CN108957001A - Aptamer elisa kit for detecting and preparation method and applications - Google Patents
Aptamer elisa kit for detecting and preparation method and applications Download PDFInfo
- Publication number
- CN108957001A CN108957001A CN201810677985.XA CN201810677985A CN108957001A CN 108957001 A CN108957001 A CN 108957001A CN 201810677985 A CN201810677985 A CN 201810677985A CN 108957001 A CN108957001 A CN 108957001A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- gold nano
- nucleic acid
- nano grain
- plate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/535—Production of labelled immunochemicals with enzyme label or co-enzymes, co-factors, enzyme inhibitors or enzyme substrates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
- G01N33/54346—Nanoparticles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/475—Assays involving growth factors
- G01N2333/485—Epidermal growth factor [EGF] (urogastrone)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nanotechnology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to aptamer elisa kit for detecting and preparation method and its usages, the aptamer elisa kit for detecting, including aptamer plate, negative control, positive control, sample diluting liquid, enzyme labelled antibody, cleaning solution, developing solution A&B, terminate liquid and sealed membrane；Wherein, aptamer plate is the aptamer modified elisa plate of VEGF nucleic acid；Enzyme labelled antibody is horseradish peroxidase-labeled vascular endothelial growth factor monoclonal antibody.Aptamer elisa kit for detecting of the invention have the advantages that result stablize accurate, high specificity, high sensitivity, it is easy to use, cheap, convenient for promoting.
Description
Technical field
The elisa kit for detecting of the present invention relates to a kind of human vascular endothelial growth factor (VEGF) based on aptamer
And its preparation.
Background technique
Nineteen ninety, Harvard University doctor Folkman propose that famous Folkman is theoretical, tumor tissue growth, it is necessary to
It is generated by new vessels and provides enough oxygen and nutriment to maintain.Hanahan and Weinberg is in Cell within 2000
Tumour cell is reviewed with six kinds of acquisition sexualities, and lists respective mechanism, wherein also referring to " continue blood vessel
Generation is the one of the important signs that of tumour ".And vascular endothelial growth factor (vascular endothelial growth
Factor, VEGF) it is one of most effective angiogenesis factor, Human Umbilical Vein Endothelial Cells have specific splitting ability.VEGF is high
The conservative homodimer glycoprotein of degree.Two molecular weight are respectively that the single-stranded of 24kDa forms dimer with disulfide bond.Wherein
VEGF121, VEGF145, VEGF165 are secreting type soluble proteins, and it is intravascular to directly act on vascular endothelial cell promotion
Epithelial cell proliferation increases vasopermeability.
General tumor patient has all arrived middle and advanced stage when making a definite diagnosis, and early screening simultaneously examines suspicious patient or asymptomatic patient in time
It is disconnected, the survival rate of tumor patient can be improved, extend life span.Early discovery and early treatment are the significances of tumor screening.
Tumor cells diagnostic reagent is used as the detection of gene mutation site more, and the tumour cell generation of variation can measure.But part is just
There is tumour cell in a dormant state in ordinary person group, some dormant periods are 10 years, and measuring can not make a definite diagnosis at this time, can only
It is assessed as cancer risk, does not have screening meaning, and very big suffering can be generated to screening object.At present in the tumour of application
The marker overwhelming majority corresponds to 1-3 kind tumour, and specificity is mostly 75% or so, sensibility multiselect in 30%-90%, screening
Several frequently seen tumor markers composition combined health checkup services are selected, screening broad spectrum activity is not enough and Expenses of laboratory examination is higher.VEGF is considered as
The marker of most significant neoplastic hematologic disorder screening.VEGF can the nearly all entity tumor of screening, its broad spectrum activity is other inspections
It is irreplaceable to survey index.In addition, VEGF participates in the morbidity and its progress of many angiogenesis-dependent diseases, in addition to cancer
It outside, further include certain inflammatory diseases (such as rheumatoid arthritis) and diabetic retinopathy.
The detection of serum VEGF at present mainly have based on antigen-antibody identification enzyme-linked immunization (ELISA), immune radiating
Method (IRMA).Due to being limited by antibody, the sensitivity of ELISA is not high, and detection range is limited, and IRMA kit is by isotope half
Decline the influence of phase, and validity period is short, clinically can only manual operations, heavy workload but also be also easy to produce human error, in addition there are
Certain radioactive pollution.In order to improve the detection sensitivity of serum VEGF, the country has company to use vegf receptor and Dan Ke
Grand antibody is fixed on ELISA Plate simultaneously, is improved sensitivity with this capture rate for increasing VEGF and is reached (the Beijing strong flat nine pg/ml
Star biological medicine Science and Technology Ltd.), however expensive vegf receptor greatly improves kit price.In addition, also there is text
Offer report using multistep method for amplifying signal improve sensitivity (Biosensors and Bioelectronics, 2016,86,
990–995；Biosensors and Bioelectronics, 2017,89,964-969), but because operating process is complicated, nothing
Method realizes kit production clinically.Therefore, develop a kind of simple and quick, high sensitivity, it is cheap, be easy to be fabricated to
The VEGF method of clinical detection reagent box is of great significance in clinical diagnosis.
Summary of the invention
The purpose of the present invention is in order to solve the above problem at least one, the present invention provides a kind of people based on aptamer
The ELISA detection kit of vascular endothelial growth factor (VEGF).There is the kit result to stablize accurate, high specificity, spirit
The advantages of sensitivity is high, easy to use, cheap, convenient for promoting.
According to an aspect of the present invention, a kind of aptamer elisa kit for detecting, including aptamer plate, yin are provided
Property control, positive control, sample diluting liquid, enzyme labelled antibody, cleaning solution, developing solution A&B, terminate liquid and sealed membrane.
Wherein, aptamer plate is the aptamer modified elisa plate of VEGF nucleic acid；Enzyme labelled antibody is horseradish peroxidase mark
Remember vascular endothelial growth factor monoclonal antibody.
Wherein, positive control is human vascular endothelial growth factor protein freeze-dried powder；Negative control is animal blood serum jelly
Dry powder.
Wherein, sample diluting liquid includes 20mM Tris-HCl, 0.1%Tween, 200mM NaCl, 10mM KCl, and 0.2%
BSA and 0.05% thimerosal, pH7.4；Concentrated cleaning solution includes 200mM Tris-HCl, 1%Tween, 2M NaCl and 100mM
KCl, pH 7.4.
Wherein, in developing solution A&B, developing solution A includes H2O2, developing solution B includes 3,3',5,5'-tetramethylbenzidine
(TMB)；Terminate liquid includes 2M sulfuric acid.
According to the second aspect of the invention, the preparation method of the aptamer elisa kit for detecting is provided, including following
Step:
A. gold nano grain is prepared；
B. using gold nano grain as carrier, gold nano grain surface first is arrived by aptamer modified；
C. the gold nano grain for being modified with VEGF nucleic acid aptamer is fixed on solid support elisa plate, with envelope
Fluid-tight is closed to close to form the aptamer plate；
D. negative control, positive control, sample diluting liquid, enzyme labelled antibody, cleaning solution, developing solution A&B, terminate liquid are prepared.
Wherein, in step c, gold nano grain is fixed by way of biotin and Avidin interaction, or logical
It crosses in the fixed either direct coated to elisa plate of mode of double-stranded DNA hybridization.
The aptamer elisa kit for detecting is provided according to the third aspect of the invention we in the application of serum context of detection.
The invention has the following advantages:
1, this kit is using the aptamer of VEGF instead of antibody.Compared with antibody, aptamer by sieving in vitro
Choosing, not against animal, cell and interior environment, is easy to get, and prepares, modifies fast and easy, no differences between batches are suitable for extensive
Production, save the cost, chemical stability is good, is convenient for long-term preservation.
2, more VEGF nucleic acid aptamers are loaded using the extra specific surface area of gold nano grain.Made using gold nano grain
It is coated on ELISA Plate again for VEGF nucleic acid aptamer carrier, than directly VEGF nucleic acid aptamer is coated with to can be bigger on ELISA Plate
Improve unit area on aptamer constant density, and spatially guarantee aptamer three-dimensional conformation, to mention
The capture rate of high target protein.
3, the VEGF in this kit detection biological samples is preferred from cancer, intraocular new blood vessel syndrome (as being proliferated
Property retinopathy or age-related macular degeneration), the sample of rheumatoid arthritis or other diseases patient.
Detailed description of the invention
By reading the following detailed description of the preferred embodiment, various other advantages and benefits are common for this field
Technical staff will become clear.The drawings are only for the purpose of illustrating a preferred embodiment, and is not considered as to the present invention
Limitation.And throughout the drawings, the same reference numbers will be used to refer to the same parts.In the accompanying drawings:
Fig. 1 shows the testing principle signal of the elisa kit for detecting of the aptamer of embodiment according to the present invention
Figure；
Fig. 2 shows the tests of the detection sensitivity of the elisa kit for detecting of the aptamer of embodiment according to the present invention
Comparative result figure；
Fig. 3 shows the detection sensitivity test of the elisa kit for detecting of the aptamer of embodiment according to the present invention
Comparative result figure；
Fig. 4 shows the detection sensitivity test of the elisa kit for detecting of the aptamer of embodiment according to the present invention
Comparative result figure；
Fig. 5 shows the detection sensitivity test of the elisa kit for detecting of the aptamer of embodiment according to the present invention
Comparative result figure.
Specific embodiment
The illustrative embodiments of the disclosure are more fully described below with reference to accompanying drawings.Although showing this public affairs in attached drawing
The illustrative embodiments opened, it being understood, however, that may be realized in various forms the disclosure without the reality that should be illustrated here
The mode of applying is limited.It is to be able to thoroughly understand the disclosure on the contrary, providing these embodiments, and can be by this public affairs
The range opened is fully disclosed to those skilled in the art.
The VEGF nucleic acid aptamer sequence used is V1, V2,3R02,3R02-3R02, these sequences derive from document report
And some changes are carried out, repetition base is primarily introduced into as connector.Wherein sequence V1 (Molecules, 2010,15,215-
It 225) is to be combined with the receptor-binding domain (RBD) of VEGF, with VEGF165In conjunction with KdFor 20nM；V2
(PlosOne, 2012,7, e31196) is combined with the heparin-binding domain (HBD) of VEGF, with VEGF165In conjunction with
KdFor 0.5nM；Sequence 3R02 and sequence 3R02-3R02 (Anal.Chem.2013,85,1132-1137) be be with
The receptor-binding domain (RBD) of VEGF is combined, with VEGF165In conjunction with KdRespectively 300pM and 30pM.More than
The selection of sequence is that kit in order to better illustrate the present invention is of universal significance in aptamer selection, the choosing of aptamer
Select any binding site that can be in conjunction with VEGF, the affinity of aptamer and VEGF can be within the scope of nM~pM, suitable
For this kit.But it is not limited to described four kinds of sequences.
1 aptamer elisa kit for detecting of embodiment
Including consisting of:
VEGF nucleic acid aptamer plate；
Positive control: people's vegf protein freeze-dried powder；
Negative control: animal blood serum freeze-dried powder；
Sample diluting liquid: 20mM Tris-HCl+0.1%Tween+200mM NaCl+10mM KCl+0.2%BSA,
PH7.4,1 bottle
Enzyme labelled antibody: the anti-VEGF mAb of horseradish peroxidase-labeled, 1 bottle
Concentrated cleaning solution: 7.4,1 bottle of 200mM Tris-HCl+1%Tween+2M NaCl+100mM KCl, pH
Developing solution A&B:A liquid be H2O2, B liquid be 3,3',5,5'-tetramethylbenzidine (TMB), each 1 bottle of A&B liquid
Terminate liquid: 2M sulfuric acid, 1 bottle
Sealed membrane 2 is opened.
Various amount of substance described in this example are calculated with the example that elisa plate is 96 holes (12 8 holes or 8 12 holes), if
The hole count of elisa plate is more or less than 96 holes, then each amount of substance is also corresponding more or less.
2 aptamer elisa kit for detecting VEGF nucleic acid aptamer plate preparation method of embodiment
The preparation of 2.1 gold nano grains
(1) 100mL 1mM HAuCl4 solution is added in double-neck flask, flask is placed on stirring on electric hot plate until returning
Stream；
(2) after solution starts reflux, plug is opened, 10mL 38.8mM sodium citrate is rapidly joined, covers plug, it is molten
The color of liquid becomes peony from light yellow in 1min, continues the 20min that flows back；
(3) stop heating, be cooled to room temperature system under stiring；
(4) synthetic gold nano grain is sealed in 4 DEG C of refrigerators.
The synthesis of 2.2VEGF aptamer modified gold nano grain
The VEGF nucleic acid aptamer sequence of label are as follows: T8-3R02SH-TTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC
The short chain single-stranded DNA spacer body SH-T of one end marking sulfhydryl12Sequence are as follows: SH-TTT TTT TTT TTT.
The short chain single-stranded DNA spacer body SH-p1 sequence of one end marking sulfhydryl are as follows: SH-
AAAAAAAAAACAAAGTAGTCGAGGCCCCGGCGTG；The sequence of the biotin labeling complementary with SH-p1 is biotin-2 tool
Body sequence are as follows: biotin-AAAAA CACGCCGGGGCCTCGACTACTTTG.
The short chain single-stranded DNA spacer body SH-T of one end marking sulfhydryl one end biotin labeling12- biotin, particular sequence are as follows:
SH-TTT TTT TTT TTT-biotin。
2.2.1VEGF the gold nano that the short chain single-stranded DNA spacer body of aptamer and one end marking sulfhydryl is modified jointly
The synthesis of grain
By 10-5The VEGF nucleic acid aptamer of M marking sulfhydryl and short chain single stranded DNA (such as SH-T of one end marking sulfhydryl12Or SH-
P1) mixing (molar ratio is 50:1~1:50, preferably 3:1) is added in gold nano grain afterwards, by adding salt to be aged to obtain VEGF core
The aptamer modified gold nano grain of acid, centrifuge separation discard supernatant, and PBS dissolution precipitating are added, 4 degree are kept in dark place.
2.2.2VEGF the synthesis for the gold nano grain that the PEG interval body of aptamer and one end marking sulfhydryl is modified jointly
By 10-5The PEG of the VEGF nucleic acid aptamer of M marking sulfhydryl and one end marking sulfhydryl mixing (molar ratio is 50:1~1:
50, preferably 3:1) it is added in gold nano grain afterwards, by adding salt to be aged to obtain the aptamer modified gold nano grain of VEGF nucleic acid, from
Heart separation, discards supernatant, and PBS dissolution precipitating is added, 4 degree are kept in dark place.
2.2.3VEGF the short chain single-stranded DNA spacer body of aptamer and one end marking sulfhydryl one end biotin labeling is common
The synthesis of the gold nano grain of modification
By 10-5The VEGF nucleic acid aptamer of M marking sulfhydryl and the short chain single stranded DNA of one end marking sulfhydryl one end biotin labeling
(such as SH-T12) (molar ratio is added in gold nano grain afterwards for 50:1~1:50, preferably 3:1), by adding salt to be aged to obtain for mixing
The aptamer modified gold nano grain of VEGF nucleic acid, centrifuge separation, discards supernatant, and PBS dissolution precipitating is added, 4 degree are kept in dark place.
2.2.4VEGF the gold that the PEG interval body of aptamer and one end marking sulfhydryl one end biotin labeling is modified jointly
The synthesis of nano particle
By 10-5The PEG mixing of the VEGF nucleic acid aptamer and one end marking sulfhydryl one end biotin labeling of M marking sulfhydryl (rubs
You are than being 50:1~1:50, preferably 3:1) be added in gold nano grain afterwards, by add salt be aged to obtain VEGF nucleic acid it is aptamer modified
Gold nano grain, centrifuge separation, discard supernatant, be added PBS dissolution precipitating, 4 degree are kept in dark place.
The preparation of 2.3VEGF aptamer plate
A. VEGF nucleic acid aptamer plate of the invention citing can be is fixed on ELISA Plate by coating mode.Work as interval body
When using unrelated short chain single stranded DNA or polyethylene glycol (PEG), it can be used by coating mode that VEGF nucleic acid is aptamer modified
Gold nano grain be fixed to ELISA Plate on.
Method particularly includes: by the coating buffer dilution one of the VEGF nucleic acid being prepared aptamer modified gold nano grain
Fixed multiple, every hole are added 100ul, and 4 degree coatings are overnight or to 48h；Every hole is added PBST and washed once, and adds confining liquid,
It is placed at room temperature for 10 minutes.Confining liquid mainly contains BSA and some buffers；Confining liquid is discarded, is patted dry；It is carried out with vacuum packing machine
Packaging.Wherein PEG can use long-chain (such as PEG1000, can purchase from overgrown with weeds lake PengSheng Biotechnology Co., Ltd) or short chain (such as PEG4,
Commercially available certainly overgrown with weeds lake PengSheng Biotechnology Co., Ltd).
B. VEGF nucleic acid aptamer plate of the invention citing can be is consolidated by way of biotin and Avidin interaction
Determine onto Avidin or the coated ELISA Plate of Streptavidin.When interval body uses one end sulfydryl modification, other end biotin is repaired
Short chain single stranded DNA (such as SH-T of decorations12- biotin) or PEG is (such as
SH-PEG1000- biotin) when, which can be used and be fixed to the aptamer modified gold nano grain of VEGF nucleic acid
On ELISA Plate.
Method particularly includes: by the coating buffer dilution one of the VEGF nucleic acid being prepared aptamer modified gold nano grain
Fixed multiple, every hole 100ul are added on the coated ELISA Plate of Streptavidin (commercially available from pierce company) 4 degree of reactions
24h-48h.Every hole is added PBST and washed once, and pats dry.It is packed with vacuum packing machine.
C. VEGF nucleic acid aptamer plate of the invention citing, which can be, is fixed with list in such a way that double-stranded DNA hybridizes
On the ELISA Plate of chain complementary DNA.When interval body uses short chain single stranded DNA, which can be used VEGF nucleic acid is aptamer modified
Gold nano grain be fixed to ELISA Plate on.Method particularly includes: first prepare VEGF nucleic acid aptamer and short chain DNA (such as SH- of interval body
P1 the gold nano grain) modified jointly；Then the DNA (such as biotin-p2) of the biotin modification complementary with SH-p1 is added to
On Streptavidin plate, 37 degree of reactions 0.2h-2h, preferably 1h.Every hole is added PBST and washed once, and pats dry, and obtains being fixed with mutually
Mend the ELISA Plate of DNA；The VEGF nucleic acid being prepared aptamer modified gold nano grain hybridization buffer is diluted centainly
Multiple, every hole 100ul are added on the ELISA Plate for being fixed with complementary DNA.37 degree of reactions 0.5h-2.5h, preferably 2h.Every hole is added
PBST washed once, and pat dry.It is packed with vacuum packing machine.It is fixed with the ELISA Plate of complementary DNA, then by the way that biology will be had
On the complementary DNA and Avidin or the coated ELISA Plate of Streptavidin of element modification (commercially available from pierce company), 37 degree anti-
0.5-2.5h, preferably 1h is answered to obtain.
Complementary DNA (such as biotin-p2) is complementary with interval body short chain single stranded DNA (such as SH-p1), can be in sequence selection
It is replaced with other two complementary DNA chain, it is only necessary to which stable double-stranded DNA can be formed at normal temperature by saving selected sequence
(such as Tm value is greater than 40 DEG C), and combined with the aptamer of VEGF without obvious.
Embodiment 2-1 aptamer elisa kit for detecting VEGF nucleic acid aptamer plate preparation method
2-1.1 the preparation of gold nano grain
(1) 100mL 1mM HAuCl4 solution is added in double-neck flask, flask is placed on stirring on electric hot plate until returning
Stream；
(2) after solution starts reflux, plug is opened, 10mL 38.8mM sodium citrate is rapidly joined, covers plug, it is molten
The color of liquid becomes peony from light yellow in 1min, continues the 20min that flows back；
(3) stop heating, be cooled to room temperature system under stiring；
(4) synthetic gold nano grain is sealed in 4 DEG C of refrigerators.
The synthesis of 2-1.2VEGF aptamer modified gold nano grain
The VEGF nucleic acid aptamer sequence of label are as follows: T8-3R02-3R02SH-
TTTTTTTTTGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC
The short chain single-stranded DNA spacer body SH-T of one end marking sulfhydryl12Sequence are as follows: SH-TTT TTT TTT TTT.
The short chain single-stranded DNA spacer body SH-p1 sequence of one end marking sulfhydryl are as follows: SH-
AAAAAAAAAACAAAGTAGTCGAGGCCCCGGCGTG；The sequence of the biotin labeling complementary with SH-p1 is biotin-2 tool
Body sequence are as follows: biotin-AAAAA CACGCCGGGGCCTCGACTACTTTG.
The short chain single-stranded DNA spacer body SH-T of one end marking sulfhydryl one end biotin labeling12- biotin, particular sequence are as follows:
SH-TTT TTT TTT TTT-biotin。
The gold nano that the short chain single-stranded DNA spacer body of 2-1.2.1VEGF aptamer and one end marking sulfhydryl is modified jointly
The synthesis of particle
By 10-5The VEGF nucleic acid aptamer of M marking sulfhydryl and short chain single stranded DNA (such as SH-T of one end marking sulfhydryl12Or SH-
P1) mixing (molar ratio is 50:1~1:50, preferably 3:1) is added in gold nano grain afterwards, by adding salt to be aged to obtain VEGF core
The aptamer modified gold nano grain of acid, centrifuge separation discard supernatant, and PBS dissolution precipitating are added, 4 degree are kept in dark place.
The conjunction for the gold nano grain that the PEG interval body of 2-1.2.2VEGF aptamer and one end marking sulfhydryl is modified jointly
At
By 10-5The PEG of the VEGF nucleic acid aptamer of M marking sulfhydryl and one end marking sulfhydryl mixing (molar ratio is 50:1~1:
50, preferably 3:1) it is added in gold nano grain afterwards, by adding salt to be aged to obtain the aptamer modified gold nano grain of VEGF nucleic acid, from
Heart separation, discards supernatant, and PBS dissolution precipitating is added, 4 degree are kept in dark place.
The short chain single-stranded DNA spacer body of 2-1.2.3VEGF aptamer and one end marking sulfhydryl one end biotin labeling is total
With the synthesis of the gold nano grain of modification
By 10-5The VEGF nucleic acid aptamer of M marking sulfhydryl and the short chain single stranded DNA of one end marking sulfhydryl one end biotin labeling
(such as SH-T12) (molar ratio is added in gold nano grain afterwards for 50:1~1:50, preferably 3:1), by adding salt to be aged to obtain for mixing
The aptamer modified gold nano grain of VEGF nucleic acid, centrifuge separation, discards supernatant, and PBS dissolution precipitating is added, 4 degree are kept in dark place.
What the PEG interval body of 2-1.2.4VEGF aptamer and one end marking sulfhydryl one end biotin labeling was modified jointly
The synthesis of gold nano grain
By 10-5The PEG mixing of the VEGF nucleic acid aptamer and one end marking sulfhydryl one end biotin labeling of M marking sulfhydryl (rubs
You are than being 50:1~1:50, preferably 3:1) be added in gold nano grain afterwards, by add salt be aged to obtain VEGF nucleic acid it is aptamer modified
Gold nano grain, centrifuge separation, discard supernatant, be added PBS dissolution precipitating, 4 degree are kept in dark place.
The preparation of 2-1.3VEGF aptamer plate
A. VEGF nucleic acid aptamer plate of the invention citing can be is fixed on ELISA Plate by coating mode.Work as interval body
When using unrelated short chain single stranded DNA or polyethylene glycol (PEG), it can be used by coating mode that VEGF nucleic acid is aptamer modified
Gold nano grain be fixed to ELISA Plate on.
Method particularly includes: by the coating buffer dilution one of the VEGF nucleic acid being prepared aptamer modified gold nano grain
Fixed multiple, every hole are added 100ul, and 4 degree coatings are overnight or to 48h；Every hole is added PBST and washed once, and adds confining liquid,
It is placed at room temperature for 10 minutes.Confining liquid mainly contains BSA and some buffers；Confining liquid is discarded, is patted dry；It is carried out with vacuum packing machine
Packaging.Wherein PEG can use long-chain (such as PEG1000, can purchase from overgrown with weeds lake PengSheng Biotechnology Co., Ltd) or short chain (such as PEG4,
Commercially available certainly overgrown with weeds lake PengSheng Biotechnology Co., Ltd).(please two kinds of interval bodies of marking sulfhydryl, that is, unrelated short chain is single-stranded here
The structure or preparation method of DNA and PEG1000, so as to corresponding with the IA of Fig. 2 and IB)
B. VEGF nucleic acid aptamer plate of the invention citing can be is consolidated by way of biotin and Avidin interaction
Determine onto Avidin or the coated ELISA Plate of Streptavidin.When interval body uses one end sulfydryl modification, other end biotin is repaired
Short chain single stranded DNA (such as SH-T of decorations12- biotin) or PEG (such as SH-PEG1000- biotin) when, which can be used will
The aptamer modified gold nano grain of VEGF nucleic acid is fixed on ELISA Plate.
Method particularly includes: by the coating buffer dilution one of the VEGF nucleic acid being prepared aptamer modified gold nano grain
Fixed multiple, every hole 100ul are added on the coated ELISA Plate of Streptavidin and (buy from pierce company).4 degree of reactions
24h-48h.Every hole is added PBST and washed once, and pats dry.It is packed with vacuum packing machine.
C. VEGF nucleic acid aptamer plate of the invention citing, which can be, is fixed with list in such a way that double-stranded DNA hybridizes
On the ELISA Plate of chain complementary DNA.When interval body uses short chain single stranded DNA, which can be used VEGF nucleic acid is aptamer modified
Gold nano grain be fixed to ELISA Plate on.Method particularly includes: first prepare VEGF nucleic acid aptamer and short chain DNA (such as SH- of interval body
P1 the gold nano grain) modified jointly；Then the DNA (such as biotin-p2) of the biotin modification complementary with SH-p1 is added to
On Streptavidin plate, 37 degree of reactions 0.2h-2h, preferably 1h.Every hole is added PBST and washed once, and pats dry, and obtains being fixed with mutually
Mend the ELISA Plate of DNA；The VEGF nucleic acid being prepared aptamer modified gold nano grain hybridization buffer is diluted centainly
Multiple, every hole 100ul are added on the ELISA Plate for being fixed with complementary DNA.Complementary DNA (such as biotin-p2) and the short chain of interval body
Single stranded DNA (such as SH-p1) is complementary, can be replaced with other two complementary DNA chain in sequence selection, it is only necessary to save
Selected sequence can form stable double-stranded DNA (such as Tm value is greater than 40 DEG C) at normal temperature, and with the aptamer of VEGF without bright
It is aobvious to combine.37 degree of reactions 0.5h-2.5h, preferably 2h.Every hole is added PBST and washed once, and pats dry.With vacuum packing machine into
Row packaging.It is fixed with the ELISA Plate of complementary DNA, then by the way that complementary DNA and Avidin or the strepto- parent of biotin modification will be had
With (commercially available from pierce company) on the coated ELISA Plate of element, 37 degree of reaction 0.5-2.5h, preferably 1h are obtained.
Embodiment 2-2 aptamer elisa kit for detecting VEGF nucleic acid aptamer plate preparation method
2-2.1 the preparation of gold nano grain
(1) 100mL 1mM HAuCl4 solution is added in double-neck flask, flask is placed on stirring on electric hot plate until returning
Stream；
(2) after solution starts reflux, plug is opened, 10mL 38.8mM sodium citrate is rapidly joined, covers plug, it is molten
The color of liquid becomes peony from light yellow in 1min, continues the 20min that flows back；
(3) stop heating, be cooled to room temperature system under stiring；
(4) synthetic gold nano grain is sealed in 4 DEG C of refrigerators.
The synthesis of 2-2.2VEGF aptamer modified gold nano grain
The VEGF nucleic acid aptamer sequence of label are as follows: T8-V1
SH-TTTTTTTT TGTGGGGGTGGACGGGCCGGGTAGA
The short chain single-stranded DNA spacer body SH-T of one end marking sulfhydryl12Sequence are as follows: SH-TTT TTT TTT TTT.
The short chain single-stranded DNA spacer body SH-p1 sequence of one end marking sulfhydryl are as follows: SH-
AAAAAAAAAACAAAGTAGTCGAGGCCCCGGCGTG；The sequence of the biotin labeling complementary with SH-p1 is biotin-2 tool
Body sequence are as follows: biotin-AAAAA CACGCCGGGGCCTCGACTACTTTG.
The short chain single-stranded DNA spacer body SH-T of one end marking sulfhydryl one end biotin labeling12- biotin, particular sequence are as follows:
SH-TTT TTT TTT TTT-biotin。
The gold nano that the short chain single-stranded DNA spacer body of 2-2.2.1VEGF aptamer and one end marking sulfhydryl is modified jointly
The synthesis of particle
By 10-5The VEGF nucleic acid aptamer of M marking sulfhydryl and short chain single stranded DNA (such as SH-T of one end marking sulfhydryl12Or SH-
P1) mixing (molar ratio is 50:1~1:50, preferably 3:1) is added in gold nano grain afterwards, by adding salt to be aged to obtain VEGF core
The aptamer modified gold nano grain of acid, centrifuge separation discard supernatant, and PBS dissolution precipitating are added, 4 degree are kept in dark place.
The conjunction for the gold nano grain that the PEG interval body of 2-2.2.2VEGF aptamer and one end marking sulfhydryl is modified jointly
At
By 10-5The PEG of the VEGF nucleic acid aptamer of M marking sulfhydryl and one end marking sulfhydryl mixing (molar ratio is 50:1~1:
50, preferably 3:1) it is added in gold nano grain afterwards, by adding salt to be aged to obtain the aptamer modified gold nano grain of VEGF nucleic acid, from
Heart separation, discards supernatant, and PBS dissolution precipitating is added, 4 degree are kept in dark place.
The short chain single-stranded DNA spacer body of 2-2.2.3VEGF aptamer and one end marking sulfhydryl one end biotin labeling is total
With the synthesis of the gold nano grain of modification
By 10-5The VEGF nucleic acid aptamer of M marking sulfhydryl and the short chain single stranded DNA of one end marking sulfhydryl one end biotin labeling
(such as SH-T12) (molar ratio is added in gold nano grain afterwards for 50:1~1:50, preferably 3:1), by adding salt to be aged to obtain for mixing
The aptamer modified gold nano grain of VEGF nucleic acid, centrifuge separation, discards supernatant, and PBS dissolution precipitating is added, 4 degree are kept in dark place.
What the PEG interval body of 2-2.2.4VEGF aptamer and one end marking sulfhydryl one end biotin labeling was modified jointly
The synthesis of gold nano grain
By 10-5The PEG mixing of the VEGF nucleic acid aptamer and one end marking sulfhydryl one end biotin labeling of M marking sulfhydryl (rubs
You are than being 50:1~1:50, preferably 3:1) be added in gold nano grain afterwards, by add salt be aged to obtain VEGF nucleic acid it is aptamer modified
Gold nano grain, centrifuge separation, discard supernatant, be added PBS dissolution precipitating, 4 degree are kept in dark place.
The preparation of 2-2.3VEGF aptamer plate
A. VEGF nucleic acid aptamer plate of the invention citing can be is fixed on ELISA Plate by coating mode.Work as interval body
When using unrelated short chain single stranded DNA or polyethylene glycol (PEG), it can be used by coating mode that VEGF nucleic acid is aptamer modified
Gold nano grain be fixed to ELISA Plate on.
Method particularly includes: by the coating buffer dilution one of the VEGF nucleic acid being prepared aptamer modified gold nano grain
Fixed multiple, every hole are added 100ul, and 4 degree coatings are overnight or to 48h；Every hole is added PBST and washed once, and adds confining liquid,
It is placed at room temperature for 10 minutes.Confining liquid mainly contains BSA and some buffers；Confining liquid is discarded, is patted dry；It is carried out with vacuum packing machine
Packaging.Wherein PEG can use long-chain (such as PEG1000, can purchase from overgrown with weeds lake PengSheng Biotechnology Co., Ltd) or short chain (such as PEG4,
Commercially available certainly overgrown with weeds lake PengSheng Biotechnology Co., Ltd).(please two kinds of interval bodies of marking sulfhydryl, that is, unrelated short chain is single-stranded here
The structure or preparation method of DNA and PEG1000, so as to corresponding with the IA of Fig. 2 and IB)
B. VEGF nucleic acid aptamer plate of the invention citing can be is consolidated by way of biotin and Avidin interaction
Determine onto Avidin or the coated ELISA Plate of Streptavidin.When interval body uses one end sulfydryl modification, other end biotin is repaired
Short chain single stranded DNA (such as SH-T of decorations12- biotin) or PEG (such as SH-PEG1000- biotin) when, which can be used will
The aptamer modified gold nano grain of VEGF nucleic acid is fixed on ELISA Plate.
Method particularly includes: by the coating buffer dilution one of the VEGF nucleic acid being prepared aptamer modified gold nano grain
Fixed multiple, every hole 100ul are added on the coated ELISA Plate of Streptavidin and (buy from pierce company).4 degree of reactions
24h-48h.Every hole is added PBST and washed once, and pats dry.It is packed with vacuum packing machine.
C. VEGF nucleic acid aptamer plate of the invention citing, which can be, is fixed with list in such a way that double-stranded DNA hybridizes
On the ELISA Plate of chain complementary DNA.When interval body uses short chain single stranded DNA, which can be used VEGF nucleic acid is aptamer modified
Gold nano grain be fixed to ELISA Plate on.Method particularly includes: first prepare VEGF nucleic acid aptamer and short chain DNA (such as SH- of interval body
P1 the gold nano grain) modified jointly；Then the DNA (such as biotin-p2) of the biotin modification complementary with SH-p1 is added to
On Streptavidin plate, 37 degree of reactions 0.2h-2h, preferably 1h.Every hole is added PBST and washed once, and pats dry, and obtains being fixed with mutually
Mend the ELISA Plate of DNA；The VEGF nucleic acid being prepared aptamer modified gold nano grain hybridization buffer is diluted centainly
Multiple, every hole 100ul are added on the ELISA Plate for being fixed with complementary DNA.Complementary DNA (such as biotin-p2) and the short chain of interval body
Single stranded DNA (such as SH-p1) is complementary, can be replaced with other two complementary DNA chain in sequence selection, it is only necessary to save
Selected sequence can form stable double-stranded DNA (such as Tm value is greater than 40 DEG C) at normal temperature, and with the aptamer of VEGF without bright
It is aobvious to combine.37 degree of reactions 0.5h-2.5h, preferably 2h.Every hole is added PBST and washed once, and pats dry.With vacuum packing machine into
Row packaging.It is fixed with the ELISA Plate of complementary DNA, then by the way that complementary DNA and Avidin or the strepto- parent of biotin modification will be had
With (commercially available from pierce company) on the coated ELISA Plate of element, 37 degree of reaction 0.5-2.5h, preferably 1h are obtained.
Embodiment 2-3 aptamer elisa kit for detecting VEGF nucleic acid aptamer plate preparation method
2-3.1 the preparation of gold nano grain
(1) 100mL 1mM HAuCl4 solution is added in double-neck flask, flask is placed on stirring on electric hot plate until returning
Stream；
(2) after solution starts reflux, plug is opened, 10mL 38.8mM sodium citrate is rapidly joined, covers plug, it is molten
The color of liquid becomes peony from light yellow in 1min, continues the 20min that flows back；
(3) stop heating, be cooled to room temperature system under stiring；
(4) synthetic gold nano grain is sealed in 4 DEG C of refrigerators.
The synthesis of 2-2.2VEGF aptamer modified gold nano grain
The VEGF nucleic acid aptamer sequence of label are as follows: T8-V2
SH-TTTTTTTT CAATTGGGCCCGTCCGTATGGTGGGT
The short chain single-stranded DNA spacer body SH-T of one end marking sulfhydryl12Sequence are as follows: SH-TTT TTT TTT TTT.
The short chain single-stranded DNA spacer body SH-p1 sequence of one end marking sulfhydryl are as follows: SH-
AAAAAAAAAACAAAGTAGTCGAGGCCCCGGCGTG；The sequence of the biotin labeling complementary with SH-p1 is biotin-2 tool
Body sequence are as follows: biotin-AAAAA CACGCCGGGGCCTCGACTACTTTG.
The short chain single-stranded DNA spacer body SH-T of one end marking sulfhydryl one end biotin labeling12- biotin, particular sequence are as follows:
SH-TTT TTT TTT TTT-biotin。
The gold nano that the short chain single-stranded DNA spacer body of 2-3.2.1VEGF aptamer and one end marking sulfhydryl is modified jointly
The synthesis of particle
By 10-5The VEGF nucleic acid aptamer of M marking sulfhydryl and short chain single stranded DNA (such as SH-T of one end marking sulfhydryl12Or SH-
P1) mixing (molar ratio is 50:1~1:50, preferably 3:1) is added in gold nano grain afterwards, by adding salt to be aged to obtain VEGF core
The aptamer modified gold nano grain of acid, centrifuge separation discard supernatant, and PBS dissolution precipitating are added, 4 degree are kept in dark place.
The conjunction for the gold nano grain that the PEG interval body of 2-3.2.2VEGF aptamer and one end marking sulfhydryl is modified jointly
At
By 10-5The PEG of the VEGF nucleic acid aptamer of M marking sulfhydryl and one end marking sulfhydryl mixing (molar ratio is 50:1~1:
50, preferably 3:1) it is added in gold nano grain afterwards, by adding salt to be aged to obtain the aptamer modified gold nano grain of VEGF nucleic acid, from
Heart separation, discards supernatant, and PBS dissolution precipitating is added, 4 degree are kept in dark place.
The short chain single-stranded DNA spacer body of 2-3.2.3VEGF aptamer and one end marking sulfhydryl one end biotin labeling is total
With the synthesis of the gold nano grain of modification
By 10-5The VEGF nucleic acid aptamer of M marking sulfhydryl and the short chain single stranded DNA of one end marking sulfhydryl one end biotin labeling
(such as SH-T12) (molar ratio is added in gold nano grain afterwards for 50:1~1:50, preferably 3:1), by adding salt to be aged to obtain for mixing
The aptamer modified gold nano grain of VEGF nucleic acid, centrifuge separation, discards supernatant, and PBS dissolution precipitating is added, 4 degree are kept in dark place.
What the PEG interval body of 2-3.2.4VEGF aptamer and one end marking sulfhydryl one end biotin labeling was modified jointly
The synthesis of gold nano grain
By 10-5The PEG mixing of the VEGF nucleic acid aptamer and one end marking sulfhydryl one end biotin labeling of M marking sulfhydryl (rubs
You are than being 50:1~1:50, preferably 3:1) be added in gold nano grain afterwards, by add salt be aged to obtain VEGF nucleic acid it is aptamer modified
Gold nano grain, centrifuge separation, discard supernatant, be added PBS dissolution precipitating, 4 degree are kept in dark place.
The preparation of 2-3.3VEGF aptamer plate
A. VEGF nucleic acid aptamer plate of the invention citing can be is fixed on ELISA Plate by coating mode.Work as interval body
When using unrelated short chain single stranded DNA or polyethylene glycol (PEG), it can be used by coating mode that VEGF nucleic acid is aptamer modified
Gold nano grain be fixed to ELISA Plate on.
Method particularly includes: by the coating buffer dilution one of the VEGF nucleic acid being prepared aptamer modified gold nano grain
Fixed multiple, every hole are added 100ul, and 4 degree coatings are overnight or to 48h；Every hole is added PBST and washed once, and adds confining liquid,
It is placed at room temperature for 10 minutes.Confining liquid mainly contains BSA and some buffers；Confining liquid is discarded, is patted dry；It is carried out with vacuum packing machine
Packaging.Wherein PEG can use long-chain (such as PEG1000, can purchase from overgrown with weeds lake PengSheng Biotechnology Co., Ltd) or short chain (such as PEG4,
Commercially available certainly overgrown with weeds lake PengSheng Biotechnology Co., Ltd).(please two kinds of interval bodies of marking sulfhydryl, that is, unrelated short chain is single-stranded here
The structure or preparation method of DNA and PEG1000, so as to corresponding with the IA of Fig. 2 and IB)
B. VEGF nucleic acid aptamer plate of the invention citing can be is consolidated by way of biotin and Avidin interaction
Determine onto Avidin or the coated ELISA Plate of Streptavidin.When interval body uses one end sulfydryl modification, other end biotin is repaired
Short chain single stranded DNA (such as SH-T of decorations12- biotin) or PEG (such as SH-PEG1000- biotin) when, which can be used will
The aptamer modified gold nano grain of VEGF nucleic acid is fixed on ELISA Plate.
Method particularly includes: by the coating buffer dilution one of the VEGF nucleic acid being prepared aptamer modified gold nano grain
Fixed multiple, every hole 100ul are added on the coated ELISA Plate of Streptavidin and (buy from pierce company).4 degree of reactions
24h-48h.Every hole is added PBST and washed once, and pats dry.It is packed with vacuum packing machine.
C. VEGF nucleic acid aptamer plate of the invention citing, which can be, is fixed with list in such a way that double-stranded DNA hybridizes
On the ELISA Plate of chain complementary DNA.When interval body uses short chain single stranded DNA, which can be used VEGF nucleic acid is aptamer modified
Gold nano grain be fixed to ELISA Plate on.Method particularly includes: first prepare VEGF nucleic acid aptamer and short chain DNA (such as SH- of interval body
P1 the gold nano grain) modified jointly；Then the DNA (such as biotin-p2) of the biotin modification complementary with SH-p1 is added to
On Streptavidin plate, 37 degree of reactions 0.2h-2h, preferably 1h.Every hole is added PBST and washed once, and pats dry, and obtains being fixed with mutually
Mend the ELISA Plate of DNA；The VEGF nucleic acid being prepared aptamer modified gold nano grain hybridization buffer is diluted centainly
Multiple, every hole 100ul are added on the ELISA Plate for being fixed with complementary DNA.Complementary DNA (such as biotin-p2) and the short chain of interval body
Single stranded DNA (such as SH-p1) is complementary, can be replaced with other two complementary DNA chain in sequence selection, it is only necessary to save
Selected sequence can form stable double-stranded DNA (such as Tm value is greater than 40 DEG C) at normal temperature, and with the aptamer of VEGF without bright
It is aobvious to combine.37 degree of reactions 0.5h-2.5h, preferably 2h.Every hole is added PBST and washed once, and pats dry.With vacuum packing machine into
Row packaging.It is fixed with the ELISA Plate of complementary DNA, then by the way that complementary DNA and Avidin or the strepto- parent of biotin modification will be had
With (commercially available from pierce company) on the coated ELISA Plate of element, 37 degree of reaction 0.5-2.5h, preferably 1h are obtained.
The application method of 3 aptamer elisa kit for detecting of embodiment
(1) it balances: taking-up kit and sample from cold storage environment, equilibrium at room temperature 30 minutes.From with balance to room temperature
Lath needed for taking out in hermetic bag, other unused lath sealings put back to 4 degree.
(2) match liquid: all reagents should shake up before, and concentrated solution for washing distilled water or deionized water dilute 10 times, such as
Crystallization is generated, should be diluted again after it is in room-temperature dissolution.
(3) be loaded: detection is both needed to setting blank, feminine gender and each 2 hole of positive control every time.The every hole of blank control is added
100uL sample diluting liquid is first added in 200uL sample diluting liquid, other each holes, and then, it is negative that 100uL is added in the every hole of negative control
100uL positive control is added in control, the every hole of positive control, and 100uL sample to be tested is added in remaining each hole, is sealed after mixing with sealed membrane
Lid reaction plate, 37 DEG C oscillation incubation 60 minutes.
(4) board-washing: discarding liquid in hole, pat dry on filter paper, and with dilution cleaning solution board-washing 3 times, each 5min is patted dry.
(5) enzyme labeling antibody: 200uL enzyme labelled antibody is added in every hole, covers reaction plate, 37 DEG C of oscillating reactions 60 with sealed membrane
Minute.
(6) board-washing: discarding liquid in hole, pat dry on filter paper, and with dilution 1 board-washing of cleaning solution 3 times, each 5min is patted dry.
(7) develop the color: each 100uL of color developing agent A&B is added in every hole, covers reaction plate with sealed membrane for 37 DEG C after mixing, is protected from light vibration
Swing reaction 10 minutes.
(8) measure: 50uL terminate liquid is added in every hole, mixes, and microplate reader 450nm and 630nm are used in reaction terminating 10 minutes
(reference wavelength) dual wavelength measures each hole OD value.Fig. 1 is the detection schematic diagram of the elisa kit for detecting.
The sensitivity technique of 4 aptamer elisa kit for detecting of embodiment
Different aptamer plate preparation methods are sensitive to the detection of difference VEGF concentration in Serum System (fetal calf serum FBS)
Degree.
Wherein I group is that ELISA Plate is fixed to by the coating mode of the method a in embodiment 2.3: IA is that interval body uses
Unrelated short chain single stranded DNA；IB is that interval body uses PEG1000。
II group is fixed to strepto- by way of biotin and Avidin interaction for the method b's in embodiment 2.3
On the coated ELISA Plate of Avidin；IIA is the short chain single stranded DNA that interval body uses one end sulfydryl modification one end biotin modification；
IIB is PEG (such as PEG that interval body uses one end sulfydryl modification one end biotin modification1000)。
III group is fixed with single-stranded complementary in such a way that double-stranded DNA hybridizes for the method c's in embodiment 2.3
On the ELISA Plate of DNA.
IV group is directly by the aptamer modified on the coated ELISA Plate of Streptavidin of one end biotin modification.Directly
It connects with biotin modification aptamer method particularly includes: by 100 μ l 10-7The VEGF nucleic acid aptamer of M biotin modification
Biotin-3R02 is added on Streptavidin plate, 37 degree of reactions 0.2h-2h, preferably 1h.Every hole is added PBST and washed once,
It pats dry, obtains the ELISA Plate for being fixed with VEGF nucleic acid aptamer.
V group is the VEGF commercial kit of purchase, and testing principle is antibody as capture molecule and carries out ELISA detection.
The vegf protein of various concentration is detected, all results are shown in Fig. 2.Calculate vegf protein standard items and blank pair
According to OD value and blank control standard deviation, when vegf protein standard items OD value be greater than blank mean value add twice of standard deviation
When, illustrate that kit can detecte the vegf protein standard items of the concentration, minimum concentration is the sensitivity of kit.
Figure it is seen that the sensitivity of control group (IV group) is 100pg/ml, the sensitivity of control group (V group) is
6.5pg/ml, and the aptamer plate of the gold nano particle modification aptamer modified based on VEGF nucleic acid produced by the present invention (I group,
II group and III group) detection sensitivity can reach 3pg/ml, have higher sensitivity.
Sequence T in corresponding embodiment 2-18The experimental result of the aptamer plate of -3R02-3R02 preparation:
Wherein I group is to be fixed to ELISA Plate by the coating mode of the method a in embodiment 2-1.3: IA adopts for interval body
With unrelated short chain single stranded DNA；IB is that interval body uses PEG1000。
II group is fixed to chain by way of biotin and Avidin interaction for the method b's in embodiment 2-1.3
On the mould coated ELISA Plate of Avidin；IIA is that interval body is single-stranded using the short chain of one end sulfydryl modification one end biotin modification
DNA；IIB is PEG (such as PEG that interval body uses one end sulfydryl modification one end biotin modification1000)。
III group is that being fixed in such a way that double-stranded DNA hybridizes for the method c in embodiment 2-1.3 is single-stranded mutual
On the ELISA Plate for mending DNA.
IV group is directly by the aptamer modified on the coated ELISA Plate of Streptavidin of one end biotin modification.Directly
It connects with biotin modification aptamer method particularly includes: by 100 μ l 10-7The VEGF nucleic acid aptamer of M biotin modification
Biotin-3R02 is added on Streptavidin plate, 37 degree of reactions 0.2h-2h, preferably 1h.Every hole is added PBST and washed once,
It pats dry, obtains the ELISA Plate for being fixed with VEGF nucleic acid aptamer；
The vegf protein of various concentration is detected, all results are shown in Fig. 3.Calculate vegf protein standard items and blank pair
According to OD value and blank control standard deviation, when vegf protein standard items OD value be greater than blank mean value add twice of standard deviation
When, illustrate that kit can detecte the vegf protein standard items of the concentration, minimum concentration is the sensitivity of kit.
From figure 3, it can be seen that the sensitivity of control group (IV group) is 100pg/ml, and it is produced by the present invention based on VEGF core
The detection sensitivity of the aptamer plate (I group, II group and III group) of the aptamer modified gold nano particle modification of acid can reach 3pg/
Ml has high sensitivity.
Sequence T in corresponding embodiment 2-28The experimental result of the aptamer plate of-V1 preparation:
Wherein I group is to be fixed to ELISA Plate by the coating mode of the method a in embodiment 2-2.3: IA adopts for interval body
With unrelated short chain single stranded DNA；IB is that interval body uses PEG1000。
II group is fixed to chain by way of biotin and Avidin interaction for the method b's in embodiment 2-2.3
On the mould coated ELISA Plate of Avidin；IIA is that interval body is single-stranded using the short chain of one end sulfydryl modification one end biotin modification
DNA；IIB is PEG (such as PEG that interval body uses one end sulfydryl modification one end biotin modification1000)。
III group is that being fixed in such a way that double-stranded DNA hybridizes for the method c in embodiment 2-2.3 is single-stranded mutual
On the ELISA Plate for mending DNA.
IV group is directly by the aptamer modified on the coated ELISA Plate of Streptavidin of one end biotin modification.Directly
It connects with biotin modification aptamer method particularly includes: by 100 μ l 10-7The VEGF nucleic acid aptamer of M biotin modification
Biotin-3R02 is added on Streptavidin plate, 37 degree of reactions 0.2h-2h, preferably 1h.Every hole is added PBST and washed once,
It pats dry, obtains the ELISA Plate for being fixed with VEGF nucleic acid aptamer；
The vegf protein of various concentration is detected, all results are shown in Fig. 4.Calculate vegf protein standard items and blank pair
According to OD value and blank control standard deviation, when vegf protein standard items OD value be greater than blank mean value add twice of standard deviation
When, illustrate that kit can detecte the vegf protein standard items of the concentration, minimum concentration is the sensitivity of kit.
From fig. 4, it can be seen that the sensitivity of control group (IV group) is 100pg/ml, and it is produced by the present invention based on VEGF core
The detection sensitivity of the aptamer plate (I group, II group and III group) of the aptamer modified gold nano particle modification of acid can reach 3pg/
Ml has high sensitivity.
Sequence T in corresponding embodiment 2-38The experimental result of the aptamer plate of-V2 preparation:
Wherein I group is to be fixed to ELISA Plate by the coating mode of the method a in embodiment 2-3.3: IA adopts for interval body
With unrelated short chain single stranded DNA；IB is that interval body uses PEG1000。
II group is fixed to chain by way of biotin and Avidin interaction for the method b's in embodiment 2-3.3
On the mould coated ELISA Plate of Avidin；IIA is that interval body is single-stranded using the short chain of one end sulfydryl modification one end biotin modification
DNA；IIB is PEG (such as PEG that interval body uses one end sulfydryl modification one end biotin modification1000)。
III group is that being fixed in such a way that double-stranded DNA hybridizes for the method c in embodiment 2-3.3 is single-stranded mutual
On the ELISA Plate for mending DNA.
IV group is directly by the aptamer modified on the coated ELISA Plate of Streptavidin of one end biotin modification.Directly
It connects with biotin modification aptamer method particularly includes: by 100 μ l 10-7The VEGF nucleic acid aptamer of M biotin modification
Biotin-3R02 is added on Streptavidin plate, 37 degree of reactions 0.2h-2h, preferably 1h.Every hole is added PBST and washed once,
It pats dry, obtains the ELISA Plate for being fixed with VEGF nucleic acid aptamer；
The vegf protein of various concentration is detected, all results are shown in Fig. 5.Calculate vegf protein standard items and blank pair
According to OD value and blank control standard deviation, when vegf protein standard items OD value be greater than blank mean value add twice of standard deviation
When, illustrate that kit can detecte the vegf protein standard items of the concentration, minimum concentration is the sensitivity of kit.
From fig. 5, it can be seen that the sensitivity of control group (IV group) is 100pg/ml, and it is produced by the present invention based on VEGF core
The detection sensitivity of the aptamer plate (I group, II group and III group) of the aptamer modified gold nano particle modification of acid can reach 3pg/
Ml has high sensitivity.
The foregoing is only a preferred embodiment of the present invention, but scope of protection of the present invention is not limited thereto,
In the technical scope disclosed by the present invention, any changes or substitutions that can be easily thought of by anyone skilled in the art,
It should be covered by the protection scope of the present invention.Therefore, protection scope of the present invention should be with the protection model of the claim
Subject to enclosing.
Claims (7)
1. a kind of aptamer elisa kit for detecting, which is characterized in that including aptamer plate, negative control, positive control,
Sample diluting liquid, enzyme labelled antibody, cleaning solution, developing solution A&B, terminate liquid and sealed membrane；
Wherein, aptamer plate is the aptamer modified elisa plate of VEGF nucleic acid；
Enzyme labelled antibody is horseradish peroxidase-labeled vascular endothelial growth factor monoclonal antibody.
2. aptamer elisa kit for detecting as described in claim 1, which is characterized in that
Sample diluting liquid includes 20mM Tris-HCl, 0.1%Tween, 200mM NaCl, 10mM KCl, 0.2%BSA and
0.05% thimerosal, pH7.4；
Concentrated cleaning solution includes 200mM Tris-HCl, 1%Tween, 2M NaCl and 100mM KCl, pH 7.4.
3. aptamer elisa kit for detecting as described in claim 1, which is characterized in that
Positive control is human vascular endothelial growth factor protein freeze-dried powder；Negative control is animal blood serum freeze-dried powder.
4. aptamer elisa kit for detecting as described in claim 1, which is characterized in that in developing solution A&B, developing solution A
Including H2O2, developing solution B includes 3,3',5,5'-tetramethylbenzidine (TMB)；Terminate liquid includes 2M sulfuric acid.
5. the preparation method of any aptamer elisa kit for detecting of Claims 1 to 4, which is characterized in that including
Following steps:
A. gold nano grain is prepared；
B. using gold nano grain as carrier, gold nano grain surface first is arrived by aptamer modified；
C. the gold nano grain for being modified with VEGF nucleic acid aptamer is fixed on solid support elisa plate, with confining liquid enclosed shape
At the aptamer plate；
D. negative control, positive control, sample diluting liquid, enzyme labelled antibody, cleaning solution, developing solution A&B, terminate liquid are prepared.
6. preparation method as claimed in claim 5, which is characterized in that
In step c, gold nano grain is fixed by way of biotin and Avidin interaction, or passes through double-stranded DNA
The mode of hybridization fix or direct coated to elisa plate on.
7. aptamer elisa kit for detecting as described in Claims 1 to 4 is any is in the application of serum context of detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810677985.XA CN108957001B (en) | 2018-06-27 | 2018-06-27 | Aptamer elisa kit for detecting and preparation method and applications |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810677985.XA CN108957001B (en) | 2018-06-27 | 2018-06-27 | Aptamer elisa kit for detecting and preparation method and applications |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108957001A true CN108957001A (en) | 2018-12-07 |
| CN108957001B CN108957001B (en) | 2019-11-12 |
Family
ID=64487050
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810677985.XA Active CN108957001B (en) | 2018-06-27 | 2018-06-27 | Aptamer elisa kit for detecting and preparation method and applications |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108957001B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111521602A (en) * | 2020-05-20 | 2020-08-11 | 河南大学 | Detection method of PARP-1 concentration and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1740793A (en) * | 2004-08-25 | 2006-03-01 | 北京健平九星生物医药科技有限公司 | Enzyme-linked assay kit and producing process thereof |
| US20120157670A1 (en) * | 2007-03-01 | 2012-06-21 | United States, As Represented By The Secretary Of The Air Force | Aptamer-based assays |
| CN102854322A (en) * | 2012-07-31 | 2013-01-02 | 吴克 | Vascular endothelial growth factor (VEGF) receptor enzyme linked diagnosis kit and preparation method thereof |
| CN104004763A (en) * | 2014-05-22 | 2014-08-27 | 中国科学院化学研究所 | Nucleic acid aptamer of affinity viral hepatitis C core protein and application of nucleic acid aptamer |
| CN105483132A (en) * | 2014-09-19 | 2016-04-13 | 中国科学院化学研究所 | Aptamer with affinity to viral hepatitis C core antigen and application thereof |
| CN106248960A (en) * | 2016-07-28 | 2016-12-21 | 郑州轻工业学院 | A kind of high-throughput nucleic acid aptamer sensor detecting insulin and preparation method thereof |
-
2018
- 2018-06-27 CN CN201810677985.XA patent/CN108957001B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1740793A (en) * | 2004-08-25 | 2006-03-01 | 北京健平九星生物医药科技有限公司 | Enzyme-linked assay kit and producing process thereof |
| US20120157670A1 (en) * | 2007-03-01 | 2012-06-21 | United States, As Represented By The Secretary Of The Air Force | Aptamer-based assays |
| CN102854322A (en) * | 2012-07-31 | 2013-01-02 | 吴克 | Vascular endothelial growth factor (VEGF) receptor enzyme linked diagnosis kit and preparation method thereof |
| CN104004763A (en) * | 2014-05-22 | 2014-08-27 | 中国科学院化学研究所 | Nucleic acid aptamer of affinity viral hepatitis C core protein and application of nucleic acid aptamer |
| CN105483132A (en) * | 2014-09-19 | 2016-04-13 | 中国科学院化学研究所 | Aptamer with affinity to viral hepatitis C core antigen and application thereof |
| CN106248960A (en) * | 2016-07-28 | 2016-12-21 | 郑州轻工业学院 | A kind of high-throughput nucleic acid aptamer sensor detecting insulin and preparation method thereof |
Non-Patent Citations (7)
| Title |
|---|
| DANIEL W. DROLET: "An enzyme-linked oligonucleotide assay", 《NATURE BIOTECHNOLOGY》 * |
| HARLEEN KAUR,LIN-YUE LANRY YUNG: "Probing high affinity sequences of DNA aptamer against VEGF165", 《PLOS ONE》 * |
| HUIFENG XU: "Highly sensitive antibody-aptamer sensor for vascular endothelial growth factor based on hydridization chain reaction and pH meter/indicator", 《TALANTA》 * |
| SAW YI TOH: "Aptamers as a replacement for antibodies in enzyme-linked immunosorbent assay", 《BIOSENSORS AND BIOELECTRONICS》 * |
| YOSHIHIKO NONAKA等: "Affinity improvement of a VEGF aptamer by in Silico maturation for a sensitive VEGF-detection system", 《ANALYTICAL CHEMISTRY》 * |
| YOSHIHIKO NONAKA等: "Screening and improvement of an anti-VEGF DNA aptamer", 《MOLECULES》 * |
| 张振: "基于核酸适体的丙肝病毒核心蛋白检测新方法", 《中国科学：化学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111521602A (en) * | 2020-05-20 | 2020-08-11 | 河南大学 | Detection method of PARP-1 concentration and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108957001B (en) | 2019-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6653433B2 (en) | Electrochemical biosensor based on nucleic acid aptamer / nano silver probe and EXO I enzyme. | |
| Wu et al. | Ultrasensitive ebola virus detection based on electroluminescent nanospheres and immunomagnetic separation | |
| Wang et al. | Sensitive immunoassay of a biomarker tumor necrosis factor-α based on poly (guanine)-functionalized silica nanoparticle label | |
| CN106199011A (en) | Adiponectin chemiluminescence immune detection reagent kit and its preparation method and application | |
| CN103278623B (en) | A kind of isoenzymes of creatine kinase nano magnetic particulate chemistry electrochemiluminescent immunoassay immue quantitative detection reagent box and preparation method thereof | |
| CN103278651A (en) | Kit for chemiluminescence immunity quantitative detection of MYO (myohaemoglobinnano) nano magnetic particle and preparation method of kit | |
| Wang et al. | Simultaneously fluorescence detecting thrombin and lysozyme based on magnetic nanoparticle condensation | |
| CN104655833A (en) | Enzyme nano composite as well as controllable self-assembly method and application thereof to immunoassay | |
| Leonard et al. | Antibody–Invertase Fusion Protein Enables Quantitative Detection of SARS-CoV-2 Antibodies Using Widely Available Glucometers | |
| CN108957001B (en) | Aptamer elisa kit for detecting and preparation method and applications | |
| CN102253194B (en) | Secondary antibody probe for sandwich immune reaction by using amperometric immunosensor | |
| Li et al. | A novel renewable electrochemical biosensor based on mussel-inspired adhesive protein for the detection of Escherichia coli O157: H7 in food | |
| Li et al. | Tetrahedral framework nucleic acids linked CRISPR/Cas13a signal amplification system for rare tumor cell detection | |
| CN105891483B (en) | A kind of preparation method of the unmarked electrochemical immunosensor based on graphene parcel polystyrene composite Nano ball | |
| CN1316249C (en) | Enzyme-linked assay kit and producing process thereof | |
| CN106525771A (en) | Gold nano-particle probe, preparation method and application thereof and method for detecting PSA | |
| US20220283151A1 (en) | Method for controlling protein dimerization using an intramolecular to intermolecular conformational switch | |
| Kowalczyk et al. | Ultrasensitive voltammetric detection of SARS-CoV-2 in clinical samples | |
| CN110045123A (en) | A kind of carbohydrate antigen 242 magnetic microparticle chemiluminescence immune quantitative detection reagent box and preparation method thereof | |
| CN104330562A (en) | High-throughput treponema pallidum specific antibody detection kit and preparation method thereof | |
| CN108918873A (en) | A kind of preparation method and application of the optical electro-chemistry thrombin aptamer sensor based on PS@Au double inhibition ZnCdS | |
| Strmečki et al. | Immunoassays of chemically modified polysaccharides, glycans in glycoproteins and ribose in nucleic acids | |
| Ding et al. | In vitro detection of human breast cancer cells (SK-BR3) using herceptin-conjugated liquid crystal microdroplets as a sensing platform | |
| CN108064342A (en) | For detecting the method for stem cell and kit | |
| CN113125709A (en) | Donor reagent and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |