CN103014046A - Directional cloning method, transformation method of carrier and carrier T - Google Patents

Abstract

The invention discloses a directional cloning method, a transformation method of a carrier and a carrier T, wherein the directional cloning method includes the steps of designing and synthesizing an enzyme digestion kit, constructing the linear carrier T with two ends provided with protruded dT, generating PCR (Polymerase Chain Reaction) segment of the target gene, and constructing a recombinant carrier containing the target gene. According to the directional cloning method, the directional TA cloning technology can be used for preparing efficient directionally-cloned carrier T which can be widely applied to cloning and expression of a PCR product in molecular biology experiment. As an expression carrier is reconstructed, the PCR product can be directly connected to the expression carrier, the connecting direction of the target gene can be determined after identification of single enzyme digestion, expression can be performed in cells, the connecting direction is determined without complex steps such as conventional sequencing and the like, the direction cloning can be simply and rapidly realized, engineering bacteria can be constructed through one step, and the application prospect is wide.

Description

The remodeling method of a kind of directed cloning method and carrier and T carrier

Technical field

The present invention relates to bioengineering field, relate in particular to remodeling method and the T carrier of a kind of directed cloning method and carrier.

Background technology

PCR is the most frequently used method of present outer-gene amplification, the PCR product cloned fast and effectively, and be to carry out Gene conservation, amplification, order-checking and the effective ways of expressing.For this reason, domestic and international many scholars have explored a lot of different cloning process.Method commonly used has non-directional clone and directed cloning, and these two kinds of methods have all been set up respective carrier, but although these existing cloning vectors can both reach clone's purpose, but certain weak point is also respectively arranged.

The T carrier rapidly and efficiently clear superiority of clone PCR products has shown its application prospect in making up the range gene library, because carrier 3 ' end respectively has a 3 ' outstanding dT residue, just can be with the PCR product is terminal because dA (Desoxyadenosine) complementary pairing that the terminal enzyme (DNA) activity that Taq archaeal dna polymerase non-template relies on is added, thisly be connected on the carrier with the viscosity complementary pairing, be called the T-A clone, have simple to operate, rapidly and efficiently, positive colony ratio advantages of higher, thereby greatly improve the joint efficiency of PCR product.Yet the T carrier also has certain weak point, because carrier all is that T-A is connected with PCR product two ends, so the forward connection of PCR product possibility or Opposite direction connection carrier, can't realize directed cloning, need through sample presentation order-checking rear as can be known product and carrier closure.Present business-like T carrier such as pMD-18T, pGEM-T etc. all are clonotype carriers, only can the clonal expansion dna fragmentations, the functions such as order-checking can not be used for expressing protein, also exist in addition carrier easily to occur from connecting, and positive colony is difficult to the problems such as screening.

The T carrier can be divided into clonotype T carrier and expression type T carrier according to function, and the T carrier of supply mainly is clonotype T carrier in the market, has the function of clone's goal gene, only satisfies the needs of amplification and order-checking.If express goal gene, also need goal gene is recombinated to expression vector.Expression type T carrier satisfies the needs of gene clone and expression simultaneously, can directly connect goal gene and carry out protein expressioning analysis, and is easy and simple to handle, avoids too much operation steps to affect the sequence of goal gene.But preparation efficiently expresses type T carrier a lot of difficult points are arranged.Clonotype T carrier need not to take into account the closure of target DNA fragment, only need there be replication orgin, selection markers to get final product, and expression type T carrier is except above-mentioned key element, also need the necessary element-promotor of transcribing/translating, terminator etc., must take in addition the expression regulation element of upstream and downstream into account, they all need strict direction order to arrange.Because it is same T-A connection that expression type T carrier is connected with goal gene PCR fragment that two ends remain, the situation that same goal gene PCR fragment and carrier can occur to be connected forward or backwards, can not connect in the mode of determining, genetic expression requires goal gene can give expression to target protein with correct direction connection side, so, the gene PCR fragment with must change first cell over to after carrier is connected, the a collection of mono-clonal bacterial strain of picking is cultivated, must check order by sample presentation before expressing, wait for that the sequencing result time is longer, the progress of not only delaying experiment, and expend a large amount of manpower and materials, need to from numerous sequencing results, confirm the closure of goal gene through sequence alignment, can express that this has increased the difficulty of research and development greatly.Because above-mentioned problem limited expression type T carrier range of application, only have on the market several expression type T of minority to be loaded at present and sell, and because above-mentioned a variety of causes causes few people to be ready to adopt.

Therefore, prior art awaits improving and development.

Summary of the invention

In view of above-mentioned the deficiencies in the prior art, the object of the present invention is to provide remodeling method and the T carrier of a kind of directed cloning method and carrier, that utilizes variable restriction restriction endonuclease Xcm I to prepare can to carry out efficient quick can directed cloning T carrier, is intended to solve the problem that existing T carrier can not carry out directed cloning.

In order to solve the problems of the technologies described above, technical scheme of the present invention is as follows:

In the present invention, providing a kind of method of directed cloning, is a kind of T-A directed cloning method, and it specifically may further comprise the steps:

Design and synthesize enzyme and cut box: described enzyme is cut the two ends of box with Xcm I endonuclease digestion site, and adds respectively other restriction enzyme sites at the two ends that described enzyme is cut box;

Make up the T carrier: described enzyme is cut box be building up on the carrier, obtain the T carrier with two Xcm I endonuclease digestion sites;

Form two ends with the linearizing T carrier of outstanding dT: adopt Xcm I restriction endonuclease that described the second expression vector is carried out single endonuclease digestion, form two ends with the linearizing T carrier of outstanding dT;

Generate target gene PCR fragment: with the target gene fragment with the pcr amplification method 5 ' or 3 ' end add one with 3 ' or 5 ' of T carrier hold corresponding identical restriction endonuclease sites, obtain target gene PCR fragment, described corresponding identical restriction endonuclease sites all has and only has one in target P CR fragment with in the T carrier;

Structure contains the recombinant vectors of target gene: with the T4 ligase enzyme target gene PCR fragment and T carrier are coupled together and consist of the recombinant vectors that contains target gene.

The method of described directed cloning, further comprising the steps of:

Transform and identify: the described recombinant vectors that contains target gene is changed in the competent escherichia coli cell, obtain the mono-clonal bacterium colony by being coated with resistant panel, picking mono-clonal bacterium colony carries out enlarged culturing, then extract plasmid, carry out single endonuclease digestion with restriction enzyme again and identify, determine the closure of target gene;

Wherein, the restriction enzyme described in conversion and the authentication step is for generating the corresponding restriction enzyme of restriction endonuclease sites described in the target gene PCR fragment step.

Particularly, the described enzyme that designs and synthesizes is cut in the box step, may further comprise the steps:

The complex sign gene, whether described marker gene successfully amplifies described enzyme and cuts box for the identification of cutting box with the described enzyme of screening;

Add a plurality of restriction enzyme sites at the two ends of described marker gene; Wherein, the two ends of described marker gene all are added with an Xcm I endonuclease digestion site;

The described enzyme that increases is cut the box fragment, and identifies: cut the box fragment by the described enzyme of pcr amplification, and carry out electrophoresis and identify.

In the described structure T carrier step, may further comprise the steps:

Described enzyme is cut the box fragment link to each other with the pMD-19T carrier, obtain cutting with described enzyme the first recombinant vectors of box;

Described the first recombinant vectors is transformed in the competent cell, and picking list bacterium colony after cultivating carries out enlarged culturing, extracts described the first recombinant vectors from bacterium liquid;

Carrier and described the first recombinant vectors are carried out double digestion with same restriction enzyme respectively; Wherein, carrying out the restriction enzyme that double digestion adopts is not Xcm I restriction endonuclease;

Carrier after reclaiming enzyme that described the first recombinant vectors cuts out and cutting box fragment and enzyme and cut;

Carrier after the enzyme of described recombinant vectors excision cut the box fragment and enzyme is connected connects, and forms the second recombinant vectors;

The second recombinant vectors is converted into competent cell, and picking list bacterium colony after cultivating carries out enlarged culturing, extracts described the second recombinant vectors from bacterium liquid;

Described the second recombinant vectors is carried out the double digestion enzyme with same restriction enzyme cut evaluation, after identifying correctly, obtain the T carrier with two Xcm I endonuclease digestion sites.

Wherein, described carrier can be clonotype and expression vector.Described carrier can prokaryotic expression carrier or carrier for expression of eukaryon.

In the described generation target gene PCR fragment step, be in particular:

With the target gene fragment with the pcr amplification method 5 ' end add one with 3 ' of T carrier hold corresponding identical restriction endonuclease sites, or, with the target gene fragment with the pcr amplification method 3 ' end add one with 5 ' of T carrier hold corresponding identical restriction endonuclease sites, obtain target gene PCR fragment, described corresponding identical restriction endonuclease sites all has and only has one in target P CR fragment with in the T carrier.

A kind of remodeling method of carrier also is provided among the present invention, and it specifically may further comprise the steps:

Design and synthesize enzyme and cut box: described enzyme is cut the two ends of box with Xcm I endonuclease digestion site, and adds respectively other restriction enzyme sites at the two ends that described enzyme is cut box;

Make up the T carrier: described enzyme is cut box be building up on the carrier, obtain the T carrier with two Xcm I endonuclease digestion sites.

The remodeling method of described carrier is further comprising the steps of:

Described T carrier is carried out single endonuclease digestion with Xcm I restriction endonuclease, form two ends with the linearizing T carrier of outstanding dT.

In addition, also provide a kind of T carrier among the present invention, described T carrier is the T carrier with directed cloning function, is to adopt the remodeling method of above-mentioned expression vector that existing expression vector transformation is obtained.Wherein, described existing expression vector comprises clonotype carrier and expression vector.

T-A directed cloning technology provided by the present invention can be widely used in the direct directed cloning of PCR product, has very high using value, the positively effect that following several respects are arranged: 1, the PCR product need not that enzyme is cut, purifying, determine closure with single endonuclease digestion after the connection carrier, method with simple and fast realizes directed cloning, then directly express, save valuable search time.And the constructed T carrier of the present invention need not to carry out in advance the various steps such as double digestion, purifying recovery, and the preparation method simply settles at one go, compares with the T-A cloning process with traditional directed cloning to have clear superiority.2, simplified control, recombinant vectors can carry out the work that waits of protein expression immediately after single endonuclease digestion is identified closure.3, compare with traditional method, the success ratio of the recombinant vectors order-checking after single endonuclease digestion is identified improves a lot, can reach 100% accurate.

Description of drawings

Fig. 1 is that PCR fragment 3 ' end is introduced restriction enzyme site A cis connection diagram.

Fig. 2 is that PCR fragment 3 ' end is introduced the trans connection diagram of restriction enzyme site A.

Fig. 3 is that PCR fragment 5 ' end is introduced restriction enzyme site D cis connection diagram.

Fig. 4 is that PCR fragment 5 ' end is introduced the trans connection diagram of restriction enzyme site D.

Fig. 5 is pQE-T building process Technology Roadmap among the embodiment 1.

Fig. 6 is pQE-T restriction enzyme site synoptic diagram among the embodiment 1.

Fig. 7 is the as a result figure that enzyme is cut the electrophoresis evaluation of box fragment among the embodiment 1.Wherein, M:TaKaRa5,000Marker; 1: enzyme is cut box PCR product.

Fig. 8 is pT-Q plasmid and double digestion electrophorogram among the embodiment 1.Wherein, M:TaKaRa 5000Marker; 1:pT-Q; Behind the 2:pT-Q double digestion (EcoR I/Hind III).

Fig. 9 is pQE-T carrier design and evaluation electrophorogram among the embodiment 1.Wherein, M:TaKaRa5,000Marker; 1: enzyme is cut box PCR product T-Q; 2:pT-Q; 3:pT-Q double digestion product (EcoR I/Hind III); 4:pQE-TX; 5:pQE-TX double digestion product (EcoR I/Hind III); 6:pQE-TX single endonuclease digestion product (Xcm I).

Figure 10 a is the dna sequencing figure of pQE-TX plasmid 5 ' end among the embodiment 1.

Figure 10 b is the dna sequencing figure of pQE-TX plasmid 3 ' end among the embodiment 1.

Figure 11 is that the pQE-T carrier is connected the as a result figure that identifies among the embodiment 1 with hRBP.Wherein, 1:TaKaRa 5,000Marker; 2:hRBP reading frame PCR product; 3:pQE-T carrier and bacterium liquid plasmid after hRBP is connected; Plasmid BamH I single endonuclease digestion product among the 4:2.

Figure 12 recombinates hRBP at the SDS-PAGE of escherichia coli expression collection of illustrative plates among the embodiment 1.Wherein, M: standard protein molecular weight Marker; The 1:BL21 blank; 2-5:IPTG induces the BL21 that contains the pQE-hRBP recombinant plasmid to express, and induction time is respectively 0,1,3,5 hours.

Figure 13 is the western blotting detected result figure of RBP albumen among the embodiment 1.Wherein, M: standard protein Marker; 1:IPTG induces the BL21 that contains the pQE-hRBP recombinant plasmid to express.

Figure 14 is RBP protein fingerprint spectrum among the embodiment 1.

Figure 15 is the Technology Roadmap of the T carrier of structure among the embodiment 2.

Figure 16 is pYD-T carrier structure synoptic diagram among the embodiment 2.

Figure 17 is the primer restriction enzyme site distribution plan that enzyme is cut box PCR reaction among the embodiment 2 (place, sequence space arranges for distinguishing the restriction enzyme site sequence, without other Special Significance).

Figure 18 is construction of recombinant plasmid and evaluation electrophorogram among the embodiment 2.Wherein, M:5000bpMarker; 1: enzyme is cut box PCR product; The 2:pMD-YFP plasmid; 3:pMD-YFP plasmid NheI and Xho I double digestion; The 4:pYD-T plasmid; 5:pYD-T plasmid Nhe I and Xho I double digestion; 6:pYD-T plasmid Xcm I single endonuclease digestion.

Figure 19 is the surface display situation of pYD-YFP carrier transformed yeast under laser confocal microscope among the embodiment 2.The surface display situation of Figure 19 .pYD-YFP carrier transformed yeast under laser confocal microscope wherein.Wherein, A: the yeast surface whole observation figure (excitation wavelength 457nm) under the cyan fluorescence excitation; B: the yeast surface whole observation figure under visible light; C: in the overlay chart of the yeast surface under the cyan fluorescence excitation and the yeast surface whole observation figure under visible light; D: the partial enlarged drawing of the yeast surface under the cyan fluorescence excitation; E: the yeast surface structure iron under visible light; F: in the overlay chart of the yeast surface structure iron under the cyan fluorescence excitation and the yeast surface structure iron under visible light.

Figure 20 is pYD-RFP plasmid identification electrophorogram among the embodiment 2.Wherein, M:5000bp Marker; 1: the red fluorescent protein plasmid; The 2:pYD-RFP plasmid; The 3:pYD-RFP plasmid is through BamH I single endonuclease digestion.

Figure 21 is the whole observation figure of pYD-RFP under laser confocal microscope among the embodiment 2.Wherein, A: the yeast surface structure iron under ultraviolet excitation (excitation wavelength 407nm); B: the yeast surface structure iron under visible light; C: the overlay chart of the yeast surface structure iron under ultraviolet excitation and the yeast surface structure iron under visible light.

Embodiment

The invention provides remodeling method and the T carrier of a kind of directed cloning method and carrier, clearer, clear and definite for making purpose of the present invention, technical scheme and effect, below the present invention is described in more detail.Should be appreciated that specific embodiment described herein only in order to explain the present invention, is not intended to limit the present invention.

Because the T carrier all is connected with one-T residue at the 3 ' end of linear plasmid DNA, therefore can with 3 ' have-A residue PCR product is connected, goal gene can not be connected with carrier with specific direction, can connect forward or backwards, so can't realize directed cloning.The present invention utilize variable restriction restriction endonuclease Xcm I to prepare can to carry out efficient quick can directed cloning the T carrier.The directed cloning T carrier that forms with the inventive method transformation expression vector can be directly used in protein expression research.Compare with traditional molecular biology method, the PCR product of goal gene need not that enzyme is cut, purifying, directly be reconstituted in carrier by the TA clone, extract plasmid and carry out the closure that simple single endonuclease digestion evaluation can be determined goal gene by picking mono-clonal bacterium colony, and need not could determine closure by traditional loaded down with trivial details steps such as order-checking, realize directed cloning in the mode of simple and fast, precise and high efficiency.The constructed T carrier of present technique need not to carry out in advance double digestion, and the loaded down with trivial details steps such as purifying, recovery have clear superiority, and the method simply effectively need not expensive equipment, and the laboratory of general condition all can operate implementation.

Concrete, the present invention is that the enzyme that utilizes variable restriction restriction endonuclease Xcm I to make up is cut box, 5 ' and 3 ' end is provided with a plurality of different restriction enzyme sites, be building up on the expression vector, generate two ends with the cloning site (T Cloning Site) of outstanding ' T ' by Xcm I single endonuclease digestion, the target gene fragment with the pcr amplification method 5 ' or 3 ' end add one with 3 ' or 5 ' of T carrier hold corresponding identical restriction endonuclease sites (this restriction endonuclease sites must guarantee all there is and only has in target P CR fragment with in the T carrier), then with the T4 ligase enzyme target gene PCR fragment and T carrier are coupled together the formation recombinant vectors, change over to again in the competent escherichia coli cell, obtain the mono-clonal bacterium colony by being coated with resistant panel, picking several to more than ten bacterium colony enlarged culturing, then extract plasmid, carrying out single endonuclease digestion with set restriction enzyme again identifies, if can cut out the fragment of making an appointment with target gene PCR clip size, can be accredited as forward and connect.

Described qualification process and principle are as follows:

One, hypothetical target gene PCR fragment adds the identical optional A of restriction endonuclease sites A(or the B restriction endonuclease sites of 5 ' end institute correspondence of and T carrier at 3 ' end), with the T4 ligase enzyme target gene PCR fragment and T carrier are coupled together the formation recombinant vectors and two kinds connection can occur: cis is connected and is connected connection.If as shown in Figure 1, carry out single endonuclease digestion with restriction enzyme A and identify when cis connects, the fragment (much more about bp more than ten) of making an appointment with target gene PCR clip size can appear.If as shown in Figure 2 result will occur such as trans connection, carry out single endonuclease digestion with restriction enzyme A and identify, can only obtain the fragment that length is about 20 bp, in fact in agarose gel electrophoresis, can't see band.Therefore can identify cloned sequence is to connect forward or backwards.

Two, hypothetical target gene PCR fragment adds the identical optional C of restriction endonuclease sites D(or the D restriction endonuclease sites of 3 ' end institute correspondence of and T carrier at 5 ' end), with the T4 ligase enzyme target gene PCR fragment and T carrier are coupled together the formation recombinant vectors and two kinds connection can occur: cis is connected and is connected connection.If as shown in Figure 3, carry out single endonuclease digestion with restriction enzyme D and identify when cis connects, the fragment (much more about bp more than ten) of making an appointment with target gene PCR clip size can appear.If as shown in Figure 4 result will occur such as trans connection, carry out single endonuclease digestion with restriction enzyme D and identify, can only obtain the fragment that length is about 20 bp, in fact in agarose gel electrophoresis, can't see band.Therefore can identify cloned sequence is to connect forward or backwards.

To further describe the solution of the present invention by transforming prokaryotic expression carrier pQE-30a and carrier for expression of eukaryon PYD-1 among the embodiment below.

Embodiment 1: prokaryotic expression type T-Vector construction

By prokaryotic expression carrier pQE-30a is transformed, design and utilize two ends to cut box with the enzyme that contains kalamycin resistance gene in Xcm I endonuclease digestion site, enzyme is cut the box two ends and is added other restriction enzyme site, and then cut box corresponding restriction enzyme site to the pQE-30a carrier by recombinant technology directed cloning two ends with the enzyme that contains kalamycin resistance gene of Xcm I restriction enzyme site, the plasmid of the restructuring that order-checking is correct is used Xcm I restriction endonuclease single endonuclease digestion again, fragment with kalamycin resistance gene is scaled off, thereby form two ends with the linearizing T-carrier of outstanding dT.At last, utilize human retinol-binding protein (hRBP) to identify the expressive function of the T carrier of structure, by usefulness T4 ligase enzyme and the T carrier of being connected behind the dna fragmentation PCR of hRBP gene are connected, then import to express in the bacterium e. coli bl21 and carry out abduction delivering, by the target protein that Western Blotting detects, the detection of hRBP protein spectrum is expressed, prove thus the exactness of constructed T carrier.

1.1 experiment material

1.1.1 gene

Human retinol-binding protein gene (hRBP).

1.1.2 bacterial strain

Intestinal bacteria JM107 genotype: endA1, yrA96, thi, hsdR17, supE44, relA1, △ (lac-proAB)/F'[traD36, proAB+, lac Iq, lacZ △ M15];

E. coli bl21 (DE3) genotype: F', ompT, hsdSB (rB-mB-), gal (λ cI857, ind1, Sam7, nin5, lacUV5-T7gene1), dcm (DE3).

1.1.3 plasmid

Enzyme is cut box material requested: pET-28a, pQE-30a.

1.1.4 main agents

Restriction endonuclease: EcoR I, Hind III, Nco I, BamH I, Xcm I.

Microbiotic: kantlex ((Kanamycin, Kana), Ampicillin Trihydrate (Ampicillin, Amp)

Agarose, peptone, yeast extract (yeast extract), sodium-chlor (NaCl), sodium hydroxide (NaOH), 30% acrylamide (ACRY), sec.-propyl-β-D-sulfo-galactopyranoside (IPTG), Tris-HCl damping fluid (1.5mol/L pH8.8; 0.5mol/L pH6.8), N, N, N', N'-tetramethyl-diethylamine (TEMED).Other reagent are domestic analytical pure.

1.1.5 key instrument equipment: high-pressure sterilizing pot, electronic balance, pcr amplification instrument, agarose gel electrophoresis instrument, spectrophotometer, electro-heating standing-temperature cultivator, constant temperature culture oscillator, refrigerated centrifuge etc.

1.1.6 the preparation of main agents

The agarose gel electrophoresis damping fluid: 50 * TAE Buffer:242g Tris alkali, 57.1ml HAc, 100ml 0.5M EDTA (pH8.0) is settled to 1000ml.Dilution is 1 * TAE Buffer during use.

The LB substratum: 10g Trypeptone, 5g Yeast extract, 10g NaCl adds ddH2O to 1000ml, with the laggard horizontal high voltage sterilization of NaOH accent pH to 7.2 of 5M.

1.5M Tris-HCl (pH 8.8): Tris 18.17g adds the ddH2O dissolving, and concentrated hydrochloric acid is transferred pH to 8.8, is settled to 100ml.

1M Tris-HCl (pH 6.8): Tris 12.11g adds the ddH2O dissolving, and concentrated hydrochloric acid is transferred pH to 6.8, is settled to 100ml.

10%SDS: electrophoresis level SDS 10.0g adds 68 ℃ of hydrotropies of ddH2O, and concentrated hydrochloric acid transfers to pH 7.2, is settled to 100ml.

10 * electrophoretic buffer (pH 8.3): Tris 3.02g, glycine 18.8g, 10%SDS 10ml add the ddH2O dissolving, are settled to 100ml.Dilution is 1 * electrophoretic buffer during use.

10% ammonium persulphate (AP): 0.1gAP adds ddH2O to 1ml.

2 * SDS electrophoresis sample-loading buffer: 1M Tris-HCl (pH 6.8) 2.5ml, beta-mercaptoethanol 1.0ml, SDS 0.6g, glycerine 2.0ml, 0.1%, bromjophenol blue 1.0ml, ddH2O 3.5ml.

Coomassie brilliant blue staining fluid: Coomassie brilliant blue 0.25g, methyl alcohol 225ml, Glacial acetic acid 46ml, ddH2O 225ml.

Destainer: methyl alcohol, Glacial acetic acid, ddH2O are formulated with 3: 1: 6.

IPTG liquid storage (200mg/ml): in 800 μ l distilled water, behind the dissolving 200mg IPTG, be settled to 1ml with distilled water, with 0.22 μ m membrane filtration degerming, be sub-packed in the 1.5ml centrifuge tube and be stored in-20 ℃.

Penbritin (Ampicillin Amp) mother liquor: the penbritin powder is made into the 100mg/ml aqueous solution, and-20 ℃ save backup.

Kantlex ((Kanamycin, Kana) mother liquor: the kantlex powder is made into the 1000mg/ml aqueous solution, saves backup in-20 ℃.

1.1.7 the preparation of substratum

Intestinal bacteria LB substratum (liquid): 10g Trypeptone, 5g Yeast extract, 10g NaCl, add deionized water to 950ml, transfer pH to 7.2 with 5M NaOH, be settled to 1000ml, (121 ℃ of autoclavings, use (solid medium need to add 1.5% agar, sterilizes again) 20min).

Need the heat solid substratum to fully dissolving before being coated with flat board, be put in the aseptic operating platform, temperature is down to below 60 ℃, add 2 ‰ ammonia benzyl, be down flat rapidly plate behind the mixing.It is stand-by to put into 4 ℃ of refrigerators after good flat board dries.

1.2 experimental technique

1.2.1 enzyme is cut the design of box with synthetic

The primer of design clone's kalamycin resistance gene (Kana): pQE-T P1, pQE-T P2, primer sequence is shown in table 2., go out Kana fragment (utilize and introduce the screening that the Kana resistance is carried out the target clone) take the pET-28a plasmid as template through pcr amplification, change again the kanamycin gene expression cassette fragment that increases among the pMD-19T over to.Include a plurality of restriction enzyme sites (EcoR I, Hind III, Nco I, Xcm I, BamH I).Wherein Xcm I endonuclease digestion site in addition, adds 6 His labels at its 3' end at the two ends of kanamycin gene expression cassette, and is such as Fig. 5, shown in Figure 6.This tests required PCR primer shown in table 2..

The primer that this experiment of table 2. is required

1.2.1.1 filter out the Kana fragment with the PCR method

Kana gene order (pET-28a Kana fragment reading frame) is as follows, and wherein, underscore partly is the primer partial sequence of clone's kanamycin gene expression cassette:

ATGAGCCATATTCAACGGGAAACGTCTTGCTCTAGGCCGCGATTAAATTCCAACAT

GGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGC

GACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATG

GCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCT

GACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGC

ATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAAT

ATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTG

CATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTC

AGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAG

CGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATT

CTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGA

CGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGAT

ACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGA

AACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCA

TTTGAT GCTCGATGAGTTTTTCTAA

Get the PCR pipe of a 0.2ml, the pET-28a plasmid is added as template, PCR reaction cycle parameter is: 94 ℃, and denaturation 5min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s carry out 30 circulations, and 72 ℃ are extended 10min.React by following system.

Plasmid PCR reaction system (50 μ l):

1.2.1.2PCR the purifying of product

Target DNA carries out agarose gel electrophoresis, is cutting out the sepharose that contains target DNA, and weighs up the weight of glue.The gel that downcuts is put into the 1.5ml centrifuge tube, add BindingBuffer (XP2), add 2ml by every gram glue and calculate the volume that adds, 65 ℃ of heating 10min (per 1 ~ 2min takes out jolting); Solvent glue moved into reclaim in the post, the centrifugal 30s of 12000rpm refunds liquid that to reclaim post again centrifugal, and the centrifugal 1min of 12000rpm outwells waste liquid; Add Wash Buffer 700 μ l, centrifugal 12000rpm, 1min repeats once, and the 13000rpm 5min that dallies changes a new centrifuge tube, and pillar is put in, and uncaps and dries 10min; At the Elution Buffer of pillar adding 60 μ l, centrifugal behind the 2min, the centrifugal 2min of 12000rpm.The electrophoresis detection recovering effect.

Cut the box fragment by the pcr amplification enzyme, and carry out electrophoresis and identify.As seen from Figure 7, the enzyme that electrophoresis is identified is cut box PCR product size and is about 900bp, conforms to theoretical value, successfully amplifies the required kanamycin gene expression cassette (T-) of experiment.Kanamycin gene expression cassette fragment (T-Q) comprises a plurality of restriction enzyme sites (EcoR I, Hind III, Nco I, Xcm I, BamH I) and 6 His labels.

1.2.1.3PCR product is connected with the pMD-19T carrier

The fragment of cutting after glue reclaims is connected with the pMD-19T carrier, and 16 ℃ of lower connections spend the night.This connection product is just cut box (called after T-Q) for enzyme, and the ligation system is (10 μ l):

Change intestinal bacteria JM107 over to 1.2.1.4 connect product

Competent preparation:

1. be that 600 intestinal bacteria JM107 bacterium liquid is got 1ml in the 1.5ml centrifuge tube with the OD value, at precooling 10min on ice, 4 ℃ lower centrifugal, 4000rpm, 2min.

2. remove supernatant liquor, add 0.1mol/L CaCl2200 μ l, gently outstanding cell is placed 20min on ice, the centrifugal 2min of 4000rpm.

3. remove supernatant liquor, add 0.1mol/L CaCl2200 μ l, gently outstanding cell is placed 5min on ice.

Transform: inciting somebody to action before, ready-made goal gene fragment is transformed in the competent cell.

1. the connection product ice bath 20min of recombinant plasmid before taking out

2. the 5 μ l that get wherein join in the competence bacteria liquid

3.42 ℃ insulation 1min puts into rapidly ice, ice bath 5min behind the thermal shock

4. add the LB substratum of 800 μ l, behind the mixing, 37 ℃ of shaking culture 30min get on 200 μ l to the Kana resistance solid medium flat boards after making cellular-restoring normal growth state.

Observe dull and stereotyped next day, selects single bacterium colony, cultivates the recombinant plasmid called after pT-Q that contains in the thalline in the liquid LB substratum that contains 1 ‰ kalamycin resistances.

1.2.2 the structure of cloning vector pQE-T

1.2.2.1 enzyme is cut evaluation

Get 500 μ l bacterium liquid conservations and residue bacterium liquid is carried out plasmid extraction.Adopt the little extraction reagent kit of plasmid to extract plasmid: get the 1ml nutrient solution and pour in the 1.5ml centrifuge tube, the centrifugal 1min of normal temperature 12000rpm repeats 2 times; Abandon supernatant, waste liquid blots only in will managing with liquid-transfering gun; Bacterial sediment is resuspended in the 200 μ l solution I, adds the solution II 250 μ l of new preparation, covers tightly the mouth of pipe, and gentleness is put upside down centrifuge tube for several times, with the mixing content; The solution III that adds 350 μ l, 6-8 mixing of gentle vibration, the centrifugal 10min of 12000rpm; Supernatant liquor moves in the clean recovery post, and the centrifugal 1min of 8000rpm refunds pillar with liquid, recentrifuge, 12000rpm, 1min; Outwell liquid in the pipe, add 500 μ l Buffer HB, the centrifugal 1min of 12000rpm; Outwell waste liquid, add 700 μ l 70%Wash Buffer, the centrifugal 1min of 12000rpm repeats this step once; Outwell waste liquid, the 12000rpm 5min that dallies; Get a new Eppendorf pipe, pillar is put in, uncap and dry 10min.After pillar adds the Elution Buffer of 60 ℃ of preheatings, leaves standstill 2min, the centrifugal 2min of 12000rpm.The plasmid of carrying is carried out electrophoresis to be identified.

Enzyme is cut box T-Q to link to each other with the pMD-19T carrier, plasmid with its called after pT-Q, cultivation rear extraction plasmid is also identified behind double digestion, as shown in Figure 8, pT-Q electrophoresis size is about 3500bp, the clip size of downcutting behind the double digestion is about 900bp, and to cut box fragment (T-Q) close with enzyme, illustrates that enzyme is cut box fragment T-Q and the pMD-19T carrier connects and composes recombinant vectors.

After identifying correctly, plasmid is carried out double digestion (EcoR I, Hind III); Simultaneously the plasmid of pQE-30a carried out double digestion with same enzyme, it is as follows that enzyme is cut system:

Cut 5 hours at 37 ℃ of lower enzymes, all application of sample carries out electrophoresis, observes the result that enzyme is cut at the gel observation analyser, and the pT-Q after respectively enzyme being cut after evaluation is correct and pQE-30a fragment are cut glue and reclaimed.

With pT-Q EcoR I and Hind III double digestion, reclaiming the goal gene fragment is connected with the carrier pQE-30a that cuts with corresponding enzyme, form recombinant vectors pQE-TX, pQE-TX is converted into competent cell, extract plasmid after enzyme is cut evaluation, except the kanamycin gene gene fragment, the linearizing pQE-T recovery carrier part that ring-type pQE-TX is become with the dT lug tips namely is the pQE-T carrier through Xcm I single endonuclease digestion.See Fig. 9 swimming lane 4,5,6, the about 800bp of clip size that cuts out behind the pQE-TX process Xcm I single endonuclease digestion, cut the size of box T-Q near enzyme, pQE-TX by EcoR I and Hind III double digestion again cut out molecular size range close fragment, above result illustrates that all this plasmid is the carrier that experiment will make up, consistent with expected results, the success of pQE-T Vector construction.

1.2.2.2 connect

Be connected the T4 ligase enzyme to connect with pT-Q by the carrier pQE-30a of purifying double digestion, system following (20 μ l):

1.2.2.3 the screening of recombinant vectors

The goal gene fragment that connects is spent the night under 16 ℃ of conditions, and the recombinant vectors that will connect is transformed in the e. coli bl21 competent cell, getting 200 μ l is applied to and contains on the two resistance solid medium flat boards of Kana/Amp, cultivate about about 18 hours picking list bacterium colonies, extract plasmid after cultivating, carry out enzyme with restriction enzyme EcoR I and Hind III and cut evaluation.After identifying successfully plasmid being delivered to the large genome company of Beijing China checks order.

The pQE-TX plasmid is carried out the dna sequencing analysis, and the sequence of its 5 ' end and 3 ' end is seen Figure 10 a and Figure 10 b as a result, and lower redline part is respectively the XcmI restriction enzyme site that is positioned at the kanamycin gene both sides.

1.2.2.4 the linearizing of recombinant vectors pQE-TX

The recombinant vectors that order-checking is correct, called after pQE-TX carries out single endonuclease digestion with restriction enzyme Xcm I again, the fragment with kalamycin resistance gene is scaled off, thereby form two ends with the linearizing T carrier of outstanding dT, called after pQE-T.Single endonuclease digestion linearizing reaction system following (50 μ l):

1.2.3pQE-T the evaluation of expressive function

1.2.3.1PCR amplification RBP goal gene

As template amplification RBP gene, PCR reaction cycle parameter is with RBP cDNA: 94 ℃, and denaturation 5min; 94 ℃ of 30s, 57 ℃ of 45s, 72 ℃ of 1min carry out 30 circulations, and 72 ℃ are extended 10min.PCR reaction composition following (50 μ l):

1.2.3.2pQE-T carrier is connected with the hRBP gene

Linearizing pQE-T carrier is connected linked system following (20 μ l) with human retinol-binding protein gene (hRBP):

1.2.3.3pQE-RBP the conversion of recombinant vectors

With recombinant vectors called after pQE-RBP, change e. coli bl21 over to by the method for preamble narration and increase.The picking single strain is cultivated rear extraction plasmid.

1.2.3.4pQE-RBP single endonuclease digestion identify

Use restriction enzyme BamH I to carry out single endonuclease digestion the plasmid pQE-RBP that extracts, the enzyme time of cutting is 2h, single endonuclease digestion identification system following (20 μ l):

Linearizing pQE-T carrier is connected with hRBP, after containing the screening of Amp resistant panel, extracts plasmid.Plasmid is carried out BamH I single endonuclease digestion again and identify, the results are shown in Figure 11, swimming lane 3 is the recombinant plasmid pQE-RBP that extract, the about 3500bp of molecular size range; Swimming lane 4 is behind the BamHI single endonuclease digestion, and it is consistent with the hRBP clip size to cut out purpose band molecular size range, and is consistent with the experiment expected result, illustrates that RBP clones successfully, and pQE-RFP is carried out sequencing analysis, and the result shows, the sequence of hRBP and carrier exact connect ion.

1.2.3.5pQE-RBP the abduction delivering of recombinant plasmid

To contain the expression vector of gene fragment and the intestinal bacteria BL-21 of control group accesses respectively in the test tube of the LB substratum that contains 5ml, and in expressing protein bacterium liquid, add 5 μ l Amp(50mg/mL), insert concussion cultivation in the shaking table, after the OD600 value reaches 0.8, take out first 1ml bacterium liquid, be labeled as t0, the IPTG(24mg/mL that adds again 40 μ l) solution, behind the mixing, bacterium liquid is inserted 37 ℃ of concussions of constant-temperature table accompany fosterly, take out each 1ml of bacterium liquid at 1h, 3h, 5h respectively.

Sample takes out by the centrifugal 2min of 13000rpm, and sample is added ddH2O 80 μ l and 5 * SDS sample-loading buffer, 20 μ l, places 100 ℃ of water-bath 3-5min, and then the centrifugal 1min of 12000rpm room temperature carries out the SDS-PAGE electrophoresis.

After cultured bacterium liquid IPTG induces, so carry out the SDS-PAGE electrophoresis, the results are shown in Figure 12, the result shows that being about the 25kD place at molecular weight has obvious protein band.And visible protein expression amount along with induction time and increase.

1.2.3.6RBP the Western Blotting of albumen

1. carry out the SDS-PAGE protein electrophoresis after will containing the abduction delivering of pQE-RBP recombinant plasmid.

2. transferring film: electrophoresis is finished, and gel is immersed half-dried electricity turn balance 1min in the liquid.Pvdf membrane and 6 filter paper that clip is identical with the separation gel size.Pvdf membrane soaks in methyl alcohol first, then changes 2min in the ultrapure water over to, and rear taking-up is immersed electricity and turned 5-10min in the liquid.Stack successively filter paper (3 layers), film, gel, filter paper (3 layers) from bottom to top, be placed on that GE is half-dried to be turned on the instrument positive plate, cover the loam cake with negative plate.With 8mA/cm2 electric current transfer printing 80min, albumen is gone on the pvdf membrane.

3. sealing: the pvdf membrane that will seal after shifting is put into confining liquid, seals 1-2h under the room temperature.

4. primary antibodie is hatched: from confining liquid pvdf membrane is taken out, add respectively anti-His Tag(mouse-anti) as primary antibodie, with the confining liquid dilution, the Dilution ratio of optimization is 1:2000, hatches 1h for 37 ℃.Primary antibodie is hatched one and a half hours, and (1 ~ 2h) afterwards, takes out pvdf membrane, washes film 3 times with TBST, each 10min.

5. two anti-hatching: with the confining liquid dilution, extension rate is 1:2000 with two anti-(sheep anti mouses); Film is changed in the 15mL centrifuge tube, add two anti-(liquor capacity on every 1cm2 membrane area is about 0.1mL) that are dissolved in confining liquid, place room temperature jolting 1h on the shaking table.Then take out filter membrane, with TBST rinsing 3 times, each 10min, anti-to remove unconjugated two.

6. colour developing.

This experiment utilizes mouse-anti His Tag monoclonal antibody, the expression product that contains recombinant plasmid pQTE-RBPBL21 (DE3) has been carried out Western Blotting to be detected, as seen from Figure 13, being about the 25kD place at molecular weight in the recombinant expressed bacterium has band with anti-His antibody response, and does not have specific reaction band at empty plasmid thalline BL21 correspondence position.

1.2.3.7hRBP protein spectrum is identified

To induce the RBP protein band of acquisition to downcut behind the SDS-PAGE electrophoresis to be sent to Shenzhen University's Life Science College mass spectrum chamber and carry out Mass Spectrometric Identification.

In order further to prove the exactness of expressing protein, carry out mass spectroscopy by SDS-PAGE electrophoresis cutting purpose band, protein peptide fingerprint image by Figure 14 can be found out: in the 0.5-1.0KD limit of error, the same during the mass spectral:mass spectrographic peak value of nearly all peptide section and the natural RBP that retrieves in MS-Digest Search Result.In the peptide fingerprinting spectrum of Figure 14, wherein have following clearly peak value: 961.20,1161.14,1198.21,1246.18,1304.17,1457.16,1619.09,2007.02,2635.75,3011.80,3139.87, the corresponding peptide section among the corresponding MS-Digest Search Result respectively.And the peptide section sequence of finding in the corresponding peptide section sequence of these peak values and the ncbi database is also substantially corresponding.On the whole, this recombinant protein is consistent with the peptide section of RBP, and the RBP that this experiment clonal expression is described is correct.

The constructed pQE-T carrier of present embodiment by connecting human retinol-binding protein gene (hRBP), and carries out the expressive function that the T carrier pQE-T carrier of structure is identified in the protein expression functional analysis after evaluation successfully constructs.The hRBP gene is connected with linearizing pQE-T carrier, then import to express in the bacterium e. coli bl21 and carry out abduction delivering, detect the RBP protein spectrum through Western Blotting, the result all shows the hRBP albumen correction of clonal expression, proves that thus constructed T carrier is correct.

Embodiment 2 yeast surface display T Vector construction and Function Identification thereof

The sequence that the yeast surface display T carrier pYD-T carrier enzyme that present embodiment makes up is cut box as shown in figure 16, design and utilize two ends to cut box with the enzyme in Xcm I endonuclease digestion site, enzyme is cut the box two ends and is added respectively NheI, BamH I and NdeI, Xho I restriction enzyme site, then recombinate Nhe I, XholI enzyme cuts on the pYD-1 carrier after the processing, the plasmid of the restructuring that order-checking is correct is used Xcm I restriction endonuclease single endonuclease digestion again, the fragment that contains with the yellow fluorescence protein gene is scaled off, thereby form two ends with the linearizing T-carrier of outstanding dT.At last, utilize red fluorescent protein (RFP) to identify the expressive function of the T carrier of structure, by usefulness T4 ligase enzyme and the T carrier of being connected behind the dna fragmentation pcr amplification of RFP gene are connected, then import and carry out abduction delivering among the yeast saccharomyces cerevisiae EBY-100, identify by laser confocal microscope, prove thus the exactness of constructed T carrier.The technological line of this experimental design is seen Figure 15, and constructed pYD-T carrier structure as shown in figure 16.

2.1 material

2.1.1 bacterial strain and carrier

Intestinal bacteria JM107 genotype: endA1, yrA96, thi, hsdR17, supE44, relA1, △ (lac-proAB)/F'[traD36, proAB+, lac Iq, lacZ △ M15];

E. coli bl21 (DE3) genotype: F', ompT, hsdSB (rB-mB-), gal (λ cI857, ind1, Sam7, nin5, lacUV5-T7gene1), dcm (DE3);

PMD-19T carrier, pDsRed1-N1, pEYFP-C1, pYD-1 carrier.

2.1.2 main agents

RNA enzyme, restriction endonuclease are purchased from NheI, BamH I, NdeI, Xho I, and the T4DNA ligase enzyme is available from Takara company; Restriction endonuclease Xcm I is purchased from NEB company; Other reagent are domestic analytical pure.

2.1.3 key instrument equipment: high-pressure sterilizing pot, electronic balance, pcr amplification instrument, agarose gel electrophoresis instrument, spectrophotometer, electro-heating standing-temperature cultivator, constant temperature culture oscillator, refrigerated centrifuge etc.

2.1.4 the preparation of main agents

(1) agarose gel electrophoresis damping fluid: 50 * TAE Buffer:242g Tris alkali, 57.1mlHAc, 100ml0.5M EDTA (pH8.0) is settled to 1000ml.Dilution is 1 * TAE Buffer during use.

(2) intestinal bacteria LB substratum: 10g Trypeptone, 5g Yeast extract, 10g NaCl adds deionized water to 1000ml, transfers pH to 7.2, autoclaving with 5M NaOH.

(3) penbritin (Ampicillin, Amp) mother liquor: be made into the 50mg/ml aqueous solution ,-20 ℃ save backup.

(4) yeast YPDA substratum: peptone 20g, yeast extract 10g, 0.2%adeninehemisurfate15ml, add deionized water and be settled to 900ml, transfer pH to 6.5, be settled to 950ml, behind autoclaving, be cooled to 55 ℃, add 40% aseptic glucose 50ml to final concentration be 2%.

(5) yeast SD substratum: without amino yeast nitrogen 6.7g, 10xDropout Solution(L-adenine hemisulfate 200mg/L, L-Arginine HCl 200mg/L, L-Histicline HCl monohydrate 200mg/L, L-Isoleucine 300mg/L, L-Leucine 1000mg/L, L-Lysine300mg/L, L-Methionine 200mg/L, L-Phenylalanine 500mg/L, L-Threonine2000mg/L, L-Tryptophan 200mg/L, L-Tyrosine 300mg/L, L-Urail 200mg/L, L-Valine 1500mg/L) 100ml, add deionized water to 900ml, transfer pH to 5.8, be settled to 950ml, be cooled to 55 ℃ behind autoclaving, adding 40% aseptic glucose is 2% to 50ml to final concentration.

(6) yeast SD inducing culture: without amino yeast nitrogen 6.7g, 10xDropout Solution(L-adenine hemisulfate 200mg/L, L-Arginine HCl 200mg/L, L-Histicline HClmonohydrate 200mg/L, L-Isoleucine 300mg/L, L-Leucine 1000mg/L, L-Lysine300mg/L, L-Methionine 200mg/L, L-Phenylalanine 500mg/L, L-Threonine2000mg/L, L-Tryptophan 200mg/L, L-Tyrosine 300mg/L, L-Urail 200mg/L, L-Valine 1500mg/L) 100ml, add deionized water to 900ml, transfer pH to 5.8, be settled to 950ml, be cooled to 55 ℃ behind autoclaving, adding 40% aseptic semi-lactosi is 2% to 50ml to final concentration.

(7) PBS buffered soln: NaCl8g, KCl0.2g, Na2HPO41.42g, KH2PO40.27g transfers pH to 7.4.

Cut box amplification and purifying 2.2 contain the enzyme of yellow fluorescence protein gene (YFP) fragment

2.2.1 enzyme is cut the amplification of box

Establish primer according to the yellow fluorescence protein gene order, synthetic via the large gene of China, primer sequence sees Table 3, the primer two ends are introduced the enzyme in Xcm I endonuclease digestion site and are cut box, enzyme is cut the box two ends and is added respectively restriction endonuclease sites NheI, NdeI, Xho I, BamH I, and concrete restriction enzyme site distributes as shown in figure 17.

Table 3. enzyme is cut the primer sequence of box PCR reaction

The plasmid pDsRed1-N1 that will contain yellow fluorescence protein gene (YFP) cuts box yellow fluorescence protein gene as the template amplification enzyme, and PCR reaction cycle parameter is: 94 ℃, and denaturation 5min; 94 ℃ of 30s, 56 ℃ of 45s, 72 ℃ of 10min carry out 30 circulations, and 72 ℃ are extended 7min.Carry out PCR reaction (50 μ l) by following system:

2.2.2 enzyme is cut the purifying of the PCR product of box and is reclaimed

Target DNA carries out agarose gel electrophoresis, is cutting out the sepharose that contains target DNA, and weighs up the weight of glue.The gel that downcuts is put into the 1.5ml centrifuge tube, add BindingBuffer (XP2), add 2ml by every gram glue and calculate the volume that adds, 65 ℃ of heating 10min (per 1 ~ 2min takes out jolting); Solvent glue moved into reclaim in the post, the centrifugal 30s of 12000rpm refunds liquid that to reclaim post again centrifugal, and the centrifugal 1min of 12000rpm outwells waste liquid; Add Wash Buffer 700 μ l, centrifugal 12000rpm, 1min repeats once, and the 13000rpm 5min that dallies changes a new centrifuge tube, and pillar is put in, and uncaps and dries 10min; At the Elution Buffer of pillar adding 60 μ l, centrifugal behind the 2min, the centrifugal 2min of 12000rpm.The electrophoresis detection recovering effect.

2.3 enzyme is cut the Construction and identification of box

2.3.1PCR product is connected with the pMD-19T carrier

PCR product after reclaiming is connected with the pMD19-T carrier, and 16 ℃ of lower reactions are spent the night.Linked system following (10 μ l):

Be transformed into intestinal bacteria JM107 2.3.2 connect product

The preparation of competent escherichia coli cell:

1. be that 600 intestinal bacteria JM107 bacterium liquid is got 1ml in the 1.5ml centrifuge tube with the OD value, at precooling 10min on ice, 4 ℃ lower centrifugal, 4000rpm, 2min.

2. remove supernatant liquor, add 0.1mol/L CaCl2200 μ l, gently outstanding cell is placed 20min on ice, the centrifugal 2min of 4000rpm.

3. remove supernatant liquor, add 0.1mol/L CaCl2200 μ l, gently outstanding cell is placed 5min on ice.

Transform: inciting somebody to action before, ready-made goal gene fragment is transformed in the competent cell.

1. the connection product ice bath 20min of recombinant plasmid before taking out

2. the 5 μ l that get wherein join in the competence bacteria liquid

3.42 ℃ insulation 1min puts into rapidly ice, ice bath 5min behind the thermal shock

4. add the LB substratum of 800 μ l, behind the mixing, 37 ℃ of shaking culture 30min make and get 200 μ l behind the cellular-restoring normal growth state and be coated with on the Amp resistance solid medium flat board.

Picking list bacterium colony after cultivating is cultivated recombinant vectors called after pMD-YFP in the liquid LB substratum that contains 1 ‰ Amp resistances.

2.3.3 the evaluation of cloning vector

Bacterium liquid after cultivating is extracted plasmid pMD-YFP, use restriction enzyme XhoI, NheI carries out double digestion to be identified.With the pYD1 plasmid, also use same digestion with restriction enzyme in addition, react 3h in 37 ℃ of thermostat water baths, more than the enzyme of two kinds of plasmids cut and use identical reaction system, (50 μ l) specific as follows:

2.4 the Construction and identification of recombinant vectors PYD-T

2.4.1 the structure of recombinant vectors PYD-TX

Enzyme is cut product and is carried out agarose electrophoretic analysis, reclaims according to the glue of cutting shown in the Marker that enzyme that plasmid pMD-YFP cuts out is cut the box fragment and enzyme is cut rear pYD1 plasmid, and method for purifying and recycling as mentioned before.The pYD1 plasmid that recovery is good is cut the box fragment with enzyme and is connected the recombinant vectors called after pYD-TX of formation.Ligation is spent the night linked system following (20 μ l) 16 ℃ of lower reactions:

2.4.2 the evaluation of recombinant vectors PYD-TX

Recombinant vectors PYD-TX is transformed among the intestinal bacteria JM107, and method for transformation as mentioned before.Select single bacterium colony after the cultivation, cultivate in a large number in the liquid LB substratum that contains 1 ‰ AMP resistances, use restriction enzyme Xho I and restriction enzyme Nhe I to carry out the double digestion enzyme behind the extraction plasmid and cut evaluation, enzyme is cut system as mentioned before.After electrophoresis is identified correctly, will utilize restriction enzyme XcmI to carry out single endonuclease digestion with recombinant vectors PYD-TX linearizing, Xcm I single endonuclease digestion system following (200 μ l):

Enzyme is cut product cuts glue and reclaim, step as mentioned before, the linearizing carrier two ends of gained have single-T residue, are this carriers of testing required structure, called after PYD-T.

The enzyme that contains the 770bp gene of having an appointment of pcr amplification is cut the box fragment and is cloned in the pMD-19T carrier, extracts plasmid and cuts evaluation (seeing Figure 18, swimming lane 2,3) with restriction enzyme Nhe I and Xho I enzyme.Enzyme is cut fragment (Figure 18, swimming lane 3) that box is about 760bp cut glue and reclaim, be connected among the yeast surface display expression vector pYD-1 with the respective limits endonuclease digestion, obtain the pYD-YFP recombinant plasmid, see Figure 18, swimming lane 4.Its molecular weight is approximately 5.5kb.The pYD-YFP recombinant plasmid is through behind NheI and Xho I double digestion and the XcmI single endonuclease digestion, obtain respectively the purpose band of about 790bp and the purpose band of about 760bp (see Figure 18. swimming lane 5 and swimming lane 6), prove that the pYD-T vector construction is successfully.

The surface display of yeast surface display expression vector pYD-YFP: after yeast conversion is induced about 72h by the SD inducing culture, the cell surface whole observation figure that under laser confocal microscope, photographs, see A-C among Figure 19 and the cell surface partial enlarged drawing that under laser confocal microscope, photographs, see the D-F of Figure 19.Cellular form among the figure is circle, and can part cell just at gemmation, it is contaminated therefore can to infer that this cultured cells does not have.All can clearly see that yeast surface display is rendered as green glow from Figure 19, this is because of the synthetic light that presents two kinds of light with the yeast of yellow fluorescence protein gene under the exciting of green light, is green.Among Figure 19, the green of part yeast surface is the aperture shape, and this explanation yellow fluorescence protein gene has really correctly been expressed in yeast and showed.The green bobbles shape that also has simultaneously the part yeast surface, this is because confocal laser scanning microscope arrives the surface of yeast thalline.

2.5 the Function Identification of recombinant vectors PYD-T

This experiment is by being connected recombinant vectors PYD-T and carrying out protein expression analysis directed cloning and the yeast surface display function vector of PYD-T are identified with red fluorescent protein gene (RFP).

2.5.1 red fluorescent protein gene (RFP) amplification and purifying

With containing red fluorescent protein gene plasmid pDsRed as template design primer, synthetic by the large gene of China, primer sequence is as shown in table 4, and downstream primer 5 ' end is introduced restriction enzyme BamH I restriction enzyme site, carries out PCR product directed cloning in order to subsequent experimental.

Primer sequence in the PCR reaction of table 4.RFP

Add amplification red fluorescent protein gene (RFP) with containing red fluorescent protein gene plasmid pDsRed as template, PCR reaction cycle parameter is: 94 ℃, and denaturation 5min; 94 ℃ of 30s, 57 ℃ of 45s, 72 ℃ of 10min carry out 30 circulations, and 72 ℃ are extended 10min.PCR reaction composition following (50 μ l):

2.5.2RFP being connected of PCR product and pYD-T carrier

Red fluorescent protein gene (RFP) is connected with pYD-T, and linked system following (20 μ l) is spent the night in 16 ℃ of lower reactions:

Change e. coli bl21 over to 2.5.3 connect product pYD-RFP

With recombinant vectors called after pYD-RFP, change e. coli bl21 over to by the method for preamble narration and increase.The picking single strain is cultivated rear extraction plasmid.The closure of RFP gene and carrier in the use BamH I single endonuclease digestion evaluation plasmid, the RFP gene that shows that cuts out correct purpose band is connected with carrier pYD-T forward.The pYD-RFP plasmid of identifying correct connection is stored in-20 ℃ to be saved backup.

2.5.4 yeast conversion

2.5.4.1 the preparation of yeast EBY100 competent cell

The picking diameter be the single bacterium colony of the yeast EBY-100 of 2-3mm in 10ml YPDA liquid nutrient medium in 30 ℃, 250rpm cultivated 16-18 hour.Shift bacterium liquid in the fresh YPDA substratum of 50ml, 30 ℃, continue under the 250rpm to cultivate 3-5 hour.Under the aseptic condition, the centrifugal 5min of 3000rpm abandons supernatant.With the resuspended thalline of 30ml sterilized water, recentrifuge 5min abandons supernatant in the 3000rpm room temperature.Add 1.1 * TE/LiAc and the resuspended thalline of 7.8mlH2O of 1.5ml, be transferred in the 1.5ml centrifuge tube, centrifugal 2 minutes of 3000rpm abandons supernatant.Add 600 μ l1.1 * TE/LiAc solution and be used for Plasmid Transformation behind the resuspended thalline gently.

2.5.4.2 recombinant plasmid transformed yeast EBY-100 competent cell

Get 10 μ l recombinant plasmid pYD-RFP and 5 μ l through salmon sperm DNA (HerringTestes Carrier DNA, the Clontech) mixing of denaturing treatment; Add 100 μ l yeast EBY100 competent cell will with the PEG/LiAc solution (8ml 50%PEG4000,1ml 10 * TE Buffer, 1ml10xLiAc) of 600 μ l mixing gently, 30 ℃ of water-bath 30min; Then add 70 μ l DMSO mixings, 42 ℃ of water-bath 15min; Centrifugal 5 minutes of 7000rpm abandons supernatant; Add 500 μ l 1xTE Buffer(100mM Tris-HCl, 1mM EDTA, pH7.5) resuspended thalline; Then get 100 μ l bacterium liquid, be laid on SD/-Trp culture plate (being used for the yeast EBY100 transformant that screening contains recombinant plasmid), be inverted 30 ℃ of culture plates and cultivated the transformant that screening is positive 4-6 days; Picking mono-clonal bacterium colony is by the Insert Fragment of recombinant plasmid in the PCR evaluation yeast EBY100 transformant.

2.5.5 yeast is cultivated and protein induced Expression and Identification

2.5.5.1 the abduction delivering of target protein

The picking diameter is that the single bacterium colony of the yeast EBY100 of 2-3mm is in 10ml yeast SD/-Trp liquid nutrient medium (containing 2%glucose); 30 ℃, be cultured to the OD600 value under the 250rpm between 2.0-5.0.Collect thalline (the centrifugal 5min of 5000rpm room temperature), with the resuspended thalline of 5ml yeast SD/-Trp liquid nutrient medium (containing 2%glucose), it is added in the 50ml yeast SD/-Trp liquid nutrient medium (containing 2%glucose), make initial OD 600 values between the 0.5-1.0,20 ℃, 250rpm cultivates 48-72h.

2.5.5.2 the evaluation of target protein

Choose respectively and shake each 300 μ of the yeast that contains recombinant plasmid pYD-T and pYD-RFP that spend the night, 1000rpm is centrifugal 5 minutes under the room temperature, removes supernatant liquor, with the resuspended thalline of 1mlPBS solution, place culture dish at the bottom of the glass, use laser confocal microscope to observe and photographic images.

PYD-RFP surface display Vector construction and surface display are identified: by pcr amplification red fluorescent protein gene (RFP), agarose gel electrophoresis the results are shown in Figure 20, is about 750bp, the size of theoretical value by swimming lane 1 visible PCR product size; By swimming lane 2 as seen, when the PCR product with transform competent escherichia coli cell after yeast surface display carrier-pellet pYD-T is connected after, extract the plasmid electrophoresis after, size is about 5.3kb.This plasmid is cut the swimming lane 3 that rear electrophoresis the results are shown in Figure 20 through enzyme.The result shows that the vector plasmid size is about 5.3kb, and the endonuclease bamhi size is basically identical with the PCR product, at about 750bp place.Identify the mode of connection of RFP and carrier behind BamH I single endonuclease digestion, above result shows that pYD-RFP successfully constructs, and the RFP exact connect ion is on carrier.

The surface display of yeast surface display expression vector pYD-RFP: from Figure 21. can find, yeast surface presents redness under ultraviolet excitation, have the part yeast to present red aperture phenomenon in visual field central authorities, illustrate the red fluorescent protein gene successfully in the T carrier and correction show.The red bobbles shape that also has simultaneously the part yeast surface, this is because confocal laser scanning microscope arrives the surface of yeast thalline.

The pYD-T carrier that present embodiment makes up by connection red fluorescent protein gene (RFP), and carries out the expressive function that laser confocal microscope is identified the T carrier pYD-T carrier that makes up after the laser confocal microscope evaluation successfully constructs.The RFP gene is connected with linearizing pYD-T carrier, then import to express among the bacterium yeast saccharomyces cerevisiae EBY-100 and carry out abduction delivering, detect evaluation through laser confocal microscope, the result shows that the RFP albumen of clonal expression correctly in the yeast expression displaying, proves that thus constructed T carrier is correct.

PCR is at present efficient amplification of DNA fragments method commonly used, the PCR product is cloned fast and effectively, be that foundation, hybridization analysis, the high quality order-checking of carrying out Gene conservation, gene library reaches downstream experiments such as separating the purpose fragment from complicated PCR product, realize the multi-purpose the only way which must be passed of PCR product.For this reason, the directed TA clone technology of the present invention can be used as the T carrier of the efficient directed cloning of preparation, is widely used in clone and the expression of PCR product in molecular biology experiment.Because what the present invention transformed is expression vector, the PCR product can directly connect this carrier, after identifying, single endonuclease digestion determines the closure of goal gene, can change in the cell and express, and need not could determine closure by traditional loaded down with trivial details steps such as order-checking, method with simple and fast realizes directed cloning, and a step is constructed engineering bacteria, has a extensive future.The present invention is through experimental identification, at prokaryotic expression system and eukaryotic expression system the effect of directed cloning arranged all, has versatility, can be used for the transformation of variety carrier.

Should be understood that, for those of ordinary skills, can be improved according to the above description or conversion, and all these improvement and conversion all should belong to the protection domain of claim of the present invention.

SEQUENCE LISTING

＜110〉Shenzhen University

＜120〉remodeling method of a kind of directed cloning method and carrier and T carrier

<130>20080502

<160>9

<170>PatentIn version 3.5

<210>1

<211>19

<212>DNA

<213>Artificial Sequence

<220>

＜223〉upstream RBP primer

<400>1

atgaagtggg tgtgggcgc 19

<210>2

<211>30

<212>DNA

<213>Artificial Sequence

<220>

＜223〉downstream RBP primer

<400>2

ggatcccaaa aggtttcttt ctgatctgcc 30

<210>3

<211>70

<212>DNA

<213>Artificial Sequence

<220>

＜223〉pQE T upstream primer

<400>3

gaattcatta aagaggagaa attaaccatg ggatccagaa ttttaatggg tatgagccat 60

attcaacggg 70

<210>4

<211>60

<212>DNA

<213>Artificial Sequence

<220>

＜223〉pQE T downstream primer

<400>4

aagcttaatg atgatgatga tgatgtccac cttttctatg gttagaaaaa ctcatcgagc 60

<210>5

<211>816

<212>DNA

<213>Artificial Sequence

<220>

＜223〉Kana gene order (pET 28a Kana fragment reading frame)

<400>5

atgagccata ttcaacggga aacgtcttgc tctaggccgc gattaaattc caacatggat 60

gctgatttat atgggtataa atgggctcgc gataatgtcg ggcaatcagg tgcgacaatc 120

tatcgattgt atgggaagcc cgatgcgcca gagttgtttc tgaaacatgg caaaggtagc 180

gttgccaatg atgttacaga tgagatggtc agactaaact ggctgacgga atttatgcct 240

cttccgacca tcaagcattt tatccgtact cctgatgatg catggttact caccactgcg 300

atccccggga aaacagcatt ccaggtatta gaagaatatc ctgattcagg tgaaaatatt 360

gttgatgcgc tggcagtgtt cctgcgccgg ttgcattcga ttcctgtttg taattgtcct 420

tttaacagcg atcgcgtatt tcgtctcgct caggcgcaat cacgaatgaa taacggtttg 480

gttgatgcga gtgattttga tgacgagcgt aatggctggc ctgttgaaca agtctggaaa 540

gaaatgcata aacttttgcc attctcaccg gattcagtcg tcactcatgg tgatttctca 600

cttgataacc ttatttttga cgaggggaaa ttaataggtt gtattgatgt tggacgagtc 660

ggaatcgcag accgatacca ggatcttgcc atcctatgga actgcctcgg tgagttttct 720

ccttcattac agaaacggct ttttcaaaaa tatggtattg ataatcctga tatgaataaa 780

ttgcagtttc atttgatgct cgatgagttt ttctaa 816

<210>6

<211>40

<212>DNA

<213>Artificial Sequence

<220>

＜223〉contain the upstream primer that yellow fluorescence protein gene fragment enzyme is cut box PCR reaction

<400>6

gctagcggat ccaccagaat tcttatggtg agcaagggcg 40

<210>7

<211>44

<212>DNA

<213>Artificial Sequence

<220>

＜223〉contain the downstream primer that yellow fluorescence protein gene fragment enzyme is cut box PCR reaction

<400>7

ctcgagcata tgaccactat tactatggtt acttgtacag ctcg 44

<210>8

<211>16

<212>DNA

<213>Artificial Sequence

<220>

＜223〉PCR of red fluorescent protein gene reaction middle and upper reaches primer sequence

<400>8

atggcctcct ccgagg 16

<210>9

<211>22

<212>DNA

<213>Artificial Sequence

<220>

＜223〉PCR of red fluorescent protein gene reaction middle and lower reaches primer sequence

<400>9

ggatccctac aggaacaggt gg 22

SEQUENCE LISTING

＜110〉Shenzhen University

＜120〉remodeling method of a kind of directed cloning method and carrier and T carrier

<130> 20080502

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

＜223〉upstream RBP primer

<400> 1

atgaagtggg tgtgggcgc 19

<210> 2

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

＜223〉downstream RBP primer

<400> 2

ggatcccaaa aggtttcttt ctgatctgcc 30

<210> 3

<211> 70

<212> DNA

<213> Artificial Sequence

<220>

＜223〉pQE-T upstream primer

<400> 3

gaattcatta aagaggagaa attaaccatg ggatccagaa ttttaatggg tatgagccat 60

attcaacggg 70

<210> 4

<211> 60

<212> DNA

<213> Artificial Sequence

<220>

＜223〉pQE-T downstream primer

<400> 4

aagcttaatg atgatgatga tgatgtccac cttttctatg gttagaaaaa ctcatcgagc 60

<210> 5

<211> 816

<212> DNA

<213> Artificial Sequence

<220>

＜223〉Kana gene order (pET-28a Kana fragment reading frame)

<400> 5

atgagccata ttcaacggga aacgtcttgc tctaggccgc gattaaattc caacatggat 60

gctgatttat atgggtataa atgggctcgc gataatgtcg ggcaatcagg tgcgacaatc 120

tatcgattgt atgggaagcc cgatgcgcca gagttgtttc tgaaacatgg caaaggtagc 180

gttgccaatg atgttacaga tgagatggtc agactaaact ggctgacgga atttatgcct 240

cttccgacca tcaagcattt tatccgtact cctgatgatg catggttact caccactgcg 300

atccccggga aaacagcatt ccaggtatta gaagaatatc ctgattcagg tgaaaatatt 360

gttgatgcgc tggcagtgtt cctgcgccgg ttgcattcga ttcctgtttg taattgtcct 420

tttaacagcg atcgcgtatt tcgtctcgct caggcgcaat cacgaatgaa taacggtttg 480

gttgatgcga gtgattttga tgacgagcgt aatggctggc ctgttgaaca agtctggaaa 540

gaaatgcata aacttttgcc attctcaccg gattcagtcg tcactcatgg tgatttctca 600

cttgataacc ttatttttga cgaggggaaa ttaataggtt gtattgatgt tggacgagtc 660

ggaatcgcag accgatacca ggatcttgcc atcctatgga actgcctcgg tgagttttct 720

ccttcattac agaaacggct ttttcaaaaa tatggtattg ataatcctga tatgaataaa 780

ttgcagtttc atttgatgct cgatgagttt ttctaa 816

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

＜223〉contain the upstream primer that yellow fluorescence protein gene fragment enzyme is cut box PCR reaction

<400> 6

gctagcggat ccaccagaat tcttatggtg agcaagggcg 40

<210> 7

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

＜223〉contain the downstream primer that yellow fluorescence protein gene fragment enzyme is cut box PCR reaction

<400> 7

ctcgagcata tgaccactat tactatggtt acttgtacag ctcg 44

<210> 8

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

＜223〉PCR of red fluorescent protein gene reaction middle and upper reaches primer sequence

<400> 8

atggcctcct ccgagg 16

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

＜223〉PCR of red fluorescent protein gene reaction middle and lower reaches primer sequence

<400> 9

ggatccctac aggaacaggt gg 22

Claims (10)

1. the method for a directed cloning is characterized in that, specifically may further comprise the steps:

Design and synthesize enzyme and cut box: described enzyme is cut the two ends of box with Xcm I endonuclease digestion site, and adds respectively other restriction enzyme sites at the two ends that described enzyme is cut box;

Make up the T carrier: described enzyme is cut box be building up on the carrier, obtain the T carrier with two Xcm I endonuclease digestion sites;

Form two ends with the linearizing T carrier of outstanding dT: adopt Xcm I restriction endonuclease that described the second expression vector is carried out single endonuclease digestion, form two ends with the linearizing T carrier of outstanding dT;

Generate target gene PCR fragment: with the target gene fragment with the pcr amplification method 5 ' or 3 ' end add one with 3 ' or 5 ' of T carrier hold corresponding identical restriction endonuclease sites, obtain target gene PCR fragment, described corresponding identical restriction endonuclease sites all has and only has one in target P CR fragment with in the T carrier;

Structure contains the recombinant vectors of target gene: with the T4 ligase enzyme target gene PCR fragment and T carrier are coupled together and consist of the recombinant vectors that contains target gene.

2. the method for directed cloning according to claim 1 is characterized in that, the method for described directed cloning is further comprising the steps of:

Transform and identify: the described recombinant vectors that contains target gene is changed in the competent escherichia coli cell, obtain the mono-clonal bacterium colony by being coated with resistant panel, picking mono-clonal bacterium colony carries out enlarged culturing, then extract plasmid, carry out single endonuclease digestion with restriction enzyme again and identify, determine the closure of target gene;

Wherein, the restriction enzyme described in conversion and the authentication step is for generating the corresponding restriction enzyme of restriction endonuclease sites described in the target gene PCR fragment step.

3. the method for directed cloning according to claim 1 is characterized in that, the described enzyme that designs and synthesizes is cut the box step, may further comprise the steps:

The complex sign gene, whether described marker gene successfully amplifies described enzyme and cuts box for the identification of cutting box with the described enzyme of screening;

Add a plurality of restriction enzyme sites at the two ends of described marker gene, wherein, the two ends of described marker gene all are added with an Xcm I endonuclease digestion site;

Cut the box fragment by the described enzyme of pcr amplification.

4. the method for directed cloning according to claim 1 is characterized in that, in the described structure T carrier step, may further comprise the steps:

Described enzyme is cut the box fragment link to each other with the pMD-19T carrier, obtain cutting with described enzyme the first recombinant vectors of box;

Described the first recombinant vectors is transformed in the competent cell, and picking list bacterium colony after cultivating carries out enlarged culturing, extracts described the first recombinant vectors from bacterium liquid;

Carrier and described the first recombinant vectors are carried out double digestion with same restriction enzyme respectively;

Carrier after reclaiming enzyme that described the first recombinant vectors cuts out and cutting box fragment and enzyme and cut;

Carrier after the enzyme that described recombinant vectors is cut out is cut the box fragment and enzyme is connected connects, and forms the second recombinant vectors;

The second recombinant vectors is converted into competent cell, and picking list bacterium colony after cultivating carries out enlarged culturing, extracts described the second recombinant vectors from bacterium liquid;

Described the second recombinant vectors is carried out enzyme with above-mentioned same restriction enzyme cut evaluation, after identifying correctly, obtain the T carrier with two Xcm I endonuclease digestion sites.

5. the remodeling method of a carrier is characterized in that, may further comprise the steps:

Design and synthesize enzyme and cut box: described enzyme is cut the two ends of box with Xcm I endonuclease digestion site, and adds respectively other restriction enzyme sites at the two ends that described enzyme is cut box;

Make up the T carrier: described enzyme is cut box be building up on the carrier, obtain the T carrier with two Xcm I endonuclease digestion sites;

Described carrier is carrier to be transformed, and described carrier is clonotype carrier or expression vector.

6. the remodeling method of carrier according to claim 5 is characterized in that, the described enzyme that designs and synthesizes is cut the box step, may further comprise the steps:

The complex sign gene, whether described marker gene successfully amplifies described enzyme and cuts box for the identification of cutting box with the described enzyme of screening;

Add a plurality of restriction enzyme sites at the two ends of described marker gene, wherein, the two ends of described marker gene all are added with an Xcm I endonuclease digestion site;

Cut the box fragment by the described enzyme of pcr amplification.

7. the remodeling method of carrier according to claim 6 is characterized in that, described structure T carrier step may further comprise the steps:

Described enzyme is cut the box fragment link to each other with the pMD-19T carrier, obtain cutting with described enzyme the first recombinant vectors of box;

Described the first recombinant vectors is transformed in the competent cell, and picking list bacterium colony after cultivating carries out enlarged culturing, extracts described the first recombinant vectors from bacterium liquid;

Carrier and described the first recombinant vectors are carried out double digestion with same restriction enzyme respectively;

Carrier after reclaiming enzyme that described the first recombinant vectors cuts out and cutting box fragment and enzyme and cut;

Carrier after the enzyme that described recombinant vectors is cut out is cut the box fragment and enzyme is connected connects, and forms the second recombinant vectors;

The second recombinant vectors is converted into competent cell, and picking list bacterium colony after cultivating carries out enlarged culturing, extracts described the second recombinant vectors from bacterium liquid;

Described the second recombinant vectors is carried out enzyme with above-mentioned same restriction enzyme cut evaluation, after identifying correctly, obtain the T carrier with two Xcm I endonuclease digestion sites.

8. the remodeling method of carrier according to claim 7 is characterized in that, the remodeling method of described carrier is further comprising the steps of:

Described T carrier is carried out single endonuclease digestion with Xcm I restriction endonuclease, form two ends with the linearizing T carrier of outstanding dT.

9. T carrier, described T carrier is the T carrier with directed cloning function, it is characterized in that, described T carrier is to adopt the remodeling method such as the arbitrary described carrier of claim 6 ~ 8 that carrier transformation is obtained;

Described carrier is clonotype carrier or expression vector.

10. T carrier according to claim 9 is characterized in that, described carrier is prokaryotic expression carrier pQE-30a or carrier for expression of eukaryon PYD-1.

Images