CN108998400A

CN108998400A - Bioengineered strain and its preparation method and application for restoring dimercurion

Info

Publication number: CN108998400A
Application number: CN201810732716.9A
Authority: CN
Inventors: 王丹; 陈阳清; 韦娜; 金楠皓; 郑亚楠; 庞婷; 刘婷; 梁乐桂
Original assignee: Guangxi Teachers College
Current assignee: Shenzhen Zhihui Huasheng Technology Co ltd
Priority date: 2018-07-05
Filing date: 2018-07-05
Publication date: 2018-12-14
Anticipated expiration: 2038-07-05
Also published as: CN108998400B

Abstract

The invention discloses a kind of for restoring the bioengineered strain of dimercurion, and the bioengineered strain contains expression vector, which is merR op-ompA-merA-pSB1A2 comprising recombination merR op-ompA-merA and pSB1A2 plasmid backbone.The invention also discloses a kind of for restoring the preparation method and purposes of the bioengineered strain of dimercurion.Improvement Hg (II) in water environment that can be used for provided by the present invention for restoring the bioengineered strain of dimercurion is polluted.Bioengineered strain investment is had in the water environment of Hg (II) pollution, Hg (II) is reduced to Hg (0), realizes the improvement of water environment.Bioengineered strain of the invention has the advantages that ecological, environmental protective, selectively good, high sensitivity, low in cost, reusable for administering Hg in water environment (II) pollution.

Description

Bioengineered strain and its preparation method and application for restoring dimercurion

Technical field

It is specifically a kind of for restoring the bioengineered strain of dimercurion the present invention relates to technical field of water pollution treatment And its preparation method and application.

Background technique

With being widely used for mercury, some mercury is discharged into environment with exhaust gas, waste water, waste residue, to the mankind Production and living and the ecosystem generate serious pollution, or even endanger the life and health of the mankind.

The bio-toxicity of mercury is mainly caused by inorganic mercury and organomercurial compound.And injury of the organomercurial compound to human body Much larger than inorganic mercury, but the inorganic mercury ion in water pollution system is the form that is primarily present of mercury pollution at present, and can be with Organic mercury is converted under the action of microorganism.Therefore, realize that the improvement of inorganic mercury ion in water pollution system is even more important.

Pan Peiling, Luo Weihong etc. precipitate-adsorb the research of Hg (II) in synthesis removal waste water, on the south them The common house refuse pomelo peel of square people is raw material, and uses ZnCl₂Pre-treatment is carried out to pomelo peel, so that pomelo peel be made to become Property, then with the pomelo peel of denaturation to by Na₂Hg (II) in the S precipitation method treated waste water is adsorbed.Experimental exploring It is out 9 in pH, vulcanized sodium additional amount is 0.36g/mL, and flocculant FeSO is added₄Under conditions of, the removal rate of mercury ions in waste water It can achieve 96% or more.

The factory in China is widely implemented the prevailing technology of flue gas desulfurization, can generate the waste water containing metal mercury ions, Guo Quick brightness et al. has been probed into using chelating agent dithiocar-bamate (DTCR) in simulated wastewater and carbide slag desulfurization wastewater Hg (II) handled.Probe into what DTCR removed mercury ions in waste water by DTCR dosage and pH the two factors It influences, discovery DTCR is very high on the removal rate of mercury ion and pH influences less the removal rate of Hg (II).

One people of Zhu et al. select waste yeast bacterium used in brewing industry to adsorb the mercury ion in waste water, they are from suction Attached time, solution ph, brewer's yeast bacterium amount, the initial mass concentration of Hg (II) and temperature etc. are because usually probing into biological adsorption pair The effect that mercury ion removes in water phase, obtains saccharomyces cerevisiae to the optimal adsorption condition of Hg (II), in pH=3, adsorption time When for 15min, Hg (II) solution that mass concentration is 2.6g/L is adsorbed, removal rate may be up to 96%.

Although the method for processing mercury-containing waste water is varied at present, including the precipitation method, chemical method, absorption method etc., but still deposits It can not ignore in some disadvantages.If the precipitation method are easy to produce secondary pollution, easily cause water quality hardening, it is not thorough to mercury-containing waste water processing Bottom.Although absorption method has, the secondary pollution reusing, is numerous in variety, generating is small, it is new to bring into sewage treatment The advantages of pollutant, but adsorbent is easily saturated, processing cost is high, and poor specificity, sensitivity are low, are removing mercury ion While adsorb the metal ion beneficial to human body, destroy the ionic equilibrium of water environment.

Biosorption process provides new approach for the improvement of heavy metal ion mercury pollution, and the method passes through microbial cell Surface display technologies will adsorb the albumen of heavy metal ion mercury in bacterium surface displaying, to realize the Gao Ling to mercury ion Quick and high-selectivity adsorption.But for the bacterium of biological adsorption when adsorbance reaches saturation, will lose further is reduced The ability of mercury pollution.

With the fast development of Protocols in Molecular Biology, efficient identification is constructed with technique for gene engineering and administers mercury pollution Genetically modified microorganism be possibly realized, the improvement for mercury pollution in water environment provides strong tool.Therefore, it needs to develop Ecological, environmental protective, selectivity good, high sensitivity, low in cost, reusable mercuric pollution treatment technology.

Summary of the invention

It is an object of the invention to solve at least the above problems, and provide the advantages of at least will be described later.

It is a still further object of the present invention to provide a kind of for restoring the bioengineered strain of dimercurion.

It is a still further object of the present invention to provide a kind of for restoring the preparation method of the bioengineered strain of dimercurion.

It is a still further object of the present invention to provide a kind of for restoring the purposes of the bioengineered strain of dimercurion, has Ecological, environmental protective, selectivity good, high sensitivity, low in cost, reusable advantage.

In order to realize these purposes and other advantages according to the present invention, provide a kind of for restoring dimercurion Bioengineered strain, the bioengineered strain contain expression vector, which is merR op-ompA-merA-pSB1A2, Including recombination merR op-ompA-merA and pSB1A2 plasmid backbone.

It provides a kind of for restoring the preparation method of the bioengineered strain of dimercurion, comprising the following steps:

Step 1: realizing the amplification of merR op, ompA, merA genetic fragment respectively using pcr amplification reaction, will expand MerR op genetic fragment afterwards is connected with ompA genetic fragment by overlap extension pcr, and passes through pcr amplification reaction reality It now expands, obtains target gene fragment merR op-ompA；

Step 2: using restriction enzyme XbaI and SpeI to pSB1A2 plasmid backbone and target gene fragment merR Op-ompA carries out double digestion, makes target gene fragment merR op-ompA and pSB1A2 plasmid backbone while exposing identical viscous Property end, target gene fragment merR op-ompA is connected with pSB1A2 plasmid backbone by T4DNA ligase, realize merR The building of op-ompA-pSB1A2 plasmid；

Step 3: using restriction enzyme SpeI to the merA base after merR op-ompA-pSB1A2 plasmid and amplification Because segment carries out single endonuclease digestion, then the merA gene with T4DNA ligase by merR op-ompA-pSB1A2 plasmid and after expanding Segment connection, completes the building of expression vector merR op-ompA-merA-pSB1A2；

Step 4: expression vector merR op-ompA-merA-pSB1A2 converted by chemical transformation thin to competence It is intracellular, obtain the bioengineered strain.

Preferably, the target gene fragment merR op-ompA in step 1 is obtained especially by following methods: respectively Using fully synthetic merR op, ompA, merA gene order as template, first time pcr amplification reaction is carried out, then will be after amplification The complementary fragment of merR op and ompA genetic fragment end realizes the company of merR op and ompA by overlap extension pcr It connects, obtains junction fragment merR op-ompA, carry out second of pcr amplification reaction, realize junction fragment merR op-ompA's Amplification, obtains target gene fragment merR op-ompA.

Preferably, the competent cell in step 4 is E.coli DH5 α competent cell.

Preferably, when first time pcr amplification reaction, it includes ImeR-OP XF, OP- that merR op, which needs the primer being added, OmpA UP, it includes OP-ompA DN, OmpA SR that ompA, which needs the primer being added, and it includes MerA that merA, which needs the primer being added, SF,MerA SR；The primer that second of pcr amplification reaction is added includes IMerR-OP XF and OmpA SR.

Preferably, reaction temperature when carrying out double digestion in step 2 is 37 DEG C, reaction time 1h.

Preferably, reaction temperature when carrying out single endonuclease digestion in step 3 is 37 DEG C, reaction time 1h.

Preferably, first time pcr amplification reaction includes 30 circulations, wherein a circulation successively includes 98 DEG C of denaturation 10s, 55 DEG C of annealing 10s, 72 DEG C of extension 5s；Second of pcr amplification reaction includes 30 circulations, wherein a circulation is successively wrapped Include 98 DEG C of denaturation 10s, 55 DEG C of annealing 10s, 72 DEG C of extension 10s.

There is provided it is a kind of for restoring the purposes of the bioengineered strain of dimercurion, the bioengineered strain be used in water environment Middle improvement Hg (II) pollution.

Preferably, bioengineered strain investment is had in the water environment of Hg (II) pollution, Hg (II) is reduced to Hg (0), the improvement of water environment is realized.

The present invention is include at least the following beneficial effects:

Bioengineered strain provided by the present invention for restoring dimercurion can be used for administering Hg in water environment (II) it pollutes.Bioengineered strain investment is had in the water environment of Hg (II) pollution, Hg (II) is reduced to Hg (0), is realized The improvement of water environment.

The present invention successfully constructs plasmid merR with genetic engineering means such as conversions using PCR amplification, digestion identification, connection Op-ompA-merA-pSB1A2, the bioengineered strain containing the plasmid can " transcribing and swashing by metal-regulatory albumen MerR It is living " for mechanism regulating mercury ion reductase MerA in the expression of microbial cell surface, MerA albumen can be by toxic Hg (II) It is changed into toxicity very little and there is volatile metal Hg (0), thus the mercury ion in water environment of degrading.To low concentration and highly concentrated The mercury ion of degree, certain reduction effect is presented in mercury ion reductase MerA, also, reduction rate is in becoming for growth at any time Gesture.Mercury ion reductase MerA only restores the mercury ion in water environment, does not restore other metal ions, shows to Hg (II) Selectivity.

Bioengineered strain of the invention has ecological, environmental protective, selectivity good, clever for administering Hg in water environment (II) pollution High, low in cost, the reusable advantage of sensitivity.

Further advantage, target and feature of the invention will be partially reflected by the following instructions, and part will also be by this The research and practice of invention and be understood by the person skilled in the art.

Detailed description of the invention

Fig. 1 is the plasmid map of pSB1A2 plasmid backbone of the present invention；

Fig. 2 is the building flow chart of expression vector of the present invention；

Fig. 3 be merR op of the present invention, ompA, merA, merR op-ompA genetic fragment amplification after electrophoresis Figure；

Fig. 4 is merR op-ompA-pSB1A2 plasmid of the present invention and the electrophoretogram that digestion is identified；

Fig. 5 is merR op-ompA-merA-pSB1A2 expression vector of the present invention and the electrophoretogram that digestion is identified；

Fig. 6 be bioengineered strain of the present invention with compare bacterium to the reduction effect figure of mercury ion；

Fig. 7 is reduction effect of the bioengineered strain of the present invention to various concentration mercury ion；

Fig. 8 is reducing property comparison diagram of the bioengineered strain of the present invention to 8 metal ion species.

Specific embodiment

The present invention is described in further detail with reference to the accompanying drawings and examples, to enable those skilled in the art's reference Specification word can be implemented accordingly.

The present invention provides a kind of for restoring the bioengineered strain of dimercurion, and the bioengineered strain contains expression Carrier, the expression vector be merR op-ompA-merA-pSB1A2 comprising recombination merR op-ompA-merA and PSB1A2 plasmid backbone.PSB1A2 plasmid backbone is the current material that can prepare of the prior art, by Nanjing University in the present invention Zhao Jing teaches seminar's present, is used for construction recombination plasmid, i.e. expression vector, the plasmid map of pSB1A2 plasmid backbone such as Fig. 1 Shown, the rfp in pSB1A2 map is had been removed by subsequent endonuclease reaction, is not influenced on system construction.

The present invention provides a kind of for restoring the preparation method of the bioengineered strain of dimercurion, comprising the following steps:

Step 1: realizing the amplification of merR op, ompA, merA genetic fragment respectively using pcr amplification reaction, will expand MerR op genetic fragment afterwards is connected with ompA genetic fragment by overlap extension pcr, and passes through pcr amplification reaction reality Existing amplification in vitro, obtains target gene fragment merR op-ompA；

The gene order of merR as shown in SEQ ID NO.1, the gene order of op as shown in SEQ ID NO.2, ompA's Gene order is as shown in SEQ ID NO.3, and the gene order of merA is as shown in SEQ ID NO.4, recombination merR op- The gene order of ompA-merA is as shown in SEQ ID NO.5.

Target gene fragment merR op-ompA in step 1 is obtained especially by following methods: respectively with fully synthetic MerR op, ompA, merA gene order be template, carry out first time pcr amplification reaction, then by after amplification merR op and The complementary fragment of ompA genetic fragment end realizes the connection of merR op and ompA by overlap extension pcr, is connected Segment merR op-ompA carries out second of pcr amplification reaction, realizes the amplification of junction fragment merR op-ompA, obtains mesh Genetic fragment merR op-ompA.If the following table 1 is first time pcr amplification reaction system (100ul).If the following table 2 is second Pcr amplification reaction system (100ul).

Table 1

Table 2

When first time pcr amplification reaction, it includes ImeR-OP XF, OP-ompA UP that merR op, which needs the primer that is added, It includes OP-ompA DN, OmpA SR that ompA, which needs the primer being added, and it includes MerA SF, MerA that merA, which needs the primer being added, SR；The primer that second of pcr amplification reaction is added includes IMerR-OP XF and OmpA SR, the sequence such as following table of above-mentioned each primer Shown in 3.DNA polymerase is also added into first time pcr amplification reaction and second of pcr amplification reaction.

Table 3

First time pcr amplification reaction includes 30 circulations, wherein a circulation is successively moved back including 98 DEG C of denaturation 10s, 55 DEG C Fiery 10s, 72 DEG C of extension 5s；Second of pcr amplification reaction includes 30 circulations, wherein a circulation successively includes 98 DEG C of denaturation 10s, 55 DEG C of annealing 10s, 72 DEG C of extension 10s.Such as the response procedures that the following table 4 is first time pcr amplification reaction.If the following table 5 is the The response procedures of secondary PCR amplified reaction.

Table 4

Table 5

Genetic fragment merR op, ompA, merA, merR op-ompA use Ago-Gel after expanding by PCR program Electrophoresis identified, electrophoresis result show swimming lane 1,2,3,4 near 500bp, between 500bp-750bp, 1500 bp- There is apparent single slice between 2000bp, near 1000bp, with merR op (506bp), ompA (549bp), merA (1686bp) is consistent completely with the size of merR op-ompA (1054bp) genetic fragment, as shown in figure 3, showing PCR amplification knot Fruit is in the main true.In Fig. 3,1 represents merR op gene amplification product；2 represent ompA gene amplification product；3 represent merA gene Amplified production；4 represent merR op-ompA gene amplification product.

Step 2: using restriction enzyme XbaI and SpeI to pSB1A2 plasmid backbone and target gene fragment merR Op-ompA carries out double digestion, makes target gene fragment merR op-ompA and pSB1A2 plasmid backbone while exposing identical viscous Property end, target gene fragment merR op-ompA is connected with pSB1A2 plasmid backbone by T4DNA ligase, realize merR The building of op-ompA-pSB1A2 plasmid；Reaction temperature when carrying out double digestion is 37 DEG C, reaction time 1h.

The target gene fragment connected by overlap extension pcr is handled using restriction enzyme XbaI and SpeI MerR op-ompA and pSB1A2 plasmid backbone, reaction system digestion products after 37 DEG C of isothermal reaction 1h pass through 1% agarose Gel electrophoresis experiment and gel extraction experiment carry out concentration determination after purification.Endonuclease bamhi merR op-ompA and pSB1A2 matter Grain skeleton is after gel extraction, under the action of T4 ligase, realizes the connection of merR op-ompA segment and pSB1A2, even Object of practicing midwifery is converted by chemical method into E.coli DH5 α competent cell.Picking monoclonal carry out the method by step 1 into Row PCR identification, PCR identifies that correct monoclonal carries out plasmid extraction and digestion identification experiment, as shown in figure 4,1 and 2 point in Fig. 4 The result of merR op-ompA-pSB1A2 plasmid and the identification of XbaI, SpeI double digestion is not represented.Meanwhile through the raw work biology in Shanghai Company's sequencing proves that merR op-ompA segment is successfully inserted into the XbaI/SpeI restriction enzyme site of pSB1A2 plasmid backbone Between, and building process does not mutate.

The double enzyme digestion reaction system of target gene fragment merR op-ompA and pSB1A2 plasmid backbone is as shown in table 6 below. Then, target gene fragment merR op-ompA is constructed to pSB1A2 plasmid backbone by connection reaction, realizes merR op- The building of ompA-pSB1A2 carrier, specific reaction system is as shown in table 7, in 16 DEG C of constant temperature overnight after take a small amount of connection product into Row conversion, picking PCR identification and the correct monoclonal of digestion identification send to the raw work in Shanghai after being incubated overnight in LB culture medium raw Object company is sequenced, and the correct carrier merR-ompA-pSB1A2 of sequencing result is carried out subsequent experimental.

Table 6

Table 7

Step 3: using restriction enzyme SpeI to the merA base after merR op-ompA-pSB1A2 plasmid and amplification Because segment carries out single endonuclease digestion, then the merA gene with T4DNA ligase by merR op-ompA-pSB1A2 plasmid and after expanding Segment connection, completes the building of expression vector merR op-ompA-merA-pSB1A2, as shown in Fig. 2, over-lap PCR is just in Fig. 2 It is overlap extension pcr；Reaction temperature when carrying out single endonuclease digestion in step 3 is 37 DEG C, reaction time 1h.

MerA genetic fragment and merR op-ompA-pSB1A2 after amplification are handled using restriction enzyme SpeI, instead System digestion products after 37 DEG C of isothermal reaction 1h are answered to test after purification by the experiment of 1% agarose gel electrophoresis and gel extraction Carry out concentration determination.As shown in figure 5, in Fig. 51 and 2 respectively represent expression vector merR op-ompA-merA-pSB1A2 and The result of SpeI digestion identification, it was demonstrated that after merR op-ompA segment is successfully connected to plasmid pSB1A2, merR op-ompA- Using after SpeI single endonuclease digestion, reusing T4 ligase can be realized plasmid merR op-ompA-merA- for pSB1A2 and merA segment The successful building of pSB1A2.It is transferred in competent cell E.coli DH5 α, is sequenced to prevent having base deletion or mutation again.Through The sequencing of Shanghai Sheng Gong biotech firm proves, merA segment be successfully inserted into pSB1A2 carrier and merR op-ompA segment it Meta position, and building process does not mutate.

MerR op-ompA-pSB1A2 and the single endonuclease digestion reaction system of the merA genetic fragment after amplification are as shown in table 8 below. Then, the merA genetic fragment after amplification is constructed to merR op-ompA-pSB1A2 by connection reaction, realizes that expression carries The building of body merR op-ompA-merA-pSB1A2, specific reaction system is as shown in table 9, then is converted, picking PCR identification Shanghai Sheng Gong biotech firm is sent to after being incubated overnight in LB culture medium with the correct monoclonal of digestion identification to be sequenced, and will be surveyed It is real for subsequent performance test after the correct expression vector merR op-ompA-merA-pSB1A2 scribing line of sequence result and conservation It tests.

Table 8

Table 9

Step 4: expression vector merR op-ompA-merA-pSB1A2 converted by chemical transformation thin to competence It is intracellular, obtain the bioengineered strain.Competent cell in step 4 is E.coli DH5 α competent cell, as host Bacterium.Specific conversion process are as follows: (1) the competent cell E.coli DH5 α dispensed is taken to thaw from nitrogen gas tank on ice；(2) 1ul expression vector merR op-ompA-merA-pSB1A2 is added, tube wall can be flicked to mix, in placing 30min on ice；(3) 42 DEG C of water-bath heat shock 90s, avoid shaking；(4) 5min on ice is put back to rapidly；(5) plus 500ul sterilizes LB (being free of resistance), and 37 DEG C 250rpm constant temperature incubation 60min；(6) take 50ul bacterium solution uniform in sprawling in resistant LB solid medium board；(7) plate falls It is placed in 37 DEG C of oven overnight cultures.

One, bioengineered strain with compare comparison of the bacterium for Hg (II) reducing property

(1) from the experimental bacteria of conversion merR op-ompA-merA-pSB1A2 expression vector and conversion merR op-ompA- Picking single colonie is inoculated in 3ml liquid LB culture medium respectively and (contains on the LB solid culture plate of the control bacterium of pSB1A2 plasmid 150ug/mL carbenicillin) in, it is stayed overnight in 37 DEG C of 250rpm constant temperature incubations；

(2) bacterium solution being incubated overnight is incubated in the LB liquid medium of 100ml in the expansion of 1:100 ratio, in 37 DEG C 250rpm constant temperature incubation is until OD600=1；

(3) to the above-mentioned mercury ion for growing to addition same concentrations (20uM) in OD600=1 bacterium solution, in 37 DEG C of 250 rpm Continue culture (experimental bacteria and control bacterium are respectively provided with 3 repetitions and test)；

(4) the above two bacterium solution of 100ul is drawn respectively in 0,2,4,6,8h time point in 1.5ml EP pipe, is added 100ul concentrated nitric acid nitration reaction 1h in 65 DEG C of water-baths；

(5) the bacteria liquid sample 100ul after drawing nitrification uses inductive coupling in test tube after being settled to 5ml with distilled water Plasma (ICP-MS) detects the ion concentration of mercury in bacterium solution.

It can be incited somebody to action to be verified metal-regulatory albumen MerR regulation in the MerA albumen of bacterial cell Membrane surface expression Toxic Hg (II) is changed into toxicity very little and has volatile metal Hg (0), gives bioengineered strain respectively in this experiment With the control certain density Hg of bacterium (II) (20uM), according to above-mentioned steps (1)-(5), finally measure different moments (0,2,4,6, 8h) the content of bioengineered strain and Hg (II) in control bacterium.As shown in fig. 6, the experimental results showed that, bioengineered strain can pass through Hg in water environment is effectively reduced to restore the Hg (II) in water environment in MerR protein regulation expression OmpA-MerA recombinant protein (II) content, and the control bacterium for only expressing OmpA albumen cannot then reduce Hg in water environment (II) content.

Two, bioengineered strain studies the reducing property of various concentration Hg (II)

(1) from picking list on the LB solid culture plate of the experimental bacteria of conversion merR op-ompA-merA-pSB1A2 plasmid Bacterium colony is inoculated in respectively in 3ml LB liquid medium (carbenicillin containing 150ug/mL), in 37 DEG C of 250rpm constant temperature incubation mistakes Night；

(3) OD600=1 bacterium solution packing (3mL/ pipe) is grown to by above-mentioned, final concentration is added to the bacterium solution dispensed respectively For 10uM, 25uM, 50uM, 100uM, 250uM, 500uM Hg²⁺, continue culture in 37 DEG C of 250rpm (3 repetitions of setting are tested)；

(4) bacterium solution that 100ul contains different mercury concentration is drawn respectively in 1.5ml EP pipe in 0,2,6h, be separately added into 100ul concentrated nitric acid nitration reaction 1h in 65 DEG C of water-baths；

(5) the bacteria liquid sample 100ul after drawing nitrification uses inductive coupling in test tube after being settled to 5ml with distilled water Plasma (ICP-MS) detects the mercury ion in bacterium solution.

Give respectively the certain density Hg of bioengineered strain (II) (10uM, 25uM, 50uM, 100uM, 250uM, 500uM), according to above-mentioned steps (1)-(5), bioengineered strain under various concentration is finally measured to the reduction rate of Hg (II), by Fig. 7 , it is apparent that reduction rate is up to 37.06% when it is 2h that the time, which is added, in 10uM Hg (II)；With Hg (II) concentration Increasing, the degradation rate of Hg (II) gradually decreases, when it is 2h that the time, which is added, in 500uM Hg (II), reduction rate 26.64%, with The increase of time, no matter Hg (II) reduction rate is further increased in high concentration or in low concentration bioengineered strain, when When 10uM Hg (II) the addition time is 6h, reduction rate is up to 59%；When it is 6h that the time, which is added, in 500uM Hg (II), reduction rate It is 42.39%, Experiment Result shows that bioengineered strain can efficiently restore Hg in water environment (II), realizes the mercury pollution of high concentration It administers.

Three, the specific performance study that bioengineered strain restores Hg (II)

(2) bacterium solution being incubated overnight is incubated in the LB liquid medium of 100ml in the expansion of 1:100 ratio, in 37 DEG C, 250rpm constant temperature incubation is until OD600=1；

(3) by it is above-mentioned grow to OD600=1 bacterium solution packing (3mL/ pipe), respectively to dispensed bacterium solution addition Hg (II), Cu (II), Zn (II), Pb (II), Ni (II), Cd (II), Cr (III), Fe (III) to final concentration of 1uM or 10uM, in 37 DEG C 250rpm continues culture (3 repetitions of setting are tested)；

(4) bacterium solution that 100ul contains different metal concentration is drawn respectively in 1.5ml EP pipe in 0h, 6h, be separately added into 100ul concentrated nitric acid nitration reaction 1h in 65 DEG C of water-baths；

8 metal ion species Hg (II), Cu (II), Zn (II), Pb (II), Ni are separately added into the culture medium of bioengineered strain (II), Cd (II), Cr (III), Fe (III) compare bioengineered strain to the reducing power of different metal ions to reflect biology Selectivity of the engineering bacteria to Hg (II).As seen from Figure 8, bioengineered strain specific reduction Hg (II), to effectively drop Hg (II) concentration in low water environment, and other metal ion Cu (II), Zn (II), Pb (II), Ni (II), Cd in water environment (II), Cr (III), Fe (III) concentration after bioengineered strain is handled are basically unchanged.Result of study shows bioengineered strain pair Hg (II) has preferable selectivity, specific can reduce mercury ion content in water environment.

Therefore, the present invention successfully constructs pledge with genetic engineering means such as conversions using PCR amplification, digestion identification, connection Grain merR op-ompA-merA-pSB1A2, the bioengineered strain containing the plasmid can pass through metal-regulatory albumen merR's " transcriptional activation " mechanism regulating mercury ion reductase MerA microbial cell surface expression, thus the mercury in water environment of degrading Ion, and the control bacterium for only expressing OmpA albumen cannot then reduce Hg in water environment (II) content, show that MerA albumen can incite somebody to action Toxic Hg (II) is changed into toxicity very little and has volatile metal Hg (0).Experiment discovery, no matter to the mercury of low concentration from The bioengineered strain of the mercury ion of son or high concentration, cell surface expression mercury ion reductase MerA has higher reduction Rate, and reduction rate is in the trend of growth at any time.Meanwhile the bioengineering of cell surface expression mercury ion reductase MerA Bacterium only restores the mercury ion in water environment, does not restore other metal ions, shows to the highly selective of Hg (II).This hair Bright bioengineered strain has ecological, environmental protective, selectivity good, high sensitivity, cost for administering Hg in water environment (II) pollution Cheap, reusable advantage.

In addition, reagent used in the present invention is as shown in the following table 10.

Table 10

Instrument and equipment used in the present invention is as shown in table 11 below.

Table 11

Culture medium prescription used in the present invention is as shown in table 12 below.

Table 12

Electrophoresis liquid used in the present invention be 50*TAE electrophoresis liquid (1L), specifically: weigh 242g Tris alkali, spend from Sub- water is settled to 1000ml after 57.1ml glacial acetic acid and 100ml 0.5M NaOH (PH=8.0) are added after being completely dissolved, and works molten Liquid concentration is 1*.The formula for the 6*DNA sample-loading buffer (1ml) used is as shown in table 13 below.

Table 13

Agarose gel electrophoresis experiment has been used in the present invention.Agarose gel electrophoresis experiment is mainly used to separate and identify DNA molecular.DNA molecular is mainly by ribose, phosphoric acid and base composition, and the structure of ribose-phosphate backbone is repeated, makes identical The double chain DNA molecule of quantity possesses identical electrostatic charge, and the nucleic acid as amphiphatic molecule is in pH=8.0 or so, entirely Charge is negatively charged, will move at a same speed to anode in electrophoretic action, therefore under identical electric field strength, DNA molecular Migration rate depend on DNA molecular itself molecular weight and structure.DNA molecular identical for configuration, migration velocity with The size of relative molecular weight is inversely proportional.And the DNA molecular different for molecular weight identical configuration, agarose gel electrophoresis experiment are same Sample is available to be efficiently separated, the migration rate of the DNA molecular of various configuration in certain electric field are as follows: covalently closed circle supercoil DNA > linear DNA > open loop double-stranded cyclic DNA.General agarose gel electrophoresis experiment be suitable for separation size 0.2kb~ DNA fragmentation within the scope of 50kb.By taking the experiment of 1% agarose gel electrophoresis as an example, primary operational process are as follows: 2g agarose is weighed, It is added after 50 × TAE of 4ml electrophoretic buffer mixes and is settled to 200ml with deionized water, it is complete that agarose is heated in micro-wave oven Room temperature is cooling after fully dissolved, pours into mold rapidly after temperature is down to 60 DEG C or so and 2-4ul ethidium bromide is added.It is uniformly mixed After continue cool to colloid solidification after, the gel prepared is transferred in electrophoresis system by mold, it is slow that 1 × TAE electrophoresis is added Fliud flushing was not to there be glue surface slightly.Backward Ago-Gel swimming lane in DNA sample is added, the gel slab after sample-adding be powered immediately into Row electrophoresis, voltage 100V, sample are mobile from cathode (black) to positive (red) direction.When bromophenol blue is moved to distance in sample When at offset plate lower edge about 1/3, stop electrophoresis.It is careful to take out gel, it observes in the UV lamp, DNA, which exists, then shows that red is glimmering Striation band is taken pictures preservation using Gel Doc XR gel imaging system.

Gel extraction experiment has been used in the present invention.It is solidifying to agarose using Omega Bio-Tek gel extraction kit The DNA fragmentation that gel electrophoresis experiment is cut is recycled, and key step is as follows: 1) gel being placed in the EP pipe completely to sterilize claims Weight calculates the net weight of gel, and the ratio of 100ul Binding Buffer XP2 is added according to the gel of every 100mg weight The Binding Buffer XP2 of appropriate volume is added in EP pipe.2) EP pipe is put into 55-60 DEG C of waters, until to solidifying Glue melts completely, and the gel that during which can turn upside down accelerates the thawing of gel.3) it will be dissolved after gel melts completely with liquid-transfering gun Careful being transferred to of liquid is equipped with collecting pipeIn DNA Mini column, at room temperature 10000xg be centrifuged 1 minute, discard from Heart liquid.4) again to300ul Binding Buffer XP2 is added in DNA Mini column, equally at room temperature 10000xg discards centrifugate after being centrifuged 1 minute.5) to700ul SPW Wash is added in DNA Mini column Filtrate is discarded after Buffer, room temperature high speed centrifugation 1min.6) after repeating step 5), room temperature high speed centrifugation 3min is dry againDNA Mini column.7) sample collection tube is replaced into sterile EP to manage, the MilliQ of 20-30 ul sterilizing is added H2O infiltrationDNA Mini column is stored at room temperature high speed centrifugation eluted dna sample after 2min, uses NanoDrop1000 Trace of albumin nucleic acid analyzer saves after measuring concentration to -4 DEG C.

Although the embodiments of the present invention have been disclosed as above, but its is not only in the description and the implementation listed With it can be fully applied to various fields suitable for the present invention, for those skilled in the art, can be easily Realize other modification, therefore without departing from the general concept defined in the claims and the equivalent scope, the present invention is simultaneously unlimited In specific details and legend shown and described herein.

The sequence of merR is as follows in the present invention:

TTACGGCATAGCAGAACCAGCCAGTGAAGCACCACCTTGCAGCGAAGCGATCAGCG GACACGACACGTTACCGCGACGAGCATGACATGCGCAAACCAGTTCTGACAGCACT GCTTCCATACGTGCCAGGTCTGCCATCTTTTCACGGACATCCTTCAGTTTGTGTTCGG CCAGAGAGCTCGCTTCTTCGCAATGCGTACCGTCTTCCAGGCGCAGCAGTTCTGCGA TTTCATCCAGGGAGAAGCCCAGACGCTGAGCACTTTTGACAAAGCGAACACGGGTC ACGTCTGCTTCACCGTAGCGACGAATAGAGCCATACGGCTTATCCGGTTCCAGCAGC AGGCCTTTGCGTTGATAGAAGCGGATCGTTTCCACATTCACACCGGCAGCCTTAGCG AAGACACCAATCGTCAGGTTTTCCAGGTTATTTTCCAT

The sequence of op (operator) is as follows in the present invention:

ATCGCTTGACTCCGTACATGAGTACGGAAGTAAGGTTACGCTATCCAATTTCAATTCG AAAGGACAAGCGC

The sequence of ompA is as follows in the present invention:

ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCG CAGGCCGCTCCGAAAGATAACACCTGGTACACTGGTGCTAAACTGGGCTGGTCCCA GTACCATGACACTGGTTTCATCAACAACAATGGCCCGACCCATGAAAACCAACTGGG CGCTGGTGCTTTTGGTGGTTACCAGGTTAACCCGTATGTTGGCTTTGAAATGGGTTAC GACTGGTTAGGTCGTATGCCGTACAAAGGCAGCGTTGAAAACGGTGCATACAAAGCT CAGGGCGTTCAACTGACCGCTAAGCTGGGTTACCCAATCACTGACGACCTGGACATC TACACTCGTCTGGGTGGCATGGTATGGCGTGCAGACACTAAATCCAACGTTTATGGTA AAAACCACGACACCGGCGTTTCTCCGGTCTTCGCTGGCGGTGTTGAGTACGCGATCA CTCCTGAAATCGCTACCCGTCTGGAATACCAGTGGACCAACAACATCGGTGACGCAC ACACCATCGGCACTCGTCCGGACAACGGAGGATCC

The sequence of merA is as follows in the present invention:

ATGACCCATCTGAAAATTACCGGTATGACCTGTGATAGCTGTGCAGCACATGTTAAAG AAGCCCTGGAAAAAGTTCCGGGTGTTCAGAGCGCACTGGTTTCATATCCGAAAGGTA CCGCACAGCTGGCAATTGTTCCGGGTACATCACCGGATGCACTGACCGCAGCAGTTG CAGGTCTGGGTTATAAAGCTACCCTGGCAGATGCCCCGCTGGCCGATAATCGTGTGG GTCTGCTGGATAAAGTTCGTGGTTGGATGGCAGCAGCCGAAAAACATAGCGGTAATG AACCGCCAGTTCAGGTTGCAGTGATTGGCTCAGGTGGTGCAGCAATGGCAGCAGCA CTGAAAGCTGTGGAACAGGGTGCACAGGTTACCCTGATTGAACGTGGTACAATTGGT GGCACATGTGTGAATGTGGGTTGTGTTCCGAGCAAAATTATGATTCGTGCGGCACATA TTGCCCATCTGCGCCGCGAATCTCCGTTTGATGGCGGTATTGCAGCCACCGTTCCGAC CATTGATCGTAGTAAATTACTGGCACAGCAGCAGGCGCGTGTTGATGAACTGCGCCA TGCAAAATATGAAGGTATTCTGGGTGGCAATCCGGCTATTACCGTGGTTCATGGTGAA GCTCGTTTTAAAGATGATCAGTCTCTGACCGTGCGCCTGAATGAAGGTGGTGAACGT GTTGTTATGTTTGATCGTTGTCTGGTGGCAACAGGCGCCTCACCGGCTGTTCCGCCGA TTCCGGGTCTGAAAGAAAGTCCGTATTGGACGTCTACTGAAGCACTGGCATCAGATA CCATTCCGGAACGTCTGGCGGTGATTGGTAGTAGCGTTGTTGCCCTGGAACTGGCGC AGGCCTTTGCACGTCTGGGTTCTAAAGTTACCGTGCTGGCCCGTAATACACTGTTCTT TCGCGAAGATCCGGCCATTGGTGAAGCCGTTACAGCTGCATTTCGCGCAGAAGGTAT TGAAGTTCTGGAACATACCCAGGCAAGCCAGGTTGCGCATATGGATGGTGAATTTGT TCTGACAACCACCCATGGTGAACTGCGCGCCGATAAACTGTTGGTGGCGACCGGCC GTACCCCGAATACACGTTCTCTGGCACTGGATGCAGCAGGTGTGACAGTTAATGCGC AGGGTGCCATTGTGATTGATCAGGGTATGCGCACAAGCAATCCGAATATTTATGCGGC CGGTGATTGTACTGATCAGCCGCAGTTTGTGTATGTTGCGGCAGCGGCAGGCACCCG CGCCGCAATTAATATGACCGGTGGTGATGCTGCGCTGGATCTGACCGCAATGCCGGC CGTGGTGTTTACCGATCCGCAGGTTGCGACAGTTGGTTATAGTGAAGCGGAAGCACA TCATGATGGAATTGAAACCGATAGCCGCACCCTGACCCTGGATAATGTACCGCGTGC ACTGGCTAATTTTGATACACGCGGTTTTATTAAACTGGTGATTGAAGAAGGCTCACAT CGTCTGATTGGTGTGCAGGCAGTTGCCCCGGAAGCAGGTGAACTGATTCAGACCGC AGCACTGGCTATTCGTAATCGTATGACCGTGCAGGAACTGGCAGATCAGCTGTTTCC GTATCTGACCATGGTGGAAGGCCTGAAACTGGCGGCACAGACCTTTAATAAAGATGT TAAACAGCTGAGCTGTTGTGCCGGTTAA

The sequence of recombination merR op-ompA-merA is as follows in the present invention:

TCTAGATTACGGCATAGCAGAACCAGCCAGTGAAGCACCACCTTGCAGCGAAGCGAT CAGCGGACACGACACGTTACCGCGACGAGCATGACATGCGCAAACCAGTTCTGACA GCACTGCTTCCATACGTGCCAGGTCTGCCATCTTTTCACGGACATCCTTCAGTTTGTG TTCGGCCAGAGAGCTCGCTTCTTCGCAATGCGTACCGTCTTCCAGGCGCAGCAGTTC TGCGATTTCATCCAGGGAGAAGCCCAGACGCTGAGCACTTTTGACAAAGCGAACAC GGGTCACGTCTGCTTCACCGTAGCGACGAATAGAGCCATACGGCTTATCCGGTTCCA GCAGCAGGCCTTTGCGTTGATAGAAGCGGATCGTTTCCACATTCACACCGGCAGCCT TAGCGAAGACACCAATCGTCAGGTTTTCCAGGTTATTTTCCATATCGCTTGACTCCGT ACATGAGTACGGAAGTAAGGTTACGCTATCCAATTTCAATTCGAAAGGACAAGCGC ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCG CAGGCCGCTCCGAAAGATAACACCTGGTACACTGGTGCTAAACTGGGCTGGTCCCA GTACCATGACACTGGTTTCATCAACAACAATGGCCCGACCCATGAAAACCAACTGGG CGCTGGTGCTTTTGGTGGTTACCAGGTTAACCCGTATGTTGGCTTTGAAATGGGTTAC GACTGGTTAGGTCGTATGCCGTACAAAGGCAGCGTTGAAAACGGTGCATACAAAGCT CAGGGCGTTCAACTGACCGCTAAGCTGGGTTACCCAATCACTGACGACCTGGACATC TACACTCGTCTGGGTGGCATGGTATGGCGTGCAGACACTAAATCCAACGTTTATGGTA AAAACCACGACACCGGCGTTTCTCCGGTCTTCGCTGGCGGTGTTGAGTACGCGATCA CTCCTGAAATCGCTACCCGTCTGGAATACCAGTGGACCAACAACATCGGTGACGCAC ACACCATCGGCACTCGTCCGGACAACGGAGGATCCACTAGTATGACCCATCTGAAAA TTACCGGTATGACCTGTGATAGCTGTGCAGCACATGTTAAAGAAGCCCTGGAAAAAG TTCCGGGTGTTCAGAGCGCACTGGTTTCATATCCGAAAGGTACCGCACAGCTGGCAA TTGTTCCGGGTACATCACCGGATGCACTGACCGCAGCAGTTGCAGGTCTGGGTTATA AAGCTACCCTGGCAGATGCCCCGCTGGCCGATAATCGTGTGGGTCTGCTGGATAAAG TTCGTGGTTGGATGGCAGCAGCCGAAAAACATAGCGGTAATGAACCGCCAGTTCAG GTTGCAGTGATTGGCTCAGGTGGTGCAGCAATGGCAGCAGCACTGAAAGCTGTGGA ACAGGGTGCACAGGTTACCCTGATTGAACGTGGTACAATTGGTGGCACATGTGTGAA TGTGGGTTGTGTTCCGAGCAAAATTATGATTCGTGCGGCACATATTGCCCATCTGCGC CGCGAATCTCCGTTTGATGGCGGTATTGCAGCCACCGTTCCGACCATTGATCGTAGTA AATTACTGGCACAGCAGCAGGCGCGTGTTGATGAACTGCGCCATGCAAAATATGAAG GTATTCTGGGTGGCAATCCGGCTATTACCGTGGTTCATGGTGAAGCTCGTTTTAAAGA TGATCAGTCTCTGACCGTGCGCCTGAATGAAGGTGGTGAACGTGTTGTTATGTTTGAT CGTTGTCTGGTGGCAACAGGCGCCTCACCGGCTGTTCCGCCGATTCCGGGTCTGAAA GAAAGTCCGTATTGGACGTCTACTGAAGCACTGGCATCAGATACCATTCCGGAACGT CTGGCGGTGATTGGTAGTAGCGTTGTTGCCCTGGAACTGGCGCAGGCCTTTGCACGT CTGGGTTCTAAAGTTACCGTGCTGGCCCGTAATACACTGTTCTTTCGCGAAGATCCGG CCATTGGTGAAGCCGTTACAGCTGCATTTCGCGCAGAAGGTATTGAAGTTCTGGAAC ATACCCAGGCAAGCCAGGTTGCGCATATGGATGGTGAATTTGTTCTGACAACCACCC ATGGTGAACTGCGCGCCGATAAACTGTTGGTGGCGACCGGCCGTACCCCGAATACAC GTTCTCTGGCACTGGATGCAGCAGGTGTGACAGTTAATGCGCAGGGTGCCATTGTGA TTGATCAGGGTATGCGCACAAGCAATCCGAATATTTATGCGGCCGGTGATTGTACTGA TCAGCCGCAGTTTGTGTATGTTGCGGCAGCGGCAGGCACCCGCGCCGCAATTAATAT GACCGGTGGTGATGCTGCGCTGGATCTGACCGCAATGCCGGCCGTGGTGTTTACCGA TCCGCAGGTTGCGACAGTTGGTTATAGTGAAGCGGAAGCACATCATGATGGAATTGA AACCGATAGCCGCACCCTGACCCTGGATAATGTACCGCGTGCACTGGCTAATTTTGAT ACACGCGGTTTTATTAAACTGGTGATTGAAGAAGGCTCACATCGTCTGATTGGTGTGC AGGCAGTTGCCCCGGAAGCAGGTGAACTGATTCAGACCGCAGCACTGGCTATTCGTA ATCGTATGACCGTGCAGGAACTGGCAGATCAGCTGTTTCCGTATCTGACCATGGTGG AAGGCCTGAAACTGGCGGCACAGACCTTTAATAAAGATGTTAAACAGCTGAGCTGTT GTGCCGGTTAAACTAGT

The base sequence in XbaI enzyme cutting site in the present invention are as follows: TCTAGA

The base sequence of SpeI restriction enzyme site in the present invention are as follows: ACTAGT.

SEQUENCE LISTING

<110>Guangxi Teachers College

<120>for restoring bioengineered strain of dimercurion and its preparation method and application

<130> CN18NN9856I

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 435

<212> DNA

<213>artificial sequence

<400> 1

ttacggcata gcagaaccag ccagtgaagc accaccttgc agcgaagcga tcagcggaca 60

cgacacgtta ccgcgacgag catgacatgc gcaaaccagt tctgacagca ctgcttccat 120

acgtgccagg tctgccatct tttcacggac atccttcagt ttgtgttcgg ccagagagct 180

cgcttcttcg caatgcgtac cgtcttccag gcgcagcagt tctgcgattt catccaggga 240

gaagcccaga cgctgagcac ttttgacaaa gcgaacacgg gtcacgtctg cttcaccgta 300

gcgacgaata gagccatacg gcttatccgg ttccagcagc aggcctttgc gttgatagaa 360

gcggatcgtt tccacattca caccggcagc cttagcgaag acaccaatcg tcaggttttc 420

caggttattt tccat 435

<210> 2

<211> 71

<212> DNA

<213>artificial sequence

<400> 2

atcgcttgac tccgtacatg agtacggaag taaggttacg ctatccaatt tcaattcgaa 60

aggacaagcg c 71

<210> 3

<211> 549

<212> DNA

<213>artificial sequence

<400> 3

atgaaaaaga cagctatcgc gattgcagtg gcactggctg gtttcgctac cgtagcgcag 60

gccgctccga aagataacac ctggtacact ggtgctaaac tgggctggtc ccagtaccat 120

gacactggtt tcatcaacaa caatggcccg acccatgaaa accaactggg cgctggtgct 180

tttggtggtt accaggttaa cccgtatgtt ggctttgaaa tgggttacga ctggttaggt 240

cgtatgccgt acaaaggcag cgttgaaaac ggtgcataca aagctcaggg cgttcaactg 300

accgctaagc tgggttaccc aatcactgac gacctggaca tctacactcg tctgggtggc 360

atggtatggc gtgcagacac taaatccaac gtttatggta aaaaccacga caccggcgtt 420

tctccggtct tcgctggcgg tgttgagtac gcgatcactc ctgaaatcgc tacccgtctg 480

gaataccagt ggaccaacaa catcggtgac gcacacacca tcggcactcg tccggacaac 540

ggaggatcc 549

<210> 4

<211> 1686

<212> DNA

<213>artificial sequence

<400> 4

atgacccatc tgaaaattac cggtatgacc tgtgatagct gtgcagcaca tgttaaagaa 60

gccctggaaa aagttccggg tgttcagagc gcactggttt catatccgaa aggtaccgca 120

cagctggcaa ttgttccggg tacatcaccg gatgcactga ccgcagcagt tgcaggtctg 180

ggttataaag ctaccctggc agatgccccg ctggccgata atcgtgtggg tctgctggat 240

aaagttcgtg gttggatggc agcagccgaa aaacatagcg gtaatgaacc gccagttcag 300

gttgcagtga ttggctcagg tggtgcagca atggcagcag cactgaaagc tgtggaacag 360

ggtgcacagg ttaccctgat tgaacgtggt acaattggtg gcacatgtgt gaatgtgggt 420

tgtgttccga gcaaaattat gattcgtgcg gcacatattg cccatctgcg ccgcgaatct 480

ccgtttgatg gcggtattgc agccaccgtt ccgaccattg atcgtagtaa attactggca 540

cagcagcagg cgcgtgttga tgaactgcgc catgcaaaat atgaaggtat tctgggtggc 600

aatccggcta ttaccgtggt tcatggtgaa gctcgtttta aagatgatca gtctctgacc 660

gtgcgcctga atgaaggtgg tgaacgtgtt gttatgtttg atcgttgtct ggtggcaaca 720

ggcgcctcac cggctgttcc gccgattccg ggtctgaaag aaagtccgta ttggacgtct 780

actgaagcac tggcatcaga taccattccg gaacgtctgg cggtgattgg tagtagcgtt 840

gttgccctgg aactggcgca ggcctttgca cgtctgggtt ctaaagttac cgtgctggcc 900

cgtaatacac tgttctttcg cgaagatccg gccattggtg aagccgttac agctgcattt 960

cgcgcagaag gtattgaagt tctggaacat acccaggcaa gccaggttgc gcatatggat 1020

ggtgaatttg ttctgacaac cacccatggt gaactgcgcg ccgataaact gttggtggcg 1080

accggccgta ccccgaatac acgttctctg gcactggatg cagcaggtgt gacagttaat 1140

gcgcagggtg ccattgtgat tgatcagggt atgcgcacaa gcaatccgaa tatttatgcg 1200

gccggtgatt gtactgatca gccgcagttt gtgtatgttg cggcagcggc aggcacccgc 1260

gccgcaatta atatgaccgg tggtgatgct gcgctggatc tgaccgcaat gccggccgtg 1320

gtgtttaccg atccgcaggt tgcgacagtt ggttatagtg aagcggaagc acatcatgat 1380

ggaattgaaa ccgatagccg caccctgacc ctggataatg taccgcgtgc actggctaat 1440

tttgatacac gcggttttat taaactggtg attgaagaag gctcacatcg tctgattggt 1500

gtgcaggcag ttgccccgga agcaggtgaa ctgattcaga ccgcagcact ggctattcgt 1560

aatcgtatga ccgtgcagga actggcagat cagctgtttc cgtatctgac catggtggaa 1620

ggcctgaaac tggcggcaca gacctttaat aaagatgtta aacagctgag ctgttgtgcc 1680

ggttaa 1686

<210> 5

<211> 2759

<212> DNA

<213>artificial sequence

<400> 5

tctagattac ggcatagcag aaccagccag tgaagcacca ccttgcagcg aagcgatcag 60

cggacacgac acgttaccgc gacgagcatg acatgcgcaa accagttctg acagcactgc 120

ttccatacgt gccaggtctg ccatcttttc acggacatcc ttcagtttgt gttcggccag 180

agagctcgct tcttcgcaat gcgtaccgtc ttccaggcgc agcagttctg cgatttcatc 240

cagggagaag cccagacgct gagcactttt gacaaagcga acacgggtca cgtctgcttc 300

accgtagcga cgaatagagc catacggctt atccggttcc agcagcaggc ctttgcgttg 360

atagaagcgg atcgtttcca cattcacacc ggcagcctta gcgaagacac caatcgtcag 420

gttttccagg ttattttcca tatcgcttga ctccgtacat gagtacggaa gtaaggttac 480

gctatccaat ttcaattcga aaggacaagc gcatgaaaaa gacagctatc gcgattgcag 540

tggcactggc tggtttcgct accgtagcgc aggccgctcc gaaagataac acctggtaca 600

ctggtgctaa actgggctgg tcccagtacc atgacactgg tttcatcaac aacaatggcc 660

cgacccatga aaaccaactg ggcgctggtg cttttggtgg ttaccaggtt aacccgtatg 720

ttggctttga aatgggttac gactggttag gtcgtatgcc gtacaaaggc agcgttgaaa 780

acggtgcata caaagctcag ggcgttcaac tgaccgctaa gctgggttac ccaatcactg 840

acgacctgga catctacact cgtctgggtg gcatggtatg gcgtgcagac actaaatcca 900

acgtttatgg taaaaaccac gacaccggcg tttctccggt cttcgctggc ggtgttgagt 960

acgcgatcac tcctgaaatc gctacccgtc tggaatacca gtggaccaac aacatcggtg 1020

acgcacacac catcggcact cgtccggaca acggaggatc cactagtatg acccatctga 1080

aaattaccgg tatgacctgt gatagctgtg cagcacatgt taaagaagcc ctggaaaaag 1140

ttccgggtgt tcagagcgca ctggtttcat atccgaaagg taccgcacag ctggcaattg 1200

ttccgggtac atcaccggat gcactgaccg cagcagttgc aggtctgggt tataaagcta 1260

ccctggcaga tgccccgctg gccgataatc gtgtgggtct gctggataaa gttcgtggtt 1320

ggatggcagc agccgaaaaa catagcggta atgaaccgcc agttcaggtt gcagtgattg 1380

gctcaggtgg tgcagcaatg gcagcagcac tgaaagctgt ggaacagggt gcacaggtta 1440

ccctgattga acgtggtaca attggtggca catgtgtgaa tgtgggttgt gttccgagca 1500

aaattatgat tcgtgcggca catattgccc atctgcgccg cgaatctccg tttgatggcg 1560

gtattgcagc caccgttccg accattgatc gtagtaaatt actggcacag cagcaggcgc 1620

gtgttgatga actgcgccat gcaaaatatg aaggtattct gggtggcaat ccggctatta 1680

ccgtggttca tggtgaagct cgttttaaag atgatcagtc tctgaccgtg cgcctgaatg 1740

aaggtggtga acgtgttgtt atgtttgatc gttgtctggt ggcaacaggc gcctcaccgg 1800

ctgttccgcc gattccgggt ctgaaagaaa gtccgtattg gacgtctact gaagcactgg 1860

catcagatac cattccggaa cgtctggcgg tgattggtag tagcgttgtt gccctggaac 1920

tggcgcaggc ctttgcacgt ctgggttcta aagttaccgt gctggcccgt aatacactgt 1980

tctttcgcga agatccggcc attggtgaag ccgttacagc tgcatttcgc gcagaaggta 2040

ttgaagttct ggaacatacc caggcaagcc aggttgcgca tatggatggt gaatttgttc 2100

tgacaaccac ccatggtgaa ctgcgcgccg ataaactgtt ggtggcgacc ggccgtaccc 2160

cgaatacacg ttctctggca ctggatgcag caggtgtgac agttaatgcg cagggtgcca 2220

ttgtgattga tcagggtatg cgcacaagca atccgaatat ttatgcggcc ggtgattgta 2280

ctgatcagcc gcagtttgtg tatgttgcgg cagcggcagg cacccgcgcc gcaattaata 2340

tgaccggtgg tgatgctgcg ctggatctga ccgcaatgcc ggccgtggtg tttaccgatc 2400

cgcaggttgc gacagttggt tatagtgaag cggaagcaca tcatgatgga attgaaaccg 2460

atagccgcac cctgaccctg gataatgtac cgcgtgcact ggctaatttt gatacacgcg 2520

gttttattaa actggtgatt gaagaaggct cacatcgtct gattggtgtg caggcagttg 2580

ccccggaagc aggtgaactg attcagaccg cagcactggc tattcgtaat cgtatgaccg 2640

tgcaggaact ggcagatcag ctgtttccgt atctgaccat ggtggaaggc ctgaaactgg 2700

cggcacagac ctttaataaa gatgttaaac agctgagctg ttgtgccggt taaactagt 2759

Claims

1. the bioengineered strain for restoring dimercurion, which is characterized in that the bioengineered strain contains expression vector, should Expression vector is merR op-ompA-merA-pSB1A2 comprising recombination merR op-ompA-merA and pSB1A2 matter Grain skeleton.

2. as described in claim 1 for restoring the preparation method of the bioengineered strain of dimercurion, which is characterized in that packet Include following steps:

Step 1: the amplification of merR op, ompA, merA genetic fragment are realized respectively using pcr amplification reaction, after amplification MerR op genetic fragment is connected with ompA genetic fragment by overlap extension pcr, and is realized and expanded by pcr amplification reaction Increase, obtains target gene fragment merR op-ompA；

Step 2: using restriction enzyme XbaI and SpeI to pSB1A2 plasmid backbone and target gene fragment merR op- OmpA carries out double digestion, makes target gene fragment merR op-ompA and pSB1A2 plasmid backbone while exposing identical viscosity end End, is connected target gene fragment merR op-ompA with pSB1A2 plasmid backbone by T4 DNA ligase, realizes merR The building of op-ompA-pSB1A2 plasmid；

Step 3: using restriction enzyme SpeI to the merA gene piece after merR op-ompA-pSB1A2 plasmid and amplification Duan Jinhang single endonuclease digestion, then the merA genetic fragment with T4 DNA ligase by merR op-ompA-pSB1A2 plasmid and after expanding The building of expression vector merR op-ompA-merA-pSB1A2 is completed in connection；

Step 4: expression vector merR op-ompA-merA-pSB1A2 is converted to competent cell by chemical transformation It is interior, obtain the bioengineered strain.

3. as claimed in claim 2 for restoring the preparation method of the bioengineered strain of dimercurion, which is characterized in that step Target gene fragment merR op-ompA in rapid one is obtained especially by following methods: respectively with fully synthetic merR op, OmpA, merA gene order are template, carry out first time pcr amplification reaction, then by merR op and ompA the gene piece after amplification The complementary fragment of section end realizes the connection of merR op and ompA by overlap extension pcr, obtains junction fragment merR Op-ompA carries out second of pcr amplification reaction, realizes the amplification of junction fragment merR op-ompA, obtains target gene fragment merR op-ompA。

4. as claimed in claim 2 for restoring the preparation method of the bioengineered strain of dimercurion, which is characterized in that step Competent cell in rapid four is E.coli DH5 α competent cell.

5. as claimed in claim 3 for restoring the preparation method of the bioengineered strain of dimercurion, which is characterized in that the When pcr amplification reaction, it includes ImeR-OP XF, OP-ompA UP that merR op, which needs the primer being added, and ompA needs to be added Primer include OP-ompA DN, OmpA SR, it includes MerA SF, MerA SR that merA, which needs the primer being added,；Second of PCR The primer that amplified reaction is added includes IMerR-OP XF and OmpA SR.

6. as claimed in claim 2 for restoring the preparation method of the bioengineered strain of dimercurion, which is characterized in that step Reaction temperature when carrying out double digestion in rapid two is 37 DEG C, reaction time 1h.

7. as claimed in claim 2 for restoring the preparation method of the bioengineered strain of dimercurion, which is characterized in that step Reaction temperature when carrying out single endonuclease digestion in rapid three is 37 DEG C, reaction time 1h.

8. as claimed in claim 3 for restoring the preparation method of the bioengineered strain of dimercurion, which is characterized in that the Pcr amplification reaction includes 30 circulations, wherein a circulation successively includes 98 DEG C of denaturation 10s, 55 DEG C of annealing 10s, 72 DEG C Extend 5s；Second of pcr amplification reaction includes 30 circulations, wherein a circulation is successively moved back including 98 DEG C of denaturation 10s, 55 DEG C Fiery 10s, 72 DEG C of extension 10s.

9. as described in claim 1 for restoring the purposes of the bioengineered strain of dimercurion, which is characterized in that the biology Engineering bacteria is used to administer Hg (II) pollution in water environment.

10. as claimed in claim 9 for restoring the purposes of the bioengineered strain of dimercurion, which is characterized in that by this Bioengineered strain investment has in the water environment of Hg (II) pollution, and Hg (II) is reduced to Hg (0), realizes the improvement of water environment.