in the carrier of linearisation by homologous recombination technique, i.e.,
Obtain high-efficient cloning carrier in yeast.
Moreover, the step (1) in uracil riddled basins in Yeast expression carrier pYES2 carrier framework are contained
I site Xcm carry out point mutation；
Alternatively, the step (4) in homologous recombination technique be using restriction enzyme site, by homologous recombination enzyme or nucleic acid outside
The homologous recombination technique that enzyme cutting 3 mediates.
Moreover, being constructed between I restriction enzyme site of Xcm and I restriction enzyme site of Xcm after galactolipin induces GAL1 promoter
The sequence of the Intron of 761bp, Intron are shown in SEQ ID NO.1.
Moreover, (2) middle archaeal dna polymerase is high-fidelity DNA polymerase to the step；Alternatively, a pair of of specific primer be containing
A pair of of specific primer of I restriction enzyme site of Xcm.
Moreover, the method remains all multiple cloning sites of pYES2 in pYES2-T multiple cloning sites position；
Alternatively, being added after A by T4DNA ligase to the flush end PCR fragment obtained by PCR amplification or being sticked to added with A
Property end carry out TA clone connection.
Moreover, the pair of adapter-primer is a pair of joint primer containing I restriction enzyme site of Sca I and BamH.
Moreover, the host cell is brewing yeast cell INSCV1 or Escherichia coli.
And, the specific steps are as follows:
In initial carrier pYES2 Xcm I rite-directed mutagenesis
I restriction enzyme site of Xcm on URA3 element is subjected to synonymous point mutation, using forward primer SEQ ID NO:1 and instead
To primer SEQ ID NO:2, reversely expanded using archaeal dna polymerase using pYES2 as template, amplification system are as follows: template 50ng,
0.4 μ L, the DNA polymerization of 10mM forward primer and 4 μ L, 10mmoL/L dNTPs of reverse primer each 1 μ L, archaeal dna polymerase buffer
0.2 0.6 μ L of μ L, DMSO of enzyme, totally 20 μ L system, residue water polishing；
PCR amplification program are as follows: 98 DEG C of 30s, the program of 30 circulations are as follows: 98 DEG C of 10s, 62 DEG C of 30s, 68 DEG C of 3min, finally
68℃5min；PCR product is connected using T4 ligase, system are as follows: 5 μ l, 10X T4DNALigase buffer5 μ L of PCR product,
T4DNA Ligase 5 μ L, ddH25 μ L of O, 22 DEG C are incubated for 1 hour；Conversion Escherichia coli simultaneously choose monoclonal sequencing；
(2) the primer amplified Intron containing I restriction enzyme site of Xcm is designed
Using specific primer using pFGC5941 as template amplification Intron, the specific primer are as follows: forward primer:
SEQ ID NO:3, reverse primer: SEQ ID NO:4 obtains I-Intron-Xcm of Xcm, I element；Amplification system are as follows: template
0.4 μ L, DNA of 4 μ L, 10mmoL/L dNTPs of 50ng, 10mM forward primer reverse primer each 1 μ l, archaeal dna polymerase buffer are poly-
0.2 μ L of synthase, totally 20 μ L system, remaining to use water polishing；
PCR amplification program are as follows: 98 DEG C of 30s, the program of 30 circulations are as follows: 98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min, finally
72℃5min；PCR product electrophoresis cuts glue preservation；
(3) Sca I is connected and is converted with I digestion carrier of BamH, homologous recombination
Double digestion is carried out to pYES2, double enzymes are Sca I and BamH I, digestion system are as follows: SacI 1 μ L, BamH I 1 μ L, 10 ×
Bufffer 2.5 μ L, pYES25 μ L, ddH2O 18μL；
Using forward primer SEQ ID NO:5, reverse primer SEQ ID NO:6 to step (2) in PCR product expand
Increase, amplification system are as follows: template 1 μ l, 10mM forward primer reverse primer each 1 μ l, archaeal dna polymerase buffer 4 μ l, 10mmol/L
0.4 μ L of dNTPs, 0.2 μ L of archaeal dna polymerase, totally 20 μ l system, remaining to use water polishing；
PCR amplification program are as follows: 98 DEG C of 30s, the program of 30 circulations are as follows: 98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min, finally
72℃5min；PCR product electrophoresis gel extraction；Recovery product carries out homologous recombination by the carrier after DNA recombinase and digestion
Connection, linked system are as follows: linearized vector pYES23 μ L；5 μ L of PCR product；2 μ L of DNA recombinase；50 DEG C, 15min is incubated, so
It is placed on ice；The product connected is transferred in large intestine competent cell TOP10 by heat-shock transformed method；Convert large intestine
Bacillus simultaneously chooses monoclonal sequencing；Correct clone is high-efficient cloning carrier in yeast, and correct clone is placed in -80 DEG C of preservations.
Carrier constructed by the construction method of high-efficient cloning carrier is with high throughput to cDNA text in yeast as described above
Library carries out the application in terms of the screening of target gene.
The advantages of present invention obtains and good effect are:
1, the method for the present invention makes carrier generate two by the high-efficient cloning carrier applied in building yeast after I digestion of Xcm
On the one hand a end T outstanding can directly carry out TA clone in such a way that PCR product adds A, the carrier remains published originally
The multiple cloning sites of body, the use for facilitating downstream to test；On the other hand it utilizes under the regulation of galactolipin evoked promoter, to TA
Gene after the clone inducing expression in yeast.Using this transformation carrier, mesh can be carried out to a large amount of cDNA libraries with high throughput
Gene screening；The Yeast expression carrier of the method for the present invention building is easy to use, and high-efficient, at low cost, application prospect is extensive.
2, the method for the present invention increases the Intron of 761bp between I restriction enzyme site of Xcm, no foreign gene effect it is same
When be remarkably improved digesting efficiency and recovery efficiency.
3, the method for the present invention can quickly move through TA clone, and transformed saccharomyces cerevisiae is tested to carry out function to target gene
Card.
4, it is existing anti-effectively can conveniently and efficiently to filter out TA clone by galactolipin inducing expression for the method for the present invention
To clone and invalid clone.
5, the method for the present invention remains original vector multiple cloning sites, can be by I-Intron-Xcm of Xcm, I subassembly wrapper quick clone
Into other carriers.
Detailed description of the invention
Fig. 1 is carrier figure before pYES2-T in the present invention；
Fig. 2 is electropherogram before I digestion pYES2-T of Xcm in the present invention；
Fig. 3 is that pYES2-T vector construction completes sequencer map in the present invention；
Fig. 4 is pYES2-T-EGFP carrier figure in the present invention；
Fig. 5 is that pYES2-T-EGFP vector construction of the present invention completes sequencer map.
Specific embodiment
Below with reference to the invention will be further described by specific embodiment, following embodiment be it is descriptive, no
It is restrictive, this does not limit the scope of protection of the present invention.
Raw material used in the present invention is unless otherwise specified conventional commercial product；Used in the present invention
Method is unless otherwise specified the conventional method of this field.
Embodiment 1
The construction method of high-efficient cloning carrier in one primary yeast, the carrier are pYES2-T, have used one in the method
To the adapter-primer specifically added and contain the host cell of pYES2-T.
More preferably, steps are as follows:
(1) I restriction enzyme site of Xcm original in pYES2 carrier URA3 is carried out by fixed point same sense mutation by rite-directed mutagenesis；
(2) poly- using DNA by a pair of of specific primer containing I restriction enzyme site of Xcm using pFGC5941 carrier as template
Synthase carries out PCR amplification and obtains the Intron containing 761bp；
(3) with Sca I and BamH I, to step, (1) resulting vehicle carries out digestion, electrophoresis, and glue recycling linearized vector；
(4) I-Intron-Xcm of Xcm, I segment of amplification is connected in the carrier of linearisation by homologous recombination technique, i.e.,
Obtain high-efficient cloning carrier in yeast.
More preferably, the step (1) in uracil riddled basins in Yeast expression carrier pYES2 carrier framework are contained
Some I sites Xcm carry out point mutation；
Alternatively, the step (4) in homologous recombination technique be using restriction enzyme site, by homologous recombination enzyme or nucleic acid outside
The homologous recombination technique that enzyme cutting 3 mediates.
More preferably, it is constructed between I restriction enzyme site of Xcm and I restriction enzyme site of Xcm after galactolipin induces GAL1 promoter
The sequence of the Intron of 761bp, Intron are shown in SEQ ID NO.1.
More preferably, (2) middle archaeal dna polymerase is high-fidelity DNA polymerase to the step；Alternatively, a pair of of specific primer be containing
There is a pair of of specific primer of I restriction enzyme site of Xcm.
More preferably, the method remains all multiple cloning sites of pYES2 in pYES2-T multiple cloning sites position；
Alternatively, being added after A by T4DNA ligase to the flush end PCR fragment obtained by PCR amplification or being sticked to added with A
Property end carry out TA clone connection.
More preferably, the pair of adapter-primer is a pair of joint primer containing I restriction enzyme site of Sca I and BamH.
More preferably, the host cell is brewing yeast cell INSCV1 or Escherichia coli.
Carrier constructed by the construction method of high-efficient cloning carrier is with high throughput to cDNA text in yeast as described above
Library carries out the application in terms of the screening of target gene.
Embodiment 2
The construction method of high-efficient cloning carrier in one primary yeast, steps are as follows:
(1) pass through rite-directed mutagenesis for original I restriction enzyme site of Xcm in pYES2 carrier uracil-deficient screening-gene URA3
Carry out fixed point same sense mutation, do not change amino acid sequence.
(2) high-fidelity is utilized by template of pFGC5941 by a pair of of specific primer containing I restriction enzyme site of Xcm
Phusion enzyme carries out PCR amplification and obtains the Intron containing 761bp.
(3) digestion, electrophoresis, and glue are carried out to (1) resulting vehicle with Sca I and BamH I and recycles linearized vector.
(4) I-Intron-Xcm of Xcm, I segment of amplification is connected by the homologous recombination mode that DNA homologous recombination enzyme mediates
It is connected in the carrier of linearisation, carrier is before obtaining pYES2-T to get high-efficient cloning carrier in yeast.
The high-efficient cloning carrier of the construction method building of high-efficient cloning carrier increases in Escherichia coli TOP10 in above-mentioned yeast
It grows, Escherichia coli used are TOP10 in building process.
Carrier is by I digestion rear electrophoresis of Xcm, selection target fragment glue recycling before a kind of Yeast expression pYES2-T
It can get linearisation pYES2-T carrier.By T4 ligase can will be added " A " react after function to be identified PCR product with
The pYES2-T carrier connection.
Embodiment 3
The construction method of high-efficient cloning carrier in one primary yeast, steps are as follows:
1, in initial carrier pYES2 Xcm I rite-directed mutagenesis
I restriction enzyme site of Xcm on URA3 element is subjected to synonymous point mutation, using forward primer SEQ ID NO:1 and instead
To primer SEQ ID NO:2, reversely expanded using archaeal dna polymerase using pYES2 as template, amplification system are as follows: template 50ng,
0.4 μ L, the DNA polymerization of 10mM forward primer and 4 μ L, 10mmoL/L dNTPs of reverse primer each 1 μ L, archaeal dna polymerase buffer
0.2 0.6 μ L of μ L, DMSO of enzyme, totally 20 μ L system, residue water polishing.PCR amplification program are as follows: 98 DEG C of 30s, the journey of 30 circulations
Sequence is 98 DEG C of 10s, 62 DEG C of 30s, 68 DEG C of 3min, last 68 DEG C of 5min.PCR product using T4DNA ligase (connection, system are as follows:
5 μ l, 10X T4DNALigase buffer of PCR product 5 μ L, T4DNALigase 5 μ L, ddH25 μ L of O, 22 DEG C of incubations 1 are small
When.Conversion Escherichia coli simultaneously choose monoclonal sequencing.
2, the primer amplified Intron containing I restriction enzyme site of Xcm is designed
It is with pFGC5941 using specific primer (forward primer: SEQ ID NO:3, reverse primer: SEQ ID NO:4)
Template amplification Intron obtains I-Intron-Xcm of Xcm, I element.Amplification system are as follows: template 50ng, 10mM forward primer is reversed
4 μ L, 10mmoL/L dNTPs of primer each 1 μ l, archaeal dna polymerase buffer 0.4 μ L, 0.2 μ L of archaeal dna polymerase, totally 20 μ L system,
Residue water polishing.PCR amplification program are as follows: 98 DEG C of 30s, 30 circulation programs be 98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min,
Last 72 DEG C of 5min.PCR product electrophoresis cuts glue preservation.
3, Sca I is connected and is converted with I digestion carrier of BamH, homologous recombination
Double digestion (Sca I be purchased from BamH I NEB), digestion system are carried out to pYES2 are as follows: 1 I 1 μ L of μ L, BamH of SacI, limit
Property inscribe enzyme buffer liquid 2.5 μ L, pYES25 μ L, ddH processed2O 18μL。
The PCR product in step 2 is expanded using forward primer SEQ ID NO:5, reverse primer SEQ ID NO:6
Increase, amplification system are as follows: template 1 μ l, 10mM forward primer reverse primer each 1 μ l, archaeal dna polymerase buffer 4 μ l, 10mmol/L
0.4 μ L of dNTPs, 0.2 μ L of archaeal dna polymerase, totally 20 μ l system, remaining to use water polishing.PCR amplification program are as follows: 98 DEG C of 30s, 30
The program of circulation is 98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min, last 72 DEG C of 5min.PCR product electrophoresis gel extraction.Recycling produces
Object carries out homologous recombination connection, linked system are as follows: linearized vector pYES23 μ L by the carrier after DNA recombinase and digestion；
5 μ L of PCR product；2 μ L of DNA homologous recombination enzyme.50 DEG C, 15min is incubated, is subsequently placed on ice.The product connected is passed through into heat
The method for swashing conversion is transferred in large intestine competent cell TOP10.Conversion Escherichia coli simultaneously choose monoclonal sequencing.Correct clone is set
It is saved in -80 DEG C.
4, Yeast expression carrier efficiency of the practice is tested
EGFP gene is expanded using archaeal dna polymerase, TA clonal fashion is successfully passed and is building up to Yeast expression pYES2-T load
Body obtains pYES2-T-EGFP carrier, and by converting Escherichia coli TOP10,10 monoclonal sequencings of picking are completely converted into
Function.
Nucleotide sequence
SEQ ID NO:1
tcaactaattgcagtaattccttggtggtac
SEQ ID NO:2
agcattaggtcccaaaatttgtttac
SEQ ID NO:3
ccagtcttgacctggagcgta
SEQ ID NO:4
ccaggtgtagactggtcctg
SEQ ID NO:5
ttaagcttggtaccgagctcccagtcttgacctggagcgta
SEQ ID NO:6
cgttactagtggatccccaggtgtagactggtcctg
Although disclosing the embodiment of the present invention and attached drawing for the purpose of illustration, those skilled in the art can be managed
Solution: do not departing from the present invention and spirit and scope of the appended claims in, various substitutions, changes and modifications be all it is possible,
Therefore, the scope of the present invention is not limited to the embodiment and attached drawing disclosure of that.
Sequence table
<110>TanJin Agricultural College
The construction method of high-efficient cloning carrier and application in<120>one primary yeasts
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 31
<212> DNA
<213>forward primer (Unknown)
<400> 1
tcaactaatt gcagtaattc cttggtggta c 31
<210> 2
<211> 26
<212> DNA
<213>reverse primer (Unknown)
<400> 2
agcattaggt cccaaaattt gtttac 26
<210> 3
<211> 21
<212> DNA
<213>forward primer (Unknown) of specific primer
<400> 3
ccagtcttga cctggagcgt a 21
<210> 4
<211> 20
<212> DNA
<213>reverse primer (Unknown) of specific primer
<400> 4
ccaggtgtag actggtcctg 20
<210> 5
<211> 41
<212> DNA
<213>forward primer (Unknown)
<400> 5
ttaagcttgg taccgagctc ccagtcttga cctggagcgt a 41
<210> 6
<211> 36
<212> DNA
<213>reverse primer (Unknown)
<400> 6
cgttactagt ggatccccag gtgtagactg gtcctg 36
Claims (10)
1. the construction method of high-efficient cloning carrier in a primary yeast, it is characterised in that: the carrier is pYES2-T, the method
It is middle to have used a pair of adapter-primer specifically added and the host cell containing pYES2-T.
2. the construction method of high-efficient cloning carrier in yeast according to claim 1, it is characterised in that: steps are as follows:
(1) I restriction enzyme site of Xcm original in pYES2 carrier URA3 is carried out by fixed point same sense mutation by rite-directed mutagenesis；
(2) archaeal dna polymerase is utilized using pFGC5941 carrier as template by a pair of of specific primer containing I restriction enzyme site of Xcm
It carries out PCR amplification and obtains the Intron containing 761bp；
(3) with Sca I and BamH I, to step, (1) resulting vehicle carries out digestion, electrophoresis, and glue recycling linearized vector；
By homologous recombination technique by I-Intron-Xcm of Xcm, I segment of amplification be connected in the carrier of linearisation to get
High-efficient cloning carrier in yeast.
3. the construction method of high-efficient cloning carrier in yeast according to claim 2, it is characterised in that: the step (1) in
Point mutation is carried out to I site Xcm that uracil riddled basins in Yeast expression carrier pYES2 carrier framework contain；
Alternatively, (4) middle homologous recombination technique is to pass through homologous recombination enzyme or exonuclease 3 using restriction enzyme site to the step
The homologous recombination technique of mediation.
4. the construction method of high-efficient cloning carrier in yeast according to claim 2, it is characterised in that: induced in galactolipin
The Intron of 761bp between I restriction enzyme site of Xcm and I restriction enzyme site of Xcm, the sequence of Intron are constructed after GAL1 promoter
For shown in SEQ ID NO.1.
5. the construction method of high-efficient cloning carrier in yeast according to claim 2, it is characterised in that: the step (2) in
Archaeal dna polymerase is high-fidelity DNA polymerase；Alternatively, a pair of of specific primer is a pair of specificity containing I restriction enzyme site of Xcm
Primer.
6. the construction method of high-efficient cloning carrier in yeast according to claim 1, it is characterised in that: the method exists
PYES2-T multiple cloning sites position remains all multiple cloning sites of pYES2；
Alternatively, being added the flush end PCR fragment obtained by PCR amplification after A or to the stickiness end added with A by T4DNA ligase
End carries out TA clone's connection.
7. the construction method of high-efficient cloning carrier in yeast according to claim 1, it is characterised in that: the pair of connector
Primer is a pair of joint primer containing I restriction enzyme site of Sca I and BamH.
8. the construction method of high-efficient cloning carrier in yeast according to claim 1, it is characterised in that: the host cell
It is brewing yeast cell INSCV1 or Escherichia coli.
9. the construction method of high-efficient cloning carrier in yeast according to any one of claims 1 to 8, it is characterised in that: tool
Steps are as follows for body:
In initial carrier pYES2 Xcm I rite-directed mutagenesis
I restriction enzyme site of Xcm on URA3 element is subjected to synonymous point mutation, using forward primer SEQ ID NO:1 and is reversely drawn
Object SEQ ID NO:2 is reversely expanded using archaeal dna polymerase using pYES2 as template, amplification system are as follows: template 50ng, 10mM
0.4 μ L of forward primer and 4 μ L, 10mmoL/L dNTPs of reverse primer each 1 μ L, archaeal dna polymerase buffer, archaeal dna polymerase 0.2
0.6 μ L of μ L, DMSO, totally 20 μ L system, remaining to use water polishing；
PCR amplification program are as follows: 98 DEG C of 30s, the program of 30 circulations are as follows: 98 DEG C of 10s, 62 DEG C of 30s, 68 DEG C of 3min, last 68 DEG C
5min；PCR product is connected using T4 ligase, system are as follows: 5 μ l, 10X T4 DNA Ligase buffer of PCR product, 5 μ L,
T4 DNA Ligase 5 μ L, ddH25 μ L of O, 22 DEG C are incubated for 1 hour；Conversion Escherichia coli simultaneously choose monoclonal sequencing；
(2) the primer amplified Intron containing I restriction enzyme site of Xcm is designed
Using specific primer using pFGC5941 as template amplification Intron, the specific primer are as follows: forward primer: SEQ ID
NO:3, reverse primer: SEQ ID NO:4 obtains I-Intron-Xcm of Xcm, I element；Amplification system are as follows: template 50ng, 10mM
4 μ L, 10mmoL/L dNTPs of forward primer reverse primer each 1 μ l, archaeal dna polymerase buffer 0.4 μ L, 0.2 μ of archaeal dna polymerase
L, totally 20 μ L system, remaining to use water polishing；
PCR amplification program are as follows: 98 DEG C of 30s, the program of 30 circulations are as follows: 98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min, last 72 DEG C
5min；PCR product electrophoresis cuts glue preservation；
(3) Sca I is connected and is converted with I digestion carrier of BamH, homologous recombination
Double digestion is carried out to pYES2, double enzymes are Sca I and BamH I, digestion system are as follows: SacI 1 μ L, BamH I 1 μ L, 10 ×
Bufffer 2.5 μ L, pYES2 5 μ L, ddH2O 18μL；
Using forward primer SEQ ID NO:5, reverse primer SEQ ID NO:6 to step (2) in PCR product expand, expand
Increasing system are as follows: 14 μ l, 10mmol/L dNTPs of μ l, 10mM forward primer reverse primer each 1 μ l, archaeal dna polymerase buffer of template
0.4 μ L, 0.2 μ L of archaeal dna polymerase, totally 20 μ l system, remaining to use water polishing；
PCR amplification program are as follows: 98 DEG C of 30s, the program of 30 circulations are as follows: 98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min, last 72 DEG C
5min；PCR product electrophoresis gel extraction；Recovery product carries out homologous recombination connection by the carrier after DNA recombinase and digestion,
Linked system are as follows: 3 μ L of linearized vector pYES2；5 μ L of PCR product；2 μ L of DNA recombinase；50 DEG C, 15min is incubated, is then set
In on ice；The product connected is transferred in large intestine competent cell TOP10 by heat-shock transformed method；Convert Escherichia coli
And choose monoclonal sequencing；Correct clone is high-efficient cloning carrier in yeast, and correct clone is placed in -80 DEG C of preservations.
10. carrier constructed by the construction method of high-efficient cloning carrier is in height in yeast as described in any one of claim 1 to 9
The application in terms of the screening of target gene is carried out to flux to cDNA library.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810882165.4A CN108998466A (en) | 2018-08-06 | 2018-08-06 | The construction method of high-efficient cloning carrier and application in one primary yeast |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810882165.4A CN108998466A (en) | 2018-08-06 | 2018-08-06 | The construction method of high-efficient cloning carrier and application in one primary yeast |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108998466A true CN108998466A (en) | 2018-12-14 |
Family
ID=64594818
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810882165.4A Pending CN108998466A (en) | 2018-08-06 | 2018-08-06 | The construction method of high-efficient cloning carrier and application in one primary yeast |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108998466A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1127012A (en) * | 1993-07-13 | 1996-07-17 | 诺沃挪第克公司 | An Enzyme with acetyl esterase activity |
| WO2001077351A1 (en) * | 2000-04-07 | 2001-10-18 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Vectors and methods for dual protein expression in pichia pastoris and escherichia coli |
| CN101407823A (en) * | 2008-11-28 | 2009-04-15 | 东北林业大学 | Method for constructing yeast bivalent universal expression vector |
| CN102286511A (en) * | 2011-06-29 | 2011-12-21 | 西南大学 | Gene-auto-excision binary system (GAEBS) for biological safety control of exogenous gene in sexual reproduction plant and related plant expression vector |
| CN103014046A (en) * | 2012-11-07 | 2013-04-03 | 深圳大学 | Directional cloning method, transformation method of carrier and carrier T |
| CN105274068A (en) * | 2015-11-20 | 2016-01-27 | 上海海洋大学 | Myrmecia incisa reisigl delta 9 fatty acid desaturase coding DNA (deoxyribonucleic acid) sequence and application thereof |
-
2018
- 2018-08-06 CN CN201810882165.4A patent/CN108998466A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1127012A (en) * | 1993-07-13 | 1996-07-17 | 诺沃挪第克公司 | An Enzyme with acetyl esterase activity |
| WO2001077351A1 (en) * | 2000-04-07 | 2001-10-18 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Vectors and methods for dual protein expression in pichia pastoris and escherichia coli |
| CN101407823A (en) * | 2008-11-28 | 2009-04-15 | 东北林业大学 | Method for constructing yeast bivalent universal expression vector |
| CN102286511A (en) * | 2011-06-29 | 2011-12-21 | 西南大学 | Gene-auto-excision binary system (GAEBS) for biological safety control of exogenous gene in sexual reproduction plant and related plant expression vector |
| CN103014046A (en) * | 2012-11-07 | 2013-04-03 | 深圳大学 | Directional cloning method, transformation method of carrier and carrier T |
| CN105274068A (en) * | 2015-11-20 | 2016-01-27 | 上海海洋大学 | Myrmecia incisa reisigl delta 9 fatty acid desaturase coding DNA (deoxyribonucleic acid) sequence and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 顾頠等: "基于XcmⅠ酶切的高效TA克隆载体的构建", 《生物技术通讯》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105132451B (en) | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application | |
| CN110747187B (en) | Cas12a protein for identifying TTTV and TTV double-PAM sites, plant genome directed editing vector and method | |
| US20200131504A1 (en) | Plasmid library comprising two random markers and use thereof in high throughput sequencing | |
| WO2018129986A1 (en) | α-AMYLASE BAAMY MUTANT WITH INCREASED SPECIFIC ACTIVITY, AND CODING GENE AND APPLICATION THEREOF | |
| CN106244624B (en) | Plasmid system and its application for the building of plant polygene expression vector | |
| CN108998466A (en) | The construction method of high-efficient cloning carrier and application in one primary yeast | |
| CN102329812B (en) | Multi-gene binary expression vector constructed by using homologous recombination and preparation method and application of multi-gene binary expression vector | |
| CN107602707A (en) | The dcas9 ω fusion proteins of one species specificity regulation bacillus subtilis exogenous gene expression and its application | |
| JP2007508012A5 (en) | ||
| CN103865897A (en) | Site-directed mutagenesis system of mustard genome and application of site-directed mutagenesis system | |
| CN111621515A (en) | Method for enhancing gene editing efficiency of CRISPR/Cas9 system | |
| CN108486140A (en) | A kind of cloning vector preparation method and kit based on seamless clone technology | |
| CN109266677A (en) | A kind of construction method in overall length transcription factor yeast two-hybrid library | |
| CN116286904B (en) | Bovine-derived CRISPR/boCas13a gene editing system, method and application | |
| CN104789564A (en) | Promoter and recombinant expression vector as well as application thereof and method for expressing heterologous proteins | |
| CN107012146B (en) | Site-specific recombination-based tetrahymena expression vector and construction and application thereof | |
| CN108220314B (en) | New method for rapid connection transformation of DNA fragment and vector and application thereof | |
| Liao et al. | Fusion-PCR generates attL recombination site adaptors and allows Rapid One-Step Gateway (ROG) cloning | |
| CN117210433B (en) | Overspeed high-fidelity combined reverse transcription DNA polymerase, gene amplification and reverse transcription method based on same and reagent | |
| CN101096669A (en) | DNA multi-point directed mutation method | |
| CN101921746A (en) | Template p111 for preparing 100bp DNA ladder based on PCR technology, and preparation system thereof | |
| CN108330137A (en) | A kind of pGADT7-In carriers and its structure and application method suitable for In-Fusion clones | |
| CN106497953A (en) | A kind of green fluorescence protein expression carrier of improvement and its construction method | |
| CN106480031A (en) | Bacillus cereuss expression promoter and its application | |
| 黄雪芹 et al. | Expression of the Acid-resistant Xylanase Gene from Bacillus velezensis P7 in Bacillus subtilis and Optimization of Its Production |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181214 |
|
| RJ01 | Rejection of invention patent application after publication |