CN105483132A - Aptamer with affinity to viral hepatitis C core antigen and application thereof - Google Patents
Aptamer with affinity to viral hepatitis C core antigen and application thereof Download PDFInfo
- Publication number
- CN105483132A CN105483132A CN201410482700.9A CN201410482700A CN105483132A CN 105483132 A CN105483132 A CN 105483132A CN 201410482700 A CN201410482700 A CN 201410482700A CN 105483132 A CN105483132 A CN 105483132A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- core antigen
- hepatitis virus
- type hepatitis
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an aptamer with affinity to viral hepatitis C core antigen and application thereof. The aptamer provided by the invention is following (a) or (b): single-stranded DNA as shown in sequence 2 of following sequence table (a); single-stranded DNA containing the aptamer described in (a). The aptamer can be used to capture the viral hepatitis C core antigen in a solution and to detect the viral hepatitis C core antigen in the solution, facilitating serological diagnosis and blood screening of viral hepatitis. The aptamer can be used to partially replace a monoclonal antibody, capturing a core antigen to detect viral hepatitis C, and the aptamer has the advantages of high sensitivity, low cost, ease of preparation and ease of storage. The aptamer has high applicable value.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of aptamer and application thereof of affine hepatitis C cAg, be specifically related to a kind of aptamer of affine hepatitis C cAg and the application in assistant identification third hepatopath thereof.
Background technology
Hepatitis C is a kind of communicable disease caused by hepatitis C virus (HCV), can be infected by blood or blood product.There are nearly 200,000,000 people's HCV infection in the current whole world, and about there are 4,000 ten thousand to 5,000 ten thousand people's HCV infection in China, is only second to hepatitis B carriers quantity.Because the third liver is that RNA viruses causes, in current world wide, not yet develop effective HCV vaccine.Third liver only has early discovery, early treatment, just can alleviate virus to hepatocellular destruction.Therefore, the HCV early detection method of exploration, development of new has very important significance.
Judge whether that unique way of infection third liver does the third liver Virus monitory.The serological diagnostic method of current hepatitis C comprises detection HCV antigen/antibody combination and HCVRNA.HCV antigen/antibody combination generally appeared at HCV infection after 12 weeks, and had quite a few patient body interior without HCV antigen/antibody combination, was unfavorable for the early diagnosis to HCV.HCVRNA came across virus infection after 1 week more, but false positive and false negative result easily appear in clinical detection.Therefore these diagnostic methods more or less have that window phase Detection results is undesirable, detection technique complicated operation, expensive equipment, the limitation such as examination scarce capacity in enormous quantities, from the requirement in addition suitable gap of early diagnosis with clinical blood or blood product examination.The polyprotein of known HCV genome encoding about 3100 amino-acid residue compositions, this albumen can be analyzed to cAg (core), E1 structural protein, E2 structural protein and p7 Nonstructural Protein, NS2 Nonstructural Protein, NS3 Nonstructural Protein, NS4A Nonstructural Protein, NS4B Nonstructural Protein, NS5A Nonstructural Protein, NS5B Nonstructural Protein under body and virus protease effect.HCVcore albumen came across HCV infection after 1 week, can be used as HCV early diagnosis and Clinical screening index, was expected to realize window phase and detected.
U.S. ORTHO company was proposed forth generation HCV-ELISA test kit in 2000 is in the world exactly detection based on HCVcore albumen.At home, Hunan Kang Run biotechnology company limited in 2005 also produces similar detection HCV virus agent box.Although these test kits can detect HCV antigen, because these test kits all adopt DASELISA method (ELISA) to detect, so need the preparation carrying out a large amount of monoclonal antibody.But the preparation process of monoclonal antibody is complicated, expensive, preservation condition is harsh.This makes the cost detecting HCV virus higher, and detection sensitivity is also subject to serious impact.
Aptamer (Aptamer, also known as aptamers, aptamer) be can high-affinity, high specific the few nucleic acid molecule (ssDNA or ssRNA) of the strand in conjunction with certain biological target.Aptamer be by index concentration Fas lignand system evolution technology (SystematicEvolutionofLigandsbyExponentialenrichment, SELEX) screen from the DNA/RNA library of synthetic obtain can high degree of specificity in conjunction with the single stranded DNA/RNA of target molecules.Report that the target of aptamer comprises metal ion, organic molecule, polypeptide, protein, cell are even organized.The molecular recognition function of aptamer and antibody class are seemingly, there is the target recognition capability quite even stronger with antibody molecule, but there is much excellent characteristic compared with antibody, as little in molecular weight, can manufacture, not easy in inactivation, non-immunogenicity, easily synthesis and mark, between penetrate tissue, good dynamic metabolism, different batches, product can not there are differences and have fine chemical stability fast, has important application prospect in fields such as biological detection, medical diagnosis on disease treatments.
Summary of the invention
The object of this invention is to provide a kind of aptamer and application thereof of affine hepatitis C cAg.
Aptamer provided by the invention, specifically following (a) or (b):
The single stranded DNA shown in sequence 2 of (a) sequence table;
(b) single stranded DNA containing (a) described aptamer.
Aptamer in described (b) specifically can be the single stranded DNA shown in sequence 1 of sequence table.
Described aptamer and core antigen of C type hepatitis virus have good affinity.
Carried out modifying or transforming by described aptamer, the derivative of the described aptamer obtained also belongs to protection scope of the present invention.
The derivative of described aptamer can be following any one:
A) by described aptamer deletion or the Nucleotide increasing partial complementarity, the derivative with described aptamer with the aptamer of identical function obtained.
B) described aptamer is carried out Nucleotide replacement or part modification, the derivative with described aptamer with the aptamer of identical function obtained.
C) skeleton of described aptamer is transform as phosphorothioate backbone, the derivative with described aptamer with the aptamer of identical function obtained.
D) aptamer is transform as peptide nucleic acid(PNA), the derivative with described aptamer with the aptamer of identical function obtained.
E) after described aptamer being connected upper fluorescence, radioactivity and therapeutic substance, the derivative with described aptamer with the aptamer of identical function obtained.
The enzyme plate (as 96 orifice plates) being fixed with described aptamer also belongs to protection scope of the present invention.
The core antigen of C type hepatitis virus in enzyme connection amplifying method detection sample to be tested can be adopted, thus realize the detection of clinical middle hepatitis C virus.
Described aptamer can be used for the test kit preparing detection or auxiliary detection core antigen of C type hepatitis virus; The nucleotide sequence of described core antigen of C type hepatitis virus is specifically as shown in the sequence 3 of sequence table.
Described aptamer also can be used for the test kit of characterization or assistant identification third hepatopath.
The present invention also protects the test kit of a kind of detection or auxiliary detection core antigen of C type hepatitis virus.
The test kit of described detection or auxiliary detection core antigen of C type hepatitis virus, specifically can comprise described aptamer; The nucleotide sequence of described core antigen of C type hepatitis virus is specifically as shown in the sequence 3 of sequence table.
Described test kit also can comprise the enzyme plate (as 96 orifice plates) of the monoclonal antibody being coated with anti-described core antigen of C type hepatitis virus.The described enzyme plate being coated with the monoclonal antibody of anti-described core antigen of C type hepatitis virus specifically can be 96 orifice plates with core antigen of hepatitis virus monoclonal antibody that Hunan Kang Run pharmaceutical Co. Ltd produces.The core antigen of C type hepatitis virus in sample to be tested can be detected by the enzyme plate and aptamer being coated with core antigen of C type hepatitis virus monoclonal antibody.When using described test kit, the sample to be tested of employing specifically can be serum.
The present invention also protects the test kit of a kind of qualification or assistant identification third hepatopath.
The test kit of described qualification or assistant identification third hepatopath, specifically can comprise described aptamer.
Described test kit also can comprise the enzyme plate (as 96 orifice plates) of the monoclonal antibody being coated with anti-described core antigen of C type hepatitis virus.The described enzyme plate being coated with the monoclonal antibody of anti-described core antigen of C type hepatitis virus specifically can be 96 orifice plates with core antigen of hepatitis virus monoclonal antibody that Hunan Kang Run pharmaceutical Co. Ltd produces.When using described test kit, the sample to be tested of employing specifically can be serum.
In the test kit of qualification or assistant identification third hepatopath, also can containing the specification sheets recording following content:
(1) following experimental group and control group is carried out:
Experimental group: be fixed with in the enzyme plate of described aptamer described in the in vitro serum of person to be measured is joined, hatch 1-2 hour for 37 DEG C, the core antigen of C type hepatitis virus monoclonal antibody that HRP modifies is added after washing, hatch 0.5-1 hour for 37 DEG C, add nitrite ion A+B after washing, develop the color 10 minutes; Detect the absorbance value under 450nm after colour developing, be designated as OD450
experimental group;
Control group: the in vitro serum of the person described to be measured in experimental group described in the in vitro blood serum substituting of not suffering from the Healthy People of the third liver with clinical definite, all the other are identical with described experimental group, and the absorbance value under the 450nm recorded, is designated as OD450
right according to group± σ, σ are the standard deviation of the many cell means of control group; Definition OD450
threshold value=OD450
control group± 3 σ.
(2) according to the measurement result of step (1), according to determining whether described person to be measured is the third hepatopath as follows: if described OD450
experimental groupwith OD450
threshold valueratio be greater than 1, then described person to be measured is the third hepatopath or candidate is the third hepatopath; Otherwise then described person to be measured is not the third hepatopath or candidate is not the third hepatopath.
Third liver does not still have vaccine prevention at present, and therefore early detection just seems quite important.It is current international research and clinical hot issue that hepatitis C virus is found in development in " window phase ".Utilize aptamer of the present invention, at infection with hepatitis C virus after 1 week, the detection to hepatitis C virus can be realized by detection core antigen of C type hepatitis virus instead of antibody.The novel method that Advantageous developments third liver detects by aptamer of the present invention.
The present invention also protects the enzyme plate being fixed with described aptamer preparing the application in test kit; Described test kit can detect or auxiliary detection core antigen of C type hepatitis virus and/or qualification or assistant identification third hepatopath; The nucleotide sequence of described core antigen of C type hepatitis virus is specifically as shown in the sequence 3 of sequence table.
Described aptamer and HCV core antigen have good affinity, by being fixed with 96 orifice plates of aptamer, can adopting the HCV core antigen in enzyme connection amplification method detection solution, thus realizing the detection of clinical middle hepatitis C virus.Described aptamer and HCV core antigen have good affinity, by being fixed with 96 orifice plates of monoclonal antibody, can adopting the HCV core antigen in aptamer detection solution, thus realizing the detection of clinical middle hepatitis C virus.
Utilize aptamer of the present invention, the core antigen of C type hepatitis virus in solution can be caught, also can detect the core antigen of C type hepatitis virus in solution, hepatitis C serodiagnosis and blood screening will be conducive to.Utilize aptamer of the present invention, part replaces monoclonal antibody to catch cAg and carry out hepatitis C detection, have highly sensitive, cost is low, easy preparation, the advantage of easily preserving.The present invention has very high using value.
Accompanying drawing explanation
Fig. 1 is the western-blot result with histidine-tagged protein in embodiment 1; A: with histidine-tagged core antigen of C type hepatitis virus; B: with histidine-tagged PET albumen.
Fig. 2 is that the combination of aptamer and core antigen of C type hepatitis virus characterizes.
Fig. 3 is that the specificity that aptamer is combined with HCV core antigen characterizes.
Fig. 4 adopts the aptamer of biotin modification for the detection of HCV core antigen.A: the aptamer on aptamer plate catches effect to target proteins; B: the specificity detecting target proteins with aptamer plate.
Fig. 5 adopts the HCV core antigen in aptamer plate detection serum.
Fig. 6 detects HCV core antigen for adopting aptamer on monoclonal antibody plate.A: using monoclonal antibody plate and aptamer detect the specificity of target proteins; B: adopt the HCV core antigen in aptamer detection serum on monoclonal antibody plate.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Core antigen of C type hepatitis virus detection kit (monoclonal antibody of the anti-hepatitis c virus cAg that nitrite ion A+B, horseradish peroxidase (HRP) are modified, have 96 orifice plates of the monoclonal antibody of anti-hepatitis c virus cAg) is purchased from Hunan Kang Run pharmaceutical Co. Ltd.Ni-NTA Agarose microbead is purchased from Qiagen company.96 orifice plates (being purchased from pierce company) that Streptavidin is modified.The Streptavidin that horseradish peroxidase (HRP) marks is purchased from pierce company.Intestinal bacteria (E.coli) DH5 α bacterial strain is purchased from Beijing Ding Guo company.Intestinal bacteria (E.coli) BL21 (DE3) bacterial strain is purchased from Invitrogen company.
Prokaryotic expression carrier pLM1; The public can obtain from Institute of Chemistry, Academia Sinica; Reference: SodeokaM, LarsonC, ChenL, etal.AmultifunctionalplasmidforproteinexpressionbyECPCR: overproductionofthep50subunitofNF-κ B.BioorgMedChemLett, 1993,3:1089-1094.
The preparation of embodiment 1, associated protein and related solution
One, the preparation with histidine-tagged core antigen of C type hepatitis virus (target proteins)
1, the amplification of the encoding gene of HCV-cAg
DNA (the encoding gene of core antigen of C type hepatitis virus shown in sequence 4 of preparation sequence table, GENBANKACCESSIONNO.HM566118.1, the core antigen of C type hepatitis virus shown in sequence 3 of polynucleotide), as the template of pcr amplification, carry out pcr amplification with the primer pair of primer 1 and primer 2 composition, obtain pcr amplification product.
Primer 1 (upstream primer): 5 '-CGCGCGAATTCATGAGCACGAATCCT-3 ',
Primer 2 (downstream primer): 5 '-CTGCAGGGATCCAGAGGCCGGGACGGTCA-3 ',
Pcr amplification condition: 95 DEG C of 2min; 95 DEG C of 30s, 66 DEG C of 30s, 72 DEG C of 1min, 35 circulations; 72 DEG C of 7min.
2, the structure of prokaryotic expression carrier
1. use the pcr amplification product of Restriction Enzyme EcoR I and BamH I double digestion step 1, obtain digestion products.
2. use Restriction Enzyme EcoR I and BamH I double digestion prokaryotic expression carrier pLM1, reclaim carrier framework.
3. step digestion products is 1. connected with step carrier framework 2., obtains connecting product.
4. will connect product conversion bacillus coli DH 5 alpha competent cell, with the LB plate screening positive colony containing penbritin (Amp), extraction plasmid carries out enzyme successively and cuts qualification and order-checking qualification.
Sequencing result shows, (skeleton plasmid is prokaryotic expression carrier pLM1 to obtain recombinant plasmid pLM1-core, the DNA shown in the sequence 4 inserting sequence table between recognition site is cut at EcoR I and BamH I enzyme, histidine-tagged encoding gene on the encoding gene of the core antigen of C type hepatitis virus shown in sequence 4 and carrier merges, and expresses the core antigen of C type hepatitis virus that band is histidine-tagged).
3, the prokaryotic expression qualification with histidine-tagged core antigen of C type hepatitis virus
1. by recombinant plasmid pLM1-core transformation of E. coli BL21 (DE3) competent cell, with the LB plate screening positive colony containing penbritin.
2. picking positive colony is in LB liquid nutrient medium, and 37 DEG C of joltings are spent the night, and adds IPTG (final concentration 1mmol/L) and continues to cultivate induction 10h.
3. the centrifugal 1min of 13000rpm, collects thalline and carries out SDS-PAGE electrophoresis and Westernblot.The primary antibodie of Westernblot is anti-his (available from Sigma).
Westernblot the results are shown in Figure A in 1.Result shows, containing the core antigen of C type hepatitis virus that band is histidine-tagged in thalline.
4, the great expression with histidine-tagged core antigen of C type hepatitis virus, purifying and detection
1. by recombinant plasmid pLM1-core transformation of E. coli BL21 (DE3) competent cell, recombinant bacterium is obtained.
2. the recombinant bacterium inoculation LB substratum 1. step obtained, 37 DEG C of shaking culture are spent the night, be transferred in the LB substratum containing 50 μ g/ml penbritins by the volume ratio of 1:50, about 2h (making OD600 be 0.6-0.8) is cultivated in 37 DEG C of joltings, adds IPTG (final concentration 1mmol/L) and continues to cultivate induction 12h.
3. 3500rpm collected by centrifugation thalline, at the startbuffer (formula: 0.02M sodium phosphate containing 100ug/ml N,O-Diacetylmuramidase, 0.5MNaCl, pH7.4) ultrasonication (frequency 120w in, in each circulation, ultrasonic 3s stops 3s, and 400 circulations, ice bath carries out), 4 DEG C, the centrifugal 10min of 10000rpm, collect cracking supernatant.
4. agarose cracking supernatant being splined on Ni-NTA coupling sticks post (purchased from GE company), with washingbuffer (formula: 0.02M sodium phosphate, 0.5MNaCl, 0.05M imidazoles, pH7.4) foreign protein is removed in washing, with elutionbuffer (formula: 0.02M sodium phosphate, 0.5MNaCl, 0.5M imidazoles, pH7.4) wash-out target protein, obtains being with histidine-tagged core antigen of C type hepatitis virus (by core antigen of C type hepatitis virus detection kit test positive).
Two, the preparation with histidine-tagged PET albumen (reference protein)
1, DNA (the encoding gene of PET albumen shown in sequence 6 of preparation sequence table, GENBANKACCESSIONNO.U46489.1, the PET albumen shown in sequence 5 of polynucleotide), between the EcoR I inserting prokaryotic expression carrier pLM1 and BamH I site, (skeleton plasmid is prokaryotic expression carrier pLM1 to obtain recombinant plasmid pLM1-PET, the DNA shown in the sequence 6 inserting sequence table between recognition site is cut at EcoR I and BamH I enzyme, histidine-tagged encoding gene on the encoding gene of the PET albumen shown in sequence 6 and carrier merges, express the PET albumen that band is histidine-tagged).
2, the prokaryotic expression qualification with histidine-tagged PET albumen
1. by recombinant plasmid pLM1-PET transformation of E. coli BL21 (DE3) competent cell, with the LB plate screening positive colony containing penbritin.
2. picking positive colony is in LB liquid nutrient medium, and 37 DEG C of joltings are spent the night, and adds IPTG (final concentration 1mmol/L) and continues to cultivate induction 10h.
3. the centrifugal 1min of 13000rpm, collects thalline and carries out SDS-PAGE electrophoresis and Westernblot.The primary antibodie of Westernblot is anti-his (available from Sigma).
Westernblot the results are shown in Figure B in 1.Result shows, containing the PET albumen that band is histidine-tagged in thalline.
3, replace recombinant plasmid pLM1-core with recombinant plasmid pLM1-PET, other is with 4 of step one, obtains being with histidine-tagged PET albumen.
Three, the preparation of related solution
PBS damping fluid: pH is 7.4, is made up of water and solute; Solute and concentration thereof are: 39mMNaH
2pO
4, 61mMNa
2hPO
4, 150mMNaCl.
Binding buffer liquid: pH is 7.4, is made up of PBS damping fluid and solute; Solute and concentration thereof are: 1mMMgCl
2, 0.2mg/ml yeast transfer RNA (tRNA).
Washings: pH is 7.2, is made up of water and solute; Solute and concentration thereof are: 25mMTris, 150mMNaCl, 0.1% (mass percentage) bovine serum albumin (BSA), 0.05% (volumn concentration) Tween-20.
TBST damping fluid: pH is 7.4, is made up of water and solute; Solute and concentration thereof are: 0.02MTris-HCl, 160mMNaCl, 0.1% (volumn concentration) Tween-20.
Core antigen of C type hepatitis virus (the target proteins that band embodiment 1 prepared is histidine-tagged, for solution form, the concentration of target proteins is 100 μ g/mL), the histidine-tagged PET albumen (reference protein of band prepared of embodiment 1, for solution form, the concentration of reference protein is 100 μ g/mL) and embodiment 1 prepare various related solution be used for embodiment 2 to embodiment 8.
The screening of embodiment 2, aptamer and preparation
One, albumen is fixing
1, get Ni-NTA Agarose microbead and be placed in 5ml centrifuge tube, remove supernatant, PBS buffer solution three times;
2, be scattered in target proteins (or reference protein) by the microballon of step 1, incubated at room 1h, PBS buffer by centrifugation washs three times;
3, the microballon of step 2 is scattered in 1mlPBS damping fluid again, be placed in 4 DEG C for subsequent use.
Two, the design of random nucleic acid library
Design the random nucleic acid library that two ends comprise 20 Nucleotide, centre comprises 40 Nucleotide as follows: 5 '-ACGCTCGGATGCCACTACAG (N
40) CTCATGGACGTGCTGGTGAC-3 '; N
40represent 40 random nucleotides, namely N is A, T, C or G.
Three, the screening of aptamer
1, DNA library pre-treatment
Random nucleic acid library is dissolved in binding buffer liquid.
2, instead to sieve
Random nucleic acid library is mixed with the microballon being fixed with reference protein, hatches 1-2 hour for 37 DEG C; After the washing of binding buffer liquid, microballon is centrifugal by ultrafiltration.
3, just sieve
Being added by solution centrifugal for ultrafiltration in anti-sieved journey is fixed with in the microballon of target proteins, hatches 1-2 hour for 37 DEG C.By microballon by after ultrafiltration centrifuge washing, with aqua sterilisa, microballon is transferred in centrifuge tube.By microballon after 95 DEG C of heating 10min, cooled on ice 10min, high speed centrifugation, collect supernatant liquor with DNA wherein for template, utilize primer (FITC-5 '-ACGCTCGGATGCCACTACAG-3 ' and Biotin-5 '-GTCACCAGCACGTCCATGAG-3 ') to carry out pcr amplification; By the PCR primer of the dextran bead separating bio element mark of avidin bag quilt after amplification, then utilize the sodium hydroxide of 0.2M that double-stranded DNA sex change is unwind, collect the DNA single chain of FITC mark, screen for next round after these DNA single chain desalinations.
In order to obtain the aptamer of high-affinity and specific binding target proteins, progressively changing in the process of screening and instead sieve with tRNA content in the protein content just sieved, screening time, screening solution and just sieving washing times, to increase screening pressure.
8 take turns screening after, carry out pcr amplification for template by primer (5 '-ACGCTCGGATGCCACTACAG-3 ' and 5 '-GTCACCAGCACGTCCATGAG-3 ') to screen product, PCR primer checked order.
Aptamer (aptamer HCV103) sequence following (see the sequence 1 of sequence table, single stranded DNA) of final selection:
5’-ACGCTCGGATGCCACTACAG
TACCACACATGCAGACCCACACAAATACATACTAGAG ACACTCATGGACGTGCTGGTGAC-3’；
Wherein, what add thick underline mark is core sequence (see the sequence 2 of sequence table, single stranded DNA).
The combination of embodiment 3, aptamer and core antigen of C type hepatitis virus characterizes
One, the FITC mark of aptamer and random nucleic acid library
The aptamer HCV103 of embodiment 2 preparation is marked with fluorescein isothiocyanate (FITC).
The random nucleic acid library of embodiment 2 preparation is marked with fluorescein isothiocyanate (FITC).
Two, the combination of aptamer and core antigen of C type hepatitis virus characterizes
1, target proteins is fixing
(1) get 200 μ lNi-NTA Agarose microbeads and be placed in 5ml centrifuge tube, remove supernatant, PBS buffer solution three times;
(2) be scattered in 1mL target proteins by the microballon of step (1), incubated at room 1h, PBS buffer by centrifugation washs three times;
(3) microballon of step (2) is scattered in 1mlPBS damping fluid again, be placed in 4 DEG C for subsequent use.
2, the combination of aptamer and core antigen of C type hepatitis virus characterizes
Following two groups of process are set:
1st group: make the concentration of aptamer HCV103 be 100nM the aptamer HCV103 binding buffer liquid dilution of 1 μ l10 μM of FITC mark, the microbeads for periods 1h being fixed with target proteins then obtained with 70 μ l steps 1; After binding buffer liquid ultrafiltration washing, with the fluorescent signal of confocal fluorescent microscopic examination microballon.
2nd group: make the concentration of random nucleic acid library be 100nM the random nucleic acid library binding buffer liquid dilution of 1 μ l10 μM of FITC mark, the microbeads for periods 1h being fixed with target proteins then obtained with 70 μ l steps 1; After binding buffer liquid ultrafiltration washing, with the fluorescent signal of confocal fluorescent microscopic examination microballon.
The results are shown in Figure 2.Aptamer HCV103 is strong with the microballon binding ability being fixed with target proteins, and bead surface has very strong fluorescence.Random nucleic acid library is weak with the binding ability of the microballon being fixed with target proteins, and bead surface fluorescence is very weak.Result shows, aptamer HCV103 and core antigen of C type hepatitis virus have good binding ability.
The specificity that embodiment 4, aptamer are combined with HCV core antigen characterizes
One, the FITC mark of aptamer
The aptamer HCV103 of embodiment 2 preparation is marked with fluorescein isothiocyanate (FITC).
Two, the specificity of aptamer
1, albumen is fixing
(1) get 200 μ lNi-NTA Agarose microbeads and be placed in 5ml centrifuge tube, remove supernatant, PBS buffer solution three times;
(2) be scattered in 1mL albumen to be fixed (target proteins or reference protein) by the microballon of step (1), incubated at room 1h, PBS buffer by centrifugation washs three times;
(3) microballon of step (2) is scattered in 1mlPBS damping fluid again, be placed in 4 DEG C for subsequent use.
2, the specificity that is combined with target proteins of aptamer
Following two groups of process are set:
1st group: make the concentration of aptamer HCV103 be 100nM the aptamer HCV103 binding buffer liquid dilution of 1 μ l10 μM of FITC mark, the microbeads for periods 1h being fixed with target proteins then obtained with 70 μ l steps 1;
2nd group: make the concentration of random nucleic acid library be 100nM the aptamer HCV103 binding buffer liquid dilution of 1 μ l10 μM of FITC mark, the microbeads for periods 1h being fixed with reference protein then obtained with 70 μ l steps 1;
After binding buffer liquid ultrafiltration washing, with the fluorescent signal of confocal fluorescent microscopic examination microballon.
The results are shown in Figure 3.When aptamer HCV103 and core antigen of C type hepatitis virus or the effect of PET albumen, the bead surface being only fixed with core antigen of C type hepatitis virus has obvious fluorescent signal; And the bead surface fluorescence intensity being fixed with PET albumen is very weak.Result shows, aptamer HCV103 has good specificity to core antigen of C type hepatitis virus.
Embodiment 5, employing aptamer plate detect HCV core antigen
One, the biotin labeling of aptamer
The aptamer HCV103 of embodiment 2 preparation is marked with vitamin H (biotin).
Two, the preparation of aptamer plate
Biotin labeled aptamer HCV103 binding buffer liquid step one obtained dissolves (concentration of biotin labeled aptamer is 100nM), then add in 96 orifice plates of Streptavidin modification, every hole adds 200 microlitres, hatch 1 hour, through washings washing be placed on 4 DEG C for subsequent use.
Three, the aptamer on aptamer plate catches effect to target proteins
Following two groups of process are set:
1st group: added by target proteins in the aptamer plate that step 2 obtains, every hole 200 μ l, hatches 1 hour (1-2 hour) for 37 DEG C; After washings washing, add the monoclonal antibody of the anti-hepatitis c virus cAg that HRP modifies, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; The absorbance value under 450nm is detected after colour developing.
2nd group: target proteins is added 96 orifice plates that Streptavidin is modified, every hole 200 μ l, hatches 1 hour (1-2 hour) for 37 DEG C; After washings washing, add the core antigen of C type hepatitis virus monoclonal antibody that HRP modifies, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; The absorbance value under 450nm is detected after colour developing.
Using the absorbance value of the 2nd group as 1, calculate the relative photon absorbing intensity of aptamer plate, the results are shown in Figure A in 4.Aptamer HCV103 has core antigen of C type hepatitis virus and catches effect significantly.
Four, the specificity of target proteins is detected with aptamer plate
By testing protein (target proteins, PET albumen; Isopyknic binding buffer liquid is as blank) add the aptamer plate that step 2 obtains, every hole 200 μ l, hatches 1 hour (1-2 hour) for 37 DEG C; After washings washing, add the core antigen of C type hepatitis virus monoclonal antibody that HRP modifies, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; The absorbance value under 450nm is detected after colour developing.
Using PET albumen as the absorbance value in the hole of testing protein as 1, calculate relative photon absorbing intensity when aptamer plate adds each testing protein, the results are shown in Figure B in 4.Aptamer HCV103 specificly can catch core antigen of C type hepatitis virus, and the antibody marked by HRP realizes the detection of core antigen of C type hepatitis virus, thus this aptamer can be used for the detection of hepatitis C clinically.
Embodiment 6, the HCV core antigen adopted in aptamer plate detection serum
One, the biotin labeling of aptamer
The aptamer HCV103 of embodiment 2 preparation is marked with vitamin H (biotin).
Two, the preparation of aptamer plate
With the step 2 of embodiment 5.
Three, the HCV core antigen in aptamer plate detection serum is adopted
Following two groups of process are set:
1st group: in 100 μ l calf serums, add 20 μ l target proteinses, obtain the serum containing target proteins; Mix containing the serum of target proteins with binding buffer liquid equal-volume, joined by mixed solution in the aptamer plate that step 2 obtains, every hole 200 μ l, hatches 1 hour (1-2 hour) for 37 DEG C; After washings washing, add the core antigen of C type hepatitis virus monoclonal antibody that HRP modifies, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; The absorbance value under 450nm is detected after colour developing.
2nd group: calf serum is joined the aptamer plate that step 2 obtains, every hole 200 μ l, hatches 1 hour (1-2 hour) for 37 DEG C; After washings washing, add the core antigen of C type hepatitis virus monoclonal antibody that HRP modifies, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; The absorbance value under 450nm is detected after colour developing.
The results are shown in Figure 5, add that the value after three times of standard deviations is as threshold value using the mean value of the 2nd group of OD450.Absorbance value under 1st group of 450nm and the ratio of threshold value are significantly greater than 1.Result shows, aptamer plate can core antigen of C type hepatitis virus in specific detection serum, thus aptamer HCV103 can be used for the Virus monitory of hepatitis C clinically.
Embodiment 7, the HCV core antigen adopted on monoclonal antibody plate in aptamer detection serum
One, the biotin labeling of aptamer
The aptamer HCV103 of embodiment 2 preparation is marked with vitamin H (biotin).
Two, using monoclonal antibody plate and aptamer detect the specificity of target proteins
Target proteins or reference protein or binding buffer liquid are joined 96 orifice plates with core antigen of C type hepatitis virus monoclonal antibody, every hole 200 μ l, hatches 1 hour (1-2 hour) for 37 DEG C; After washings washing, add biotin labeled aptamer HCV103, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add the Streptavidin that horseradish peroxidase (HRP) marks, hatch 30 minutes (20-60 minute) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; The absorbance value under 450nm is detected after colour developing.
The results are shown in Figure A in 6.
Two, on monoclonal antibody plate, adopt the HCV core antigen in aptamer detection serum
Following two groups of process are set:
1st group: in 100 μ l calf serums, add 20 μ l target proteinses, obtain the serum containing target proteins; Serum containing target proteins is mixed with binding buffer liquid equal-volume, mixed solution is joined and has in 96 orifice plates of core antigen of C type hepatitis virus monoclonal antibody, every hole 200 μ l, hatch 1 hour (1-2 hour) for 37 DEG C; After washings washing, add biotin labeled aptamer HCV103, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add the Streptavidin that horseradish peroxidase (HRP) marks, hatch 30 minutes (30-60 minute) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; The absorbance value under 450nm is detected after colour developing.
2nd group: joined by calf serum and have in 96 orifice plates of core antigen of C type hepatitis virus monoclonal antibody, every hole 200 μ l, hatches 1 hour (1-2 hour) for 37 DEG C; After washings washing, add biotin labeled aptamer HCV103, hatch 0.5 hour (0.5-1 hour) for 37 DEG C; After washings washing, add the Streptavidin that horseradish peroxidase (HRP) marks, hatch 30 minutes (30-60 minute) for 37 DEG C; After washings washing, add nitrite ion A+B, develop the color 10 minutes; The absorbance value under 450nm is detected after colour developing.
The results are shown in Figure B in 6, add that the value after three times of standard deviations is as threshold value using the mean value of the 2nd group of OD450.Absorbance value under 1st group of 450nm and the ratio of threshold value are significantly greater than 1.
The result of Fig. 6 shows, aptamer HCV103 can core antigen of C type hepatitis virus in specific detection serum, and the Streptavidin modified by vitamin H and HRP can amplifying signal, thus this aptamer can be used for the Virus monitory of hepatitis C clinically.
Claims (10)
1. aptamer is following (a) or (b):
The single stranded DNA shown in sequence 2 of (a) sequence table;
(b) single stranded DNA containing (a) described aptamer.
2. aptamer as claimed in claim 1, is characterized in that: the aptamer in described (b) is the single stranded DNA shown in sequence 1 of sequence table.
3. be fixed with the enzyme plate of aptamer described in claim 1 or 2.
4. the application of aptamer described in claim 1 or 2 in the test kit preparing detection or auxiliary detection core antigen of C type hepatitis virus;
The nucleotide sequence of described core antigen of C type hepatitis virus is specifically as shown in sequence in sequence table 3.
5. the application of aptamer described in claim 1 or 2 in the test kit of characterization or assistant identification third hepatopath.
6. a test kit for detection or auxiliary detection core antigen of C type hepatitis virus, comprises aptamer described in claim 1 or 2;
The nucleotide sequence of described core antigen of C type hepatitis virus is specifically as shown in sequence in sequence table 3.
7. test kit as claimed in claim 6, is characterized in that: described test kit also comprises the enzyme plate of the monoclonal antibody being coated with anti-described core antigen of C type hepatitis virus.
8. a qualification or assistant identification third hepatopath's test kit, comprises aptamer described in claim 1 or 2.
9. test kit as claimed in claim 8, is characterized in that: described test kit also comprises the enzyme plate of the monoclonal antibody being coated with anti-described core antigen of C type hepatitis virus.
10. the application of enzyme plate according to claim 3 in the test kit preparing auxiliary detection or auxiliary detection core antigen of C type hepatitis virus and/or qualification or assistant identification third hepatopath;
The nucleotide sequence of described core antigen of C type hepatitis virus is specifically as shown in sequence in sequence table 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410482700.9A CN105483132B (en) | 2014-09-19 | 2014-09-19 | The aptamer of affine viral hepatitis type C core antigen and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410482700.9A CN105483132B (en) | 2014-09-19 | 2014-09-19 | The aptamer of affine viral hepatitis type C core antigen and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105483132A true CN105483132A (en) | 2016-04-13 |
| CN105483132B CN105483132B (en) | 2018-08-24 |
Family
ID=55670406
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410482700.9A Active CN105483132B (en) | 2014-09-19 | 2014-09-19 | The aptamer of affine viral hepatitis type C core antigen and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105483132B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108957001A (en) * | 2018-06-27 | 2018-12-07 | 中国科学院化学研究所 | Aptamer elisa kit for detecting and preparation method and applications |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121009A (en) * | 2010-12-09 | 2011-07-13 | 中国科学院化学研究所 | Nucleic acid aptamer specifically combined with hepatitis C virus core protein and application thereof |
| WO2013073602A1 (en) * | 2011-11-18 | 2013-05-23 | 独立行政法人理化学研究所 | Nucleic acid fragment binding to target protein |
| CN103642810A (en) * | 2013-11-20 | 2014-03-19 | 中山大学附属第三医院 | Nucleic acid aptamer and screening method thereof, and application of nucleic acid aptamer in prostate cancer cell strain detection |
| CN104004763A (en) * | 2014-05-22 | 2014-08-27 | 中国科学院化学研究所 | Nucleic acid aptamer of affinity viral hepatitis C core protein and application of nucleic acid aptamer |
-
2014
- 2014-09-19 CN CN201410482700.9A patent/CN105483132B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121009A (en) * | 2010-12-09 | 2011-07-13 | 中国科学院化学研究所 | Nucleic acid aptamer specifically combined with hepatitis C virus core protein and application thereof |
| WO2013073602A1 (en) * | 2011-11-18 | 2013-05-23 | 独立行政法人理化学研究所 | Nucleic acid fragment binding to target protein |
| CN103642810A (en) * | 2013-11-20 | 2014-03-19 | 中山大学附属第三医院 | Nucleic acid aptamer and screening method thereof, and application of nucleic acid aptamer in prostate cancer cell strain detection |
| CN104004763A (en) * | 2014-05-22 | 2014-08-27 | 中国科学院化学研究所 | Nucleic acid aptamer of affinity viral hepatitis C core protein and application of nucleic acid aptamer |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108957001A (en) * | 2018-06-27 | 2018-12-07 | 中国科学院化学研究所 | Aptamer elisa kit for detecting and preparation method and applications |
| CN108957001B (en) * | 2018-06-27 | 2019-11-12 | 中国科学院化学研究所 | Aptamer elisa kit for detecting and preparation method and applications |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105483132B (en) | 2018-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102121009B (en) | Nucleic acid aptamer specifically combined with hepatitis C virus core protein and application thereof | |
| CN104004763B (en) | A kind of aptamer of affine hepatitis C core protein and application thereof | |
| WO2021179371A1 (en) | Novel coronavirus n-s dominant epitope fusion protein, preparation method therefor and application thereof, expression protein, microorganism, application thereof and kit | |
| Bragstad et al. | High frequency of enterovirus D 68 in children hospitalised with respiratory illness in N orway, autumn 2014 | |
| CN102967703B (en) | A kind of biological safety African swine fever antigen multiple-factor serum for ELISA diagnosis | |
| Shukla et al. | Rapid detection strategies for the global threat of Zika virus: current state, new hypotheses, and limitations | |
| Shi et al. | Inhibition of hepatitis C virus production by aptamers against the core protein | |
| CN102731615B (en) | Detection reagent and detection method for PRRSV | |
| Zhang et al. | Recent progress on rapid lateral flow assay-based early diagnosis of COVID-19 | |
| Allain et al. | Hepatitis B virus in transfusion medicine: still a problem? | |
| CN102229932B (en) | Nucleic acid aptamer capable of identifying HCV E1E2 (hepatitis C virus E1E2), nucleic acid aptamer derivatives and screening method and application thereof | |
| Huang et al. | Characterization of an envelope gene VP19 from Singapore grouper iridovirus | |
| Mazalovska et al. | Detection of serum antibodies to hepatitis E virus based on HEV genotype 3 ORF2 capsid protein expressed in nicotiana benthamiana | |
| CN104181297B (en) | A kind of ELISA kit detecting sheep Pseudorabies virus antibody | |
| JP2023182818A (en) | Methods and systems for rapid detection of Cronobacter using infectious agents | |
| Wunderink et al. | Stability of BK polyomavirus IgG seroreactivity and its correlation with preceding viremia | |
| CN103819565B (en) | HCV restructuring fused antigen and expressing gene and preparation method | |
| CN105483132A (en) | Aptamer with affinity to viral hepatitis C core antigen and application thereof | |
| Mauroy et al. | Alternative attachment factors and internalization pathways for GIII. 2 bovine noroviruses | |
| Alidjinou et al. | Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR | |
| CN105738624A (en) | Indirect immuno-fluorescence detection method of rift valley fever virus IgG antibody | |
| Owolodun et al. | Development of a fluorescent microbead-based immunoassay for the detection of hepatitis E virus IgG antibodies in pigs and comparison to an enzyme-linked immunoassay | |
| CN105254724B (en) | Truncated-type Hepatitis C Virus HCV NS3 antigens and its preparation and application | |
| CN104193827B (en) | Hepatitis C virus HVR1 (Hypervariable Region 1) fusion antigen and application thereof | |
| Fecek et al. | Production of Alexa Fluor 488-labeled reovirus and characterization of target cell binding, competence, and immunogenicity of labeled virions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |