CN108998428A

CN108998428A - Paris polyphylla cholesterine C22 hydroxylase and its encoding gene and application

Info

Publication number: CN108998428A
Application number: CN201810900161.4A
Authority: CN
Inventors: 张夏楠; 尹艳; 高琳惠; 高伟
Original assignee: Capital Medical University
Current assignee: Capital Medical University
Priority date: 2018-08-09
Filing date: 2018-08-09
Publication date: 2018-12-14
Anticipated expiration: 2038-08-09
Also published as: CN108998428B

Abstract

The present invention relates to a kind of paris polyphylla cholesterine C22 hydroxylase and its encoding gene, the paris polyphylla cholesterine C22 hydroxylase can make cholesteric C22 to be hydroxylated, and then synthesize the Dioscin class compound of paris polyphylla.The invention further relates to the utilization of cholesterine C22 hydroxylase and encoding gene in plant breeding and biosynthesis.

Description

Paris polyphylla cholesterine C22 hydroxylase and its encoding gene and application

Technical field

The present invention relates to a kind of paris polyphylla cholesterine C22 hydroxylase and its encoding gene and paris polyphylla cholesterine C22 hydroxyls Change the utilization of enzyme and encoding gene in plant breeding and biosynthesis, belongs to medicinal ingredient synthetic biology field.

It is cloned for the first time by polymerase chain reaction and has obtained paris polyphylla (Paris polyphylla Smith Var.yunnanensis (Franch.) Hara) in cholesterine C22 '-hydroxylase gene (PpCYP90B27) cDNA full length sequence, Then synthetic biology means are utilized, Yeast engineering bacteria is constructed, 22 (R)-hydroxycholesterol oxycholesterols are produced in yeast.

Background technique

Paris polyphylla (Paris polyphylla Smith var.yunnanensis (Franch.) Hara) is that China is famous One of medicinal plant, main active is the Paris polyphylla steroid saponin (account for about compound numbers 80%) extracted in rhizome, Research shows that it is with strong pharmacological activity, using its rhizome as Chinese patent drug Yunnan Baiyao, Gong Xue Ning, heat made of primary raw material Malicious clear etc., being clinically used for treatment functional uterine bleeding, neurodermatitis, surgery inflammation and tumour etc. has significant treat Effect has high economic value and market prospects.However since paris polyphylla seed has " secondary dormancy " physiological property, breeding potential Low, the natural speed of growth of rhizome is also that medicinal commodity generally require 10-15 from seed development very slowly, serious to restrict Paris polyphylla yield, market has openings is larger, and the source of goods is in short supply, and supply falls short of demand, rapid rise of price.Therefore, improve paris polyphylla plant resources, By scientific method find can efficient accumulation or produce Paris polyphylla steroid saponin approach be the current urgent problem of Paris polyphylla. Chonglou saponin belongs to steroid saponin, and aglycon is mainly different spirostane alcohols (isospirostanols, C₂₅For R configuration) Diosgenin (diosgenin) and pennogenin (pennogenin) (based on diosgenin).Cholesterine It (cholesterol) is an important as precursors in diosgenin (diosgenin) biosynthesis pathway.Cholesterine side chain warp The intermediate cyclisation for crossing the generation of the series reactions such as the hydroxylating of C-22 is hemiketal, then generates the Spiroketals of diosgenin Structure.The monooxygenase of CYP90B27 gene coding is to be responsible for first step hydroxylation in cholesterine downstream in steroid saponin approach P450 enzyme gene.Therefore the activity of CYP90B27 can directly affect the biosynthesis of Dioscin.Paris polyphylla cholesterine C22 hydroxyl Change the clone of enzyme gene (PpCYP90B27) gene, it is important to be provided using Fermentation Engineering mass production active constituent chonglou saponin Basis.Before the present invention comes forth, there has been no any disclosure or paris polyphylla cholesterine C22 mentioned in the present invention was reported '-hydroxylase gene and its amino acid sequence.

Summary of the invention

One aspect of the present invention provides a kind of isolated albumen, i.e. cholesterine C22 hydroxylase, and the albumen participates in steroidal soap The biosynthesis of glycosides compound especially participates in the biosynthesis of Dioscin class compound, such as converts 22- for cholesterine Hydroxycholesterol oxycholesterol.

Hydroxylase of the present invention is a kind of participation paris polyphylla steroid saponin compound synthesis, especially 22- hydroxyl gallbladder The key enzyme of sterol synthesis, the enzyme have following amino acid sequence:

(1) amino acid sequence shown in SEQ ID NO:2；

(2) amino acid sequence shown in SEQ ID NO:2 is substituted, lacks or increases one or more amino acid and function Identical albumen.

In the present invention, the isolated albumen, i.e. cholesterine C22 hydroxylase refer to: having to be hydroxylated cholesterine C22 and live Property enzyme, sequence further includes the SEQ with natural cholesterine hydroxylase identical function as shown in SEQ ID NO:2 certainly The variant form of ID NO:2 sequence.These variant forms include but is not limited to: (usually 1-50 is a, preferably 1- for several 30, more preferably 1-20, most preferably 1-10) missing, insertion and/or the substitution of amino acid, and at C-terminal and/or the end N One or several (usually 20 within, be more preferably within 5 within the preferably 10) amino acid of end addition.For example, In the art, when being substituted with similar nature or similar amino acid, the function of albumen is not usually changed.For another example, The function of protein will not be changed by adding one or several amino acid generally also in C-terminal and/or N-terminal.Cholesterine C22 hydroxylation Enzyme further includes its active fragment and reactive derivative.

Cholesterine C22 hydroxylation enzyme variants or the polypeptide with substantially similar sequence identity are characterized by having one A or multiple amino acid substitutions, missing or insertion.These changes are preferably smaller in nature, i.e. conserved amino acid substitution (is shown in Table 1) folding or active other substitutions of enzyme and are not significantly affected；Small missing, typically one to about 30 amino acid lack It loses；Amino or c-terminus extend, such as aminoterminal methionine residues, the small joint peptide of no more than about 20-25 residue or Affinity tag.Present invention accordingly provides comprising with SEQ ID NO:2 at least 70%, preferably at least have 90%, be more preferable 95%, 96%, the polypeptide of 97%, 98%, 99% or more consistent sequence.

1 conserved amino acid of table substitution

It can determine comprising for maintaining the region of structural intergrity key or the amino acid residue in domain.In that region More or less tolerance changes and keeps the specific residue of the entire tertiary structure of molecule.The method of analytical sequence structure includes, but It is not limited to the comparison with multiple sequences of homoamino acid or nucleotide identity, secondary structure tendency (propensity), two Grade member figure (binary patterns), complementary accumulation (complementary packing) and hidden polar interaction (Barton,Current Opin.Struct.Biol.5:372-376,1995；With Cordes etc., Current Opin.Struct.Biol.6:3-10,1996).It generally, will be in determination when designing molecular modification or identification specific fragment The activity of the molecule of evaluation modification while structure.

It is necessary to biological activity at least to destroy that amino acid sequence change can be carried out in cholesterine C22 hydroxylase Higher structure.For example, when cholesterine C22 hydroxylase includes one or more spirals, will change amino acid residue so as not to The geometry and conformational change therein for destroying spiral will make some key functions (such as combination of molecule partner in connection) The other molecular chaperones weakened.The effect that amino acid sequence changes can carry out pre- for example, by computer simulation disclosed above It surveys, or be measured by crystal structure analysis (see such as Lapthorn etc., Nat.Struct.Biol.2:266-268, 1995).Other technologies well known in the art are compared the folding for changing albumen and standard molecule (such as native protein), example Such as, the cysteine distribution situation in variant and standard molecule can be compared.Mass spectrum and using reduction and alkylated chemistry repair Decorations for the cysteine residues of relevant or not formed to disulfide bond these keys of measurement provide method (Bean etc., Anal.Biochem.201:216-266,1992；Gray, Protein Sci.2:1732-1748,1993；And Patterson Deng Anal.Chem.66:3727-3732,1994).If it is different to be generally acknowledged that the molecule of modification and standard molecule have Cysteine distribution situation is then folded and is affected.Another received well-known process for being used to measure this point is two color of garden It composes (CD).Measuring and compare the CD spectrum that decorating molecule and standard molecule generate is conventional (Johnson, Proteins 7:205- 214,1990).Crystallography is that another analysis folds and the well-known process of structure, nuclear magnetic resonance (NMR) digest peptide mapping and table Position mapping is also known method (Schaanan etc., Science of the structural similarity between analysis folding and proteins and peptides 257:961-964,1992)。

In the present invention, the variant forms of cholesterine C22 hydroxylase include: homologous sequence, conservative variant, equipotential change Allosome, induced mutants, can hybridize under high or low high stringency conditions natural mutation with triterpenoids synthase gene The encoded albumen of DNA.

Coding isolated albumen (cholesteric of the present invention of the present invention is encoded another aspect provides a kind of Alcohol C22 hydroxylase) gene, i.e., paris polyphylla cholesterine C22 '-hydroxylase gene (Paris polyphylla CYP90B27, PpCYP90B27): the gene, it is one of following nucleotide sequences:

(1) nucleic acid molecule shown in SEQ ID NO:1；Or

(2) nucleic acid molecule shown in SEQ ID NO:1 the is substituted, lacks or increases one or more nucleotide and table Up to the nucleotide sequence of identical function albumen, or；

(3) nucleotide sequence hybridized under high stringency conditions with nucleic acid molecule shown in SEQ ID NO:1, the rigorous item Part are as follows: hybridize in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1% SDS.

Cholesterine C22 hydroxylase encoding gene of the present invention refers to: the nucleotides sequence of coding cholesterine C22 hydroxylase Column, such as SEQ ID NO:1 nucleotide sequence and its degenerate sequence.The degenerate sequence refers to the volume positioned at SEQ ID NO:1 sequence In code frame nucleotide, the sequence of generation after thering are one or more codons to be encoded replaced the degenerate codon of same amino acid Column.Due to the degeneracy of codon, so the degenerate sequence with SEQ ID NO:1 nucleotide sequence homology down to about 70% Also sequence described in SEQ ID NO:2 can be encoded out.Further including can be under moderate stringency conditions, more preferably in high stringent condition The lower nucleotide sequence hybridized with SEQ ID NO:1 nucleotide sequence.Further include and SEQ ID NO:1 nucleotide sequence Homology at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% nucleotide sequence.Also wrap Including to encode has and open reading frame sequence in the SEQ ID NO:1 of the albumen of natural cholesterine C22 hydroxylase identical function The variant form of column.These variant forms include but is not limited to several (usually 1-90, preferably 1-60, more preferably Ground 1-20, most preferably 1-10) nucleotide missing, insertion and/or substitution, and it is several (logical in 5 ' and/or 3 ' end additions Often it is within 60, within preferably 30, to be more preferably within 10, be most preferably within 5) nucleotide.

" rigor " of hybridization reaction can determine readily by those of ordinary skill in the art, and generally according to probe Length, wash temperature and salinity calculate by rule of thumb.In general, the longer higher temperature of probes call to be correctly to anneal, and compared with Short probe needs lower temperature.Hybridization is often relied on when complementary strand is present in time-varying in the environment lower than its melting temperature The ability that property DNA anneals again.Probe and can expectation degree of homology between hybridization sequences it is higher, workable relative temperature Also higher.As a result, being inferred to higher relative temperature would tend to keep reaction condition more stringent, and lower temperature is also just less Strictly.About the other details of hybridization reaction rigor and explanation, referring to Ausubel et al., " Current Protocols in Molecular Biology ", Wiley Interscience Publishers, 1995.

" high stringency conditions " or " high high stringency conditions " can identify as follows as defined herein: (1) strong using low ion Degree and high temperature are washed, such as 0.015M sodium chloride/0.0015M sodium citrate/0.1% lauryl sodium sulfate, and 50 DEG C； (2) denaturant is used in hybrid process, such as formamide, such as 50% (v/v) formamide and 0.1% bovine serum albumin/ 0.1%Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer pH 6.5, sodium chloride containing 750mM, 75mM lemon Sour sodium, 42 DEG C；Or (3) are using 50% formamide, 5x SSC (0.75M NaCl, 0.075M sodium citrate), 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x DenhardtShi solution, the salmon sperm dna (50 μ g/ml) of ultrasonication, 0.1% In 42 DEG C of hybridized overnights in the solution of SDS and 10% dextran glucosides, and in 42 DEG C in 0.2x SSC (sodium chloride/lemon Sour sodium) middle washing 10 minutes, high stringency washing in 10 minutes is then carried out in 55 DEG C in the 0.1x SSC containing EDTA.

A further purpose of the present invention is to provide a kind of expression vector, the expression vector includes to encode gallbladder of the present invention The polynucleotides (or PpCYP90B27 gene or its variant) of sterol C22 hydroxylase or its variant, or can under high stringency conditions The nucleotide sequence hybridized with the polynucleotides, the expression vector also includes promoter and terminator, wherein the starting It is sub to be operably connected with the polynucleotides, and institute's polynucleotides are operably connected with the transcription terminator.

In the present invention, various carriers known in the art can be selected, such as commercially available carrier, including plasmid, clay etc..In life When producing cholesterine C22 hydroxylase of the present invention, the nucleotide sequence of cholesterine C22 '-hydroxylase gene can be operably connected to Expression regulation sequence, to form cholesterine C22 hydroxylase expression vector." the operationally downlink connection " is when finger DNA section When indicate these sections according to certain way arrangement so that they can play a role in phase for purpose expected from it, such as Starting, which is transcribed and moved ahead, in promoter reaches terminator by coding section.Also refer to such a situation: i.e. linear DNA molecule Certain parts can influence same linear DNA molecule other parts activity, for example, if signal peptide DNA is expressed simultaneously as premise The secretion of polypeptide is participated in, then signal peptide (secretion leader sequence) DNA is exactly to be operably connected to be connected to polypeptid DNA；If opened Mover control sequence transcription, then it is to be operably connected to coded sequence；If ribosome bind site, which is placed in, to be made When its position translated, then it is to be operably coupled to coded sequence.Generally, " being operably connected ", it is adjacent to mean, and Secretion leader sequence is then meaned adjacent in reading frame.In preferred situation, the expression vector is plasmid pESC- Leu。

It is a further object of the present invention to provide a kind of host cell, the host cell includes coding of the present invention The polynucleotide molecule (or PpCYP90B27 gene or its variant) of cholesterine C22 hydroxylase or its variant, or in rigorous item The nucleic acid molecule that can be hybridized with the polynucleotide molecule under part, or the expression vector comprising foregoing description of the present invention. The host cell is selected from: bacterium, prokaryotic cell (such as Escherichia coli) fungal cell, yeast cells, insect cell, lactation Zooblast or plant cell, it is preferable that be yeast cells or plant cell.

Especially interesting yeast includes saccharomyces cerevisiae, pichia pastoris yeast and Pichia methanolica.With outer Source DNA transformed saccharomyces cerevisiae cell and such as Kawassaki, United States Patent (USP) are disclosed in from the method for wherein preparation and reorganization polypeptide In US4599311, US4931373, US4870008, US5037743, US4845075 etc..Pass through table determined by selected marker Type, usually drug resistance or the growth ability when lacking specific nutrient (such as leucine) select transformed cells.For making The preferred vector system of brewer yeast such as can be pESC expression vector.Appropriate promoters and terminator for yeast include coming from Those of glycolytic gene (US4599311, US4615974 and US4977092) and alcohol dehydrogenase.For other yeast, including Multiform Hansenula anomala, newborn Kluyveromyces yeasts, Kluyveromyces fragilis, pichia pastoris yeast, Pichia The conversion system of Methanolica, Guilliermondii Pichia pastoris and Candida maltosa are also known in the art.

In the inventive solutions, the host cell preferably uses the energy cholesteric saccharomyces cerevisiae of steady production Engineering bacteria RH6829.Another aspect of the present invention is to disclose PpCYP90B27 gene described above in fermentation by saccharomyces cerevisiae Using specifically can be applied to the preparation of Fermentation Engineering synthesizing steroid saponins biosynthesis intermediate.Further, the steroid Body saponins biosynthesis intermediate is 22 (R)-hydroxycholesterol oxycholesterols.

According to conventional methods in the culture medium containing nutrient and other necessary ingredients of growth for selected host cell Middle culture conversion or transfection host cell.A variety of suitable culture mediums, including known culture medium and complicated culture medium, Be it is known in the art, generally comprise carbon source, nitrogen source, essential amino acid, vitamin and mineral.If desired, culture medium is also Ingredient as such as growth factor or serum can be contained.Growth medium is generally for example, by drug screening or lack can be by Required nutrient that expression vector carries or selected marker that cotransfection is into host cell supplement is selected containing external source addition The cell of DNA.By conventional methods, small triangular flask or fermentor jet are such as shaken, sufficient air is provided to liquid culture.

Cholesterine C22 hydroxylase polynucleotides full length sequence of the invention or its segment usually can with PCR amplification method, again Group method or artificial synthesized method obtain.For PCR amplification method, can disclosed related nucleotide sequence according to the present invention, especially It is that open reading frame sequence carrys out design primer, and with the commercially available library cDNA or presses conventional method well known by persons skilled in the art The library cDNA is prepared as template, expands and obtains related sequence.When sequence is longer, it is often necessary to which PCR expands twice or repeatedly for progress Increase, then retells the segment that each time amplifies and be stitched together by proper order.Once obtaining related sequence, so that it may use Recombination method obtains related sequence in large quantity.This is usually to be cloned into carrier, then be transferred to cell, then passes through routine side Method isolated related sequence from the host cell after proliferation.In addition, also mutant can be introduced this hair by chemical synthesis In bright protein sequence.Other than being generated with recombination method, solid phase technique is also can be used in the segment of albumen of the present invention, by directly synthesizing Peptide and produced (Stewart etc., Solid-Phase Pedtide Synthesis, J.Am.Chem.Soc.85:2149- 2154,1963).Synthetic proteins matter can carry out by hand or automatically in vitro.For example, Applied Biosystems can be used 431A type peptide synthesizer (Foster City, CA) be automatically synthesized peptide.Each of chemical synthesis albumen of the present invention can be distinguished Section, is then chemically connected to generate the molecule of overall length.

Another aspect of the present invention provides cholesterine C22 hydroxylase of the present invention or cholesterine of the present invention C22 hydroxylase encoding gene or recombinant expression carrier of the present invention or engineering bacteria of the present invention are synthesizing 22 (R)-hydroxyls Utilization in base cholesterine.After fermentation training obtained strains 2-3d, it is extracted with ethyl acetate zymophyte, is detected through GC-MS, can detect To 22 (R)-hydroxycholesterol oxycholesterols.Steroid saponin biosynthesis intermediate can be generated by biosynthesis technology using the present invention 22 (R)-hydroxycholesterol oxycholesterols, have a good application prospect.

Also one side of the invention provides cholesterine C22 hydroxylase of the present invention or coding cholesteric of the present invention Alcohol C22 '-hydroxylase gene, the utilization in the plant breeding containing steroid saponin chemical component.With cholesterine of the present invention C22 hydroxylase or its encoding gene can improve the content of steroid saponin in plant by being applied in plant cell.

For the DNA sequence dna of SEQ ID No.1 of the present invention by 1455 base compositions, last three tga are terminator codon, are compiled The protein sequence SEQ ID No.2 being made of in code sequence table 484 amino acid residues.

Detailed description of the invention

The Multiple sequence alignments that Fig. 1 is PpCYP90B27 and correlation function aminopeptidase gene sour water is flat are analyzed. The amino acid sequence of ArCYP71D443, AtCYP90B1, StCYP72A188, SlCYP90B3 and SlCYP724B2 come from California Chenopodiaceae Reed Veratrum californicum (AJT59559.1), carpet bugle Ajuga reptans (BAS30379.1), arabidopsis Arabidopsis thaliana (O64989.2), potato Solanum tuberosum (BAV14872.1), tomato Solanum lycopersicum (BAF41219.1 and BAF41218.1).Multiple sequence alignments are carried out using DNAMEN 8.0, Cytochrome P450 cysteine heme iron ligand label is indicated with underscore.

Fig. 2 is PpCYP90B27 systematic evolution tree.The analysis is related to amino acid sequence respectively from monocotyledon California Black false hellebore Veratrum californicum (AJT59559.1), Japan japonica rice Oryza sativa Japonica Group (Q5CCK3.1), corn Zea mays (ABS30431.1) and dicotyledon Wild soybean Glycine soja (KHN36124.1), pigeonpea Cajanus cajan (KYP66752.1), M. truncatula Medicago truncatula (AET03943.2), upland cotton Gossypium hirsutum (ABJ90340.1), diversiform-leaved poplar Populus euphratica (AER08630.1), Echinacea Echinacea purpurea (AIH07328.1) and arabidopsis Arabidopsis thaliana (O64989.2).Evolutionary analysis is carried out in MEGA6 using Neighbor-Joining method, is displayed next to associated class in branch The percentage (1000 repetitions) for the repetition tree that group flocks together in bootstrapping test.

Fig. 3 is PpCYP90B27 recombination yeast and unloaded control fermentation product GC chromatogram, is sequentially followed successively by from top to bottom PpCYP90B27 recombination yeast, pESC-his blank control, 22 (R)-cholesterine reference substances, 22 (S)-cholesterine reference substances, gallbladder Sterol reference substance.

Specific embodiment

Various aspects and features of the invention, the skill of this field are illustrated below by way of preferred embodiment and in conjunction with attached drawing Art personnel are not intended to limit the scope of the invention it should be understood that these embodiments are only intended to illustrate.Without departing substantially from claim Under conditions of book range, those skilled in the art can carry out various modifications and improve to various aspects of the present invention, these Modification and improvement also belong to protection scope of the present invention.For example, institute's Practical Expression carrier and host strain in embodiment are replaced with Other expression vectors commonly used in the art and host strain are that those skilled in the art can understand and realize.

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

1 paris polyphylla Total RNAs extraction of embodiment, purifying

Paris polyphylla root total serum IgE is extracted using Trizol method.Utilize RNA purification kit (the limited public affairs of Tiangeng biochemical technology Department), mentioned RNA is purified.

The clone of 2 paris polyphylla cholesterine C22 '-hydroxylase gene of embodiment

1. design of primers

It is screened to obtain full length gene sequence fragment according to paris polyphylla transcript profile data notes, design upstream and downstream clone draws Object, primer sequence are as follows:

P1:5 ' ATGGCGTTGGAGCTGATCCTGGTTCT 3 ' (SEQ ID NO:3)

P2:5 ' ACAGACCACATACCATACCAGCCTC 3 ' (SEQ ID NO:4)

2.PCR amplification

Using QuantScript RT Kit (Tiangeng biochemical technology Co., Ltd) by 1 gained RNA reverse transcription of embodiment at cDNA。

Using cDNA as template, PCR amplification is carried out.

Amplification system are as follows: 2 × KAPA HiFi Hotstart ReadyMix 25 μ L, each 1.5 μ L of primer P1 and P2, template 2 μ L, distilled water supply 50 μ L.Reaction condition: 98 DEG C of initial denaturations 3min, 98 DEG C of 20s, 62 DEG C of annealing 15s, 72 DEG C extend 1.5min, 72 DEG C of extensions 5min after 35 circulations, 4 DEG C save.

Sequencing result shows the sequence of pcr amplification product as shown in SEQ ID No.1, by unnamed gene shown in sequence 1 For PpCYP90B27, the protein of this 485 amino acid of DNA sequence encoding composition, which is named as PpCYP90B27, the egg White amino acid sequence is SEQ ID No.2.

The bioinformatic analysis of 3 PpCYP90B27 gene of embodiment

The open reading frame cDNA sequence of paris polyphylla cholesterine C22 '-hydroxylase gene PpCYP90B27 of the present invention is long 1455bp, encodes amino acid 484aa, molecular weight (MW) 54894.74Da, theoretical isoelectric point pI 8.36, and detailed sequence is respectively SEQ ID NO.1 and SEQ ID NO:2 in sequence table.ScanProsite tool scanning result shows the egg of gene coding Bai Xulie has Cytochrome P450 cysteine heme iron ligand-marker in the position of 422-431aa (FSGGPRLCPG), InterproScan analyzes the sequence and belongs to Cytochrome P450 E family I group, has redox enzyme activity Property.Construct the systematic evolution tree (adjacent method) of C22 hydroxylases of known steroid compound, the results showed that, paris polyphylla PpCYP90B27 (Paris polyphylla) and the C22 hydroxylase (Veratrum for belonging to Liliaceae veratrum californicum Californicum affiliation) is nearest.Such as Fig. 1 and Fig. 2.Wherein Fig. 1 is PpCYP90B27 and correlation function aminopeptidase gene The flat Multiple sequence alignments of sour water；Fig. 2 is PpCYP90B27 systematic evolution tree (adjacent method).

The building of 4 PpCYP90B27 gene yeast expression vector of embodiment

1. design of primers

Using PpCYP90B27cDNA as template, specific forward primer P3 and downstream primer P4 is designed, it is anti-to carry out PCR amplification It answers, dashed part is carrier pESC-Leu (being purchased from Agilent Technologies) homology arm in primer, and primer sequence is as follows:

P3:5 '-TCACTAAAGGGCGGCCGCATGGCGTTGGAGCTGATCCT-3’(SEQ ID NO:5)

P4:5 '-ATCCTTGTAATCCATCGATACTAGTTCAGGCTTCTGACTTCTCGAGGGGAC-3’(SEQ ID NO:6)

2.PCR amplification

PCR reaction system are as follows: 2 × KAPA HiFi Hotstart ReadyMix 25 μ L, each 1.5 μ L of primer P3 and P4, 2 μ L of template, distilled water supply 50 μ L.

PCR reaction condition: 98 DEG C of initial denaturations 3min, 98 DEG C of 20s, 70 DEG C of annealing 15s, 72 DEG C of extension 1min, 35 recycle 72 DEG C of extension 5min afterwards, 4 DEG C of preservations.

3. carrier double digestion

Using restriction enzyme Not I and Spe I at 37 DEG C digestion pECS-Leu carrier 1 hour.

4. carrier connects

After amplified production and linearization plasmid carry out agarose gel electrophoresis respectively, returned using DNA gel QIAquick Gel Extraction Kit It receives.2 × EasyGeno is added with the molal weight ratio mixing of 1:2 in linearized vector and target fragment glue recovery product 50 DEG C of connection 20min of Assembly Mix convert Escherichia coli Trans5 α Competent cell, are containing ampicillin LB plate on screen recon.The recombinant plasmid of the clone containing PpCYP90B27 is identified through PCR and sequencing analysis, and saving has just The recombinant plasmid pESC-PpCYP90B27 of true target sequence is named as pESC- for expressing conversion, the prokaryotic expression carrier PpCYP90B27。

Enzyme functional verification in 4 recombinant Saccharomyces cerevisiae of embodiment

1. recombinant Saccharomyces cerevisiae culture

Target plasmid pESC-PpCYP90B27 passes through electroporated saccharomyces cerevisiae engineered yeast RH6829 competence, SC-Trp- His-Leu defect culture medium (containing 2% glucose, be purchased from the general Jino Science and Technology Ltd. in Beijing) screening positive strain (RH6829- Pp CYP90B27).Positive colony (RH6829-Pp CYP90B27) is inoculated in SC-Trp-His-Leu defect culture medium (to contain 2% glucose) in, 30 DEG C, 230rpm shaken cultivation to OD600 0.8-1.0.4000_×Thalline were collected by centrifugation by g, is floated with sterile water After washing twice, it is resuspended with YPL (1% yeast extract, 2% peptone, 2% galactolipin), 30 DEG C of induction fermentation 48h.

Empty carrier plasmid pESC-Leu is converted according to the method described above to saccharomyces cerevisiae engineered yeast RH6829 competent cell, together Fermented and cultured under batten part, as control.

2. tunning extracts

Fermentation liquid 10000_×G is centrifuged 1min, collects thallus, and ethyl acetate 10mL is added, and ultrasonic extraction 2h is repeated twice. Combined extract, N₂Solvent is dried up, 200 μ L BSTFA and 100 μ L pyridines are added, is vortexed and redissolves, 80 DEG C of derivatization 1h.N₂Drying Derivatization reagent, 500 μ L CHCl₃It redissolves, crosses 0.22 μm of PTFE pin hole filter membrane.

3. tunning detects

1 μ L extracting solution is taken to detect into GC-MS, with cholesterine, 22 (S)-hydroxycholesterol oxycholesterols and 22 (R)-hydroxycholesterol oxycholesterols are Standard items.GC condition are as follows: 180 DEG C of 1min are warming up to 280 DEG C with 20 DEG C/min, and 2 DEG C/min is warming up to 300 DEG C, keep 2 DEG C/ min.Carrier gas is helium, flow velocity 1.0mL/min.Mass spectrum uses the fractional scanning of MRM mode, and 8min starts with 15eV collision energy The prime ion that m/z is 329.1 is bombarded, product ion 121.1 and 95.1 is scanned, 10.7min starts with the bombardment of 5eV collision energy The prime ion that m/z is 173.0, scans product ion 83.1 and 73.0, and scanning residence time is 150ms.As a result, it has been found that cholesteric Alcohol retention time is 10.2min, 22 (S)-hydroxycholesterol oxycholesterols and 22 (R)-hydroxycholesterol oxycholesterol retention times about in 11.2min, In 22 (S)-hydroxycholesterol oxycholesterols retention time compared with 22 (R)-hydroxycholesterol oxycholesterols about 0.15min in advance.Such as Fig. 3.Fig. 3 is PpCYP90B27 recombination yeast and unloaded control fermentation product GC chromatogram.Recombination yeast fermentation product samples detect cholesterine With 22 (R)-hydroxycholesterol oxycholesterol characteristic peaks, and cholesterine is only detected in empty vector control sample, do not detect 22 (R)-hydroxyls Ji Danzaichunfeng, therefore assert the activity that there is PpCYP90B27 catalysis cholesterine to synthesize 22 (R)-hydroxycholesterol oxycholesterols.

Above description is not limitation of the present invention, and the present invention is also not limited to the example above.The art it is common Within the essential scope of the present invention, the variations, modifications, additions or substitutions made also should belong to protection of the invention to technical staff Range, protection scope of the present invention are subject to claims.

Sequence table

<110>Capital University of Medical Sciences

<120>paris polyphylla cholesterine C22 hydroxylase and its encoding gene and application

<130>in background document

<141> 2018-08-08

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1455

<212> DNA

<213>artificial sequence ()

<400> 1

atggcgttgg agctgatcct ggttctgtct tccttgatcg tcatcctcat catcttcttc 60

agcttcaaga gtaatgggaa gagtgagaac aaattggcca agctcccacc gggccaaatg 120

ggctggccct tcatcggcca aaccatcccc ttcatgcagc cacactcctc cgcctccctc 180

ggcctcttca tggaccaaaa catagccaag tatgggagga tcttccggac taacttgctg 240

gcgaagccga ccatcgtgtc agcggacccg gacttcaacc ggtacatcct gcagaacgag 300

gggcggctgt tcgagaacag ctgccccacg agcatcaagg agatcatggg gccgtggtcg 360

atgctcgccc tcgcgggcga catccaccgc gagatgcgat ccatcgcggt gaatttcatg 420

agcaacgtca agctccgaac ctacttcctc cctgacatcg agcagcaggc cataaaggtc 480

ctcgccagtt gggagaacac ccccgaggcc ttctcggccc aagaacaagg gaagaagttt 540

gcgttcaatc tgatggtgaa gcatctgatg agcatggatc ccgggatgcc ggagactgag 600

aaactgcgga cggagtacca cgcattcatg aagggaatgg cttcaattcc tttgaatttg 660

cccggaacgg cttatagaaa ggccttgcag tcgaggtcaa taattttgaa gatcatgggg 720

caaaagctag acgaaagaat tcggcaggta cgtgacgggt gcgagggatt ggagcaggat 780

gatctcctcg cgtccgtctc caagcaccca cacctcacaa aggagcagat tctcgatctc 840

atactcagca tgctcttcgc cggtcacgag acttcctcgg ctgccatcgc cctagctatc 900

tattttctcg attcgtgccc taaagccgcc caacaattga gggaggagca cgtggagatc 960

gcgcgacaaa aggctgagcg aggcgagacg ggactcaatt gggacgacta caagcaaatg 1020

gagttcaccc attgtgtcat aaatgaaacc ctaaggctcg gaaacattgt caagttcttg 1080

cataggaaaa ctcttaaaga tgtccaattc aaagggtatg acattccatg tgggtgggag 1140

gtggtgacga tcatctcagc cgctcatttg gatccgtccg tgtatgatga acctcagcgt 1200

tacaatccat ggagatggca gaatatctcg gcgactgcat caaagaacaa cagcataatg 1260

tcgttcagtg gcggccctcg cttgtgccct ggtgctgagc tggcgaagct ggagatggca 1320

gtttttctgc accatctcgt ccgaaagttc cactgggagc tggcagagca tgactacccc 1380

gtatctttcc ccttcctcgg attccccaag ggcctgccaa tcaaggttcg tcccctcgag 1440

aagtcagaag cctga 1455

<210> 2

<211> 484

<212> PRT

<213>artificial sequence ()

<400> 2

Met Ala Leu Glu Leu Ile Leu Val Leu Ser Ser Leu Ile Val Ile Leu

1 5 10 15

Ile Ile Phe Phe Ser Phe Lys Ser Asn Gly Lys Ser Glu Asn Lys Leu

20 25 30

Ala Lys Leu Pro Pro Gly Gln Met Gly Trp Pro Phe Ile Gly Gln Thr

35 40 45

Ile Pro Phe Met Gln Pro His Ser Ser Ala Ser Leu Gly Leu Phe Met

50 55 60

Asp Gln Asn Ile Ala Lys Tyr Gly Arg Ile Phe Arg Thr Asn Leu Leu

65 70 75 80

Ala Lys Pro Thr Ile Val Ser Ala Asp Pro Asp Phe Asn Arg Tyr Ile

85 90 95

Leu Gln Asn Glu Gly Arg Leu Phe Glu Asn Ser Cys Pro Thr Ser Ile

100 105 110

Lys Glu Ile Met Gly Pro Trp Ser Met Leu Ala Leu Ala Gly Asp Ile

115 120 125

His Arg Glu Met Arg Ser Ile Ala Val Asn Phe Met Ser Asn Val Lys

130 135 140

Leu Arg Thr Tyr Phe Leu Pro Asp Ile Glu Gln Gln Ala Ile Lys Val

145 150 155 160

Leu Ala Ser Trp Glu Asn Thr Pro Glu Ala Phe Ser Ala Gln Glu Gln

165 170 175

Gly Lys Lys Phe Ala Phe Asn Leu Met Val Lys His Leu Met Ser Met

180 185 190

Asp Pro Gly Met Pro Glu Thr Glu Lys Leu Arg Thr Glu Tyr His Ala

195 200 205

Phe Met Lys Gly Met Ala Ser Ile Pro Leu Asn Leu Pro Gly Thr Ala

210 215 220

Tyr Arg Lys Ala Leu Gln Ser Arg Ser Ile Ile Leu Lys Ile Met Gly

225 230 235 240

Gln Lys Leu Asp Glu Arg Ile Arg Gln Val Arg Asp Gly Cys Glu Gly

245 250 255

Leu Glu Gln Asp Asp Leu Leu Ala Ser Val Ser Lys His Pro His Leu

260 265 270

Thr Lys Glu Gln Ile Leu Asp Leu Ile Leu Ser Met Leu Phe Ala Gly

275 280 285

His Glu Thr Ser Ser Ala Ala Ile Ala Leu Ala Ile Tyr Phe Leu Asp

290 295 300

Ser Cys Pro Lys Ala Ala Gln Gln Leu Arg Glu Glu His Val Glu Ile

305 310 315 320

Ala Arg Gln Lys Ala Glu Arg Gly Glu Thr Gly Leu Asn Trp Asp Asp

325 330 335

Tyr Lys Gln Met Glu Phe Thr His Cys Val Ile Asn Glu Thr Leu Arg

340 345 350

Leu Gly Asn Ile Val Lys Phe Leu His Arg Lys Thr Leu Lys Asp Val

355 360 365

Gln Phe Lys Gly Tyr Asp Ile Pro Cys Gly Trp Glu Val Val Thr Ile

370 375 380

Ile Ser Ala Ala His Leu Asp Pro Ser Val Tyr Asp Glu Pro Gln Arg

385 390 395 400

Tyr Asn Pro Trp Arg Trp Gln Asn Ile Ser Ala Thr Ala Ser Lys Asn

405 410 415

Asn Ser Ile Met Ser Phe Ser Gly Gly Pro Arg Leu Cys Pro Gly Ala

420 425 430

Glu Leu Ala Lys Leu Glu Met Ala Val Phe Leu His His Leu Val Arg

435 440 445

Lys Phe His Trp Glu Leu Ala Glu His Asp Tyr Pro Val Ser Phe Pro

450 455 460

Phe Leu Gly Phe Pro Lys Gly Leu Pro Ile Lys Val Arg Pro Leu Glu

465 470 475 480

Lys Ser Glu Ala

<210> 3

<211> 26

<212> DNA

<213>artificial sequence ()

<400> 3

atggcgttgg agctgatcct ggttct 26

<210> 4

<211> 25

<212> DNA

<213>artificial sequence ()

<400> 4

acagaccaca taccatacca gcctc 25

<210> 5

<211> 38

<212> DNA

<213>artificial sequence ()

<400> 5

tcactaaagg gcggccgcat ggcgttggag ctgatcct 38

<210> 6

<211> 51

<212> DNA

<213>artificial sequence ()

<400> 6

atccttgtaa tccatcgata ctagttcagg cttctgactt ctcgagggga c 51

Claims

1. isolated albumen, the albumen are

(1) amino acid sequence shown in SEQ ID NO:2；Or

(2) amino acid sequence shown in SEQ ID NO:2 is substituted, lacks or increases one or more amino acid and function is identical Peptide.

2. encoding the polynucleotides of albumen described in claim 1.

3. polynucleotides according to claim 2, the polynucleotides are at least one of following:

(1) nucleic acid molecule shown in SEQ ID NO:1；Or

(2) nucleic acid molecule shown in SEQ ID NO:1 is substituted, lacks or increases one or more nucleotide and expression is identical The nucleotide sequence of functional protein；Or

(3) nucleotide sequence hybridized under high stringency conditions with nucleic acid molecule shown in SEQ ID NO:1, the high stringency conditions Are as follows: hybridize in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1% SDS.

4. expression vector, it includes polynucleotides shown in promoter, Claims 2 or 3 and transcription terminators, wherein the starting It is sub to be operably connected with the polynucleotides, and institute's polynucleotides are operably connected with the transcription terminator.

5. recombinant host cell, it includes express to carry described in polynucleotide molecule described in Claims 2 or 3 or claim 4 Body, the cell are selected from: bacterium, yeast cells, fungal cell, insect cell, mammalian cell and plant cell.

6. cell described in claim 5, wherein the plant cell is Paris polyphylla plant cell.

It is carried 7. being expressed described in polynucleotide molecule described in albumen or Claims 2 or 3 described in claim 1 or claim 4 Recombinant host cell described in body or claim 5 is adjusting and is producing the utilization in plant steroid saponins compound.

8. utilization as claimed in claim 7, wherein the steroid saponin compound is Dioscin class compound.

9. utilization according to claim 8, wherein the Dioscin class compound is cholesterine.

10. albumen as claimed in claim 1 or 2 or the polynucleotide molecule of claim 3 or 4 are in Paris polyphylla plant breeding With.