CN108949942A - A kind of mitochondria genome sequencing method based on high-flux sequence - Google Patents
A kind of mitochondria genome sequencing method based on high-flux sequence Download PDFInfo
- Publication number
- CN108949942A CN108949942A CN201810786284.XA CN201810786284A CN108949942A CN 108949942 A CN108949942 A CN 108949942A CN 201810786284 A CN201810786284 A CN 201810786284A CN 108949942 A CN108949942 A CN 108949942A
- Authority
- CN
- China
- Prior art keywords
- primer
- unknown
- dna
- sequencing
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The invention discloses a kind of simple, economic, accurate mitochondria full-length genome barcode based on the sequencing of two generations to expand sequencing approach.The invention devises two groups of primers worked in coordination, wherein first group of primer is made of the target fragment primer sequence and primer joint sequence of 61 pairs of mitochondria full genomes that overlap each other and cover, second group of primer is by including joint sequence, the forward and reverse Tag primer composition that can be arranged in pairs or groups two-by-two, for marking the sample of separate sources.Primer is used cooperatively by two, two pairs of primers are added simultaneously in PCR reaction and expand, tape label, amplicon be of convenient length, comprising mitochondria full-length genome is obtained, directly carries out building library sequencing after mixing, realize multisample mixing sequencing.Sequencing data application bioinformatics package technique, while identifying both ends flag sequence end to end, separate sources sequence is distinguished, all mitochondrial genomes sequence informations of all samples are obtained.By the use of this method, simplifies sequencing experimental procedure, substantially reduce sequencing cost, improve the recall rate of low frequency mutation, provide possibility for the mitochondria genome-wide association study of large sample.
Description
Technical field
The invention belongs to genetic engineering fields, and in particular to a kind of method of mitochondrial DNA genome sequencing.
Background technique
Mitochondria is the important organelle of organism metabolism and energy conversion.Human mtdna (mtDNA) is
The double-strand closed hoop molecule being made of 16571bp DNA, the albumen of coding be the important composition of respiratory chain at
Point.There is important role in medical jurisprudence, anthropology and genetics research.MtDNA has very high change in crowd's level
The opposite sex, and specific mtDNA variation will affect the function of mitochondria.This change not only may cause oxidative phosphorylation and energy
Metabolic disorder, and the related pathways such as apoptosis can be caused to change, in the occurrence and development process of aging and many complex diseases
In play important function.People, which imagine identical mtDNA variation, may will increase the onset risk of several various diseases.In early days
MtDNA and disease association research strength of confirmation it is low, the repeatability of research is smaller, and more and more researchs recently, discovery
It is repeatable, the mtDNA of high strength of confirmation and being associated with for disease, especially in neurodegenerative disease, in Parkinson's disease.
The mtDNA variation of having researched and analysed of Gavin Hudson et al. is associated with many complexity late-onset diseases, it was confirmed that before
Imagination, this be based on genome association study (Genome-wide association study, GWAS) mitochondrial inheritance
Credit analysis provides theoretical basis.
Accurate sequencing approach is the basis of mitochondria genome-wide association study.Early stage causes mtDNA and disease association
The heterogeneous biggish major reason of research, it may be possible to since mtDNA Haplotypes and sequencing approach are more rough.The mankind
First complete sequence determination mtDNA is referred to as Cambridge standard sequence (Cambrige reference sequence, CRS),
Afterwards, there are several invulnerable releases, referred to as amendment Cambridge sequence (revised CRS, rCRS).Traditional mtDNA is sequenced entirely, is to be based on
The Sanger of pcr amplification product is sequenced, either mitochondria control region (control region) or genome sequencing, all
It is unable to reach very high sensibility, this is determined by mtDNA own characteristic.Mitochondrial DNA has very high mutation rate, especially
It is and the repair mechanism and not perfect in hypervariable region.And mitochondria quantity contained in the cell of different tissues is different, and it is right
For karyogene, only there are two allele, a certain position only has a unmutated, copy mutation or two in a certain site
Copy three kinds of situations of mutation, and the mutation of mitochondrial DNA is then increasingly complex, the frequency of mutation can be 0.1% to 100% times
What ratio.Low frequency is mutated, traditional Sanger sequencing can not detect, and need deep sequencing that could accurately find.Together
When, past many mitochondria Haplotypes strategies are also based on generation sequencing.Since the cumbersome of examining order, sequencing expense are high
Expensive and post analysis workload is huge, and for many typing strategies only in control zone, this is accurate for parting and research
Property causes difficulty.Also the method for taking control zone sequencing to combine with partial coding region sequencing is attempted there are many research to carry out
Parting, but this improvement is also fairly limited.
The development of next generation's sequencing (nextgeneration sequencing, NGS), so that mtDNA is sequenced and studies
Very big progress is arrived.Sequencing throughput increases substantially, so that low-frequency mtDNA variation can be also detected.Although
There is early stage in NGS, mitochondrial genomes are since segment is smaller, its application of cost performance too lower limit, but as sequencing takes
The application of decline and more and more new sequencing strategies, carries out grinding for mitochondrial genomes sequence using NGS in recent years
Study carefully quantity to increase substantially.
Research mitochondrial DNA diversity be one challenge, although 1% of mitochondrial DNA abundance not as good as total DNA, it
Copy number changes greatly in cell, while core DNA sequencing result is often obscured by mitochondrial DNA.Mitochondria deep sequencing strategy,
In mtDNA enrichment, fragmentation length, whether there is mixing sample and how to mix aspect and have nothing in common with each other.MtDNA's is enriched with point
These types of method is captured from method, amplification and target fragment.Classical one of method, exactly isolates mtDNA from cell
Come, more commonly used is that the methods of cesium chloride supercentrifugation, column chromatography and alkaline denaturation extract mtDNA, then are sequenced,
The influence of karyogene can be absolutely eliminated on this theoretical method.However, require a great deal of time due to obtaining mtDNA,
Yield is lower, and not can avoid the interference including core DNA impurity in practical application, so that this method is very limited.
And mtDNA is enriched with based on amplification, then have great advantage.There are long segment, medium segment and short-movie section amplification etc. different at present
Method expands mtDNA for overlapped PCR product, is trimmed to sizeable segment for high-flux sequence.This side
Method method is relatively simple and accuracy rate is high, only can be relatively difficult in design of primers, the especially design of primers of long segment amplification.Also
A kind of method is then target sequence capture, and microarray technology is utilized to synthesize the oligonucleotide probe complementary with mtDNA, enrichment mesh
MtDNA segment is marked, high-flux sequence then is carried out to the segment.The sequencing strategy of based on PCR amplification, according to amplified fragments
Length respectively has superiority and inferiority.Piece segment length, workload is small, pseudogene interference is few, but mutation rate is high, and accuracy is lower；And segment is shorter,
It is high to be mutated few accuracy rate, but corresponding larger workload and is easy to be interfered by pseudogene.
The sequencing of mixing sample can then be sequenced in operation in single and obtain a large amount of chondriogen data, relatively more normal at present
What is seen is to add bar code or flag sequence to the sample of separate sources when constructing DNA sequencing library, then at the time of reading
It is distinguished by these labels.This method has had some commercialized kits in different microarray datasets, but each
Sample constructs individual sequencing library, builds library and spends larger, cost raising.Someone has invented target amplification sequencing (targeted
Amplicom sequencing, TAS) label technique, the label of 10bp is connected in PCR product by two-step pcr, directly
Tap into row high-flux sequence.However two-step method PCR, in practical application, especially sample expands, and will increase many workloads.
Recently, and it has been proposed that, will directly can be connected directly between on target sequence primer, reduce with the primer sequence of barcode
PCR amplification workload, if however this method be applied to compared with multiple clips amplification be sequenced, can primer cost and
It is greatly increased in the consumption of barcode sequence.
Summary of the invention
Since current method is there are various different limitation, the present invention provides a kind of simple, economic, accurate line grain
Body full-length genome barcode expands sequencing approach, provides possibility for the mitochondria genome-wide association study of large sample.
One section of universal primer connector is added in the present invention in the target fragment primer sequence of covering mitochondria full genome
(commentail), primer 1 is constituted, is easy to connect with the barcode primer (primer 2) comprising acomplementary connector, collocation uses, together
When primer 2 forward and reverse primer sequence can also intersect collocation two-by-two, greatly reduce primer amount by designing above；Using
Primer 2 sequence mark is directly added using two groups of primers in PCR amplification while expanding target fragment, reduces work
Amount；All expanding fragment lengths are suitable, and without interrupting, specific identification is not necessarily to after mixing, directly carry out building library sequencing, be built with reducing
Kucheng's sheet, and the recall rate that resulting two generations sequencing data depth is mutated low frequency greatly improves；Later data application is higher
Bioinformatics package technique, while identifying both ends primer 2 sequence end to end, separate sources sequence distinguished.
The present invention adopts the following technical scheme: a kind of mitochondria genome sequencing method based on high-flux sequence, step
It is rapid as follows:
(1) whole blood cells total genomic dna is extracted；
(2) two groups of primers are designed, wherein first group of primer includes that 61 pairs of primers, 1,61 pairs of primers 1 cover mitochondria full genome
Group, and include adhesive bond, primer sequence is respectively as shown in NO.1~122 SEQ ID；Wherein, SEQ ID NO. (2n-1)
It partners primer with SEQ ID NO. (2n), n=1,2 ..., 61；Second group of primer includes multiple forward primers and identical
The reaction primer of quantity, any forward primer can be matched with either direction primer, form primer 2；The forward primer and
Reverse primer includes the adhesive bond with the pairing of the adhesive bond of first group of primer, for marking different samples；Second group is drawn
Forward primer in object includes NO.123~126 SEQ ID, and reverse primer includes NO.127~130 SEQ ID；
(3) by the whole blood cells total genomic dna in multiple and different sources, PCR is carried out respectively using cross-mixing one-step method
The length of amplification, amplicon is not more than 450bp；
(4) all amplicons that step 3 obtains are mixed and is built after purification using Illumina Hiseq2500PE250
Library and sequencing；
(5) sequencing data is analyzed.
Further, step 3 specifically:
In PCR reaction, while primer 1 and primer 2 progress PCR amplification is added；Genome total for each whole blood cells
DNA carries out 61 PCR amplifications using the same primer 2 and 61 primers 1, to obtain the covering line grain for having primer 2 feature
61 amplicons of body full-length genome；For not having to the whole blood cells total genomic dna in source, carried out using different primer 2s
Signature；PCR system is as follows:
PCR reaction condition is as follows:
Further, the step (5) specific steps are as follows: according in step 3, primer 2 is total with whole blood cells
The corresponding relationship of genomic DNA source determines the source of each segment in IlluminaHiSeq sequencing result, unrecognized
Segment abandons.By the segment of same source, head and the tail splicing is carried out.
The beneficial effects of the present invention are:
(1) present invention is during pcr amplification, while the primer that can mark different samples is added, so that separate sources
The amplicon of genome dna can be sequenced simultaneously, have the characteristics that efficient, accurate, cheap.
(2) matching design for passing through primer 1 and 2 avoids in subsequent sequencing procedure so that amplified fragments are less than 450bp
Segment interrupts, to guarantee the complete reading of data.
(3) in primer 2 forward primer and reverse primer design, allow to any pairing, considerably increasing can be special
The quantity of property marker samples.The mixing of great amount of samples is sequenced, and largely reduces sequencing cost and time.
Detailed description of the invention
Fig. 1 is mitochondria full-length genome barcode PCR flow chart；
Fig. 2 is the full amplimer verifying of 61 pairs of mitochondrias, selects 1 sample at random, amplified fragments are about 350bp；
Fig. 3 is 16 pairs of barcode primer verifyings (selecting 1 sample and 2 commtail primers at random), from first from left to right
Swimming lane is common mitochondria amplified fragments (length about 350bp), and Article 2 swimming lane is the mitochondria amplification plus commentail
Segment (1 amplified fragments of primer, 22bp longer than segment 1), 3-18 swimming lane, which respectively corresponds, to be expanded plus the PCR of primer 1 and primer 2
Increase mitochondria segment (10bp longer than segment 2).
Fig. 4 is 61 pairs of commentail primer verifyings (selecting 1 sample and 1 barcode primer at random), from from left to right first
Swimming lane is common mitochondria amplified fragments (length about 350bp), and Article 2 swimming lane is to expand plus the mitochondria of commentail
Increase segment (1 amplified fragments of primer, 22bp longer than segment 1), it is simultaneously plus primer 1 and primer 2 that the 3rd swimming lane, which respectively corresponds,
PCR amplification mitochondria segment (10bp longer than segment 2).3 one group, totally 61 groups.
Fig. 5 is 16 sample barcode sequencing data Quality Controls；A.barcode expands mixing sample agarose electrophoresis figure, single
One band, and size meets sequencing and requires；B. base quality distribution diagram, the mass value of base illustrate to be sequenced substantially 30 or more
Quality is preferable；C. base contents distribution map, base contents distribution map, no AT, GC segregation phenomenon.
Fig. 6 is 16 sample barcode sequencing data covering site distribution maps.
Fig. 7 is 4 verifying sample Sanger sequencing characteristic mutation peak figures.
Specific embodiment
In the following with reference to the drawings and specific embodiments, the technical solution of present aspect is described in further detail, but the present invention is not
It is only limitted to following embodiment.16 samples are taken, carry out verifying of the invention, specific step is as follows for experiment flow.
The extraction and preservation of 1.mtDNA template
1.1 sample collections and preservation.
Every an example research object peripheric venous blood is acquired, EDTA is anticoagulant, and 4 DEG C of refrigerators save.
1.2DNA extracting
Process is extracted according to conventional whole blood DNA to carry out.
1.3DNA sample Quality Control
The DNA sample of 1ul is taken, the concentration and purity of spectrophotometry measurement DNxA template on probation, concentration >=20ng/ul,
260/280 is 1.8-2.0；The sample of 260/230 2.0-2.5 thinks qualified.The sample of Quality Control qualification is saved in -20 DEG C.
1 spectrophotometry of table measures template DNA concentration and purity
2. design of primers and preliminary identification
The present invention designs 61 pairs of primers shown in NO.1~122 SEQ ID, and 61 pairs of primers 1 cover mitochondria full-length genome,
It and include adhesive bond.Using 61 pairs of primers, on the one hand cooperates second group of primer, guarantee that amplification length is less than
450bp；On the other hand, guarantee the overlapping for having certain length between adjacent amplified fragments, be conducive to the true and reliable of sequencing data.
16 samples as involved in the present embodiment, in second group of primer, the present invention only need 4 forward primers of design and
4 reverse primers, forward primer and reverse primer arbitrarily match, and the signature to above-mentioned 16 samples can be realized.4 just
It include adhesive bond to primer and 4 reverse primers, to be matched with primer 1,4 forward primers and 4 reverse primers
Sequence respectively as shown in NO.123~126 SEQ ID and NO.127~130 SEQ ID.
1: the first group of primer of table
2: the second groups of primers of table
| Primer numbers | Primer | Sequence |
| SEQ ID NO.123 | BCF1 | tgtcacacgaacactgacgacatggttctaca |
| SEQ ID NO.124 | BCF2 | agcgactagcacactgacgacatggttctaca |
| SEQ ID NO.125 | BCF3 | atagatagacacactgacgacatggttctaca |
| SEQ ID NO.126 | BCF4 | cacgtgtcgcacactgacgacatggttctaca |
| SEQ ID NO.127 | BCR1 | tgtcacacgatacggtagcagagacttggtct |
| SEQ ID NO.128 | BCR2 | agcgactagctacggtagcagagacttggtct |
| SEQ ID NO.129 | BCR3 | atagatagactacggtagcagagacttggtct |
| SEQ ID NO.130 | BCR4 | cacgtgtcgctacggtagcagagacttggtct |
Live part amplification other than 2.1 pairs of first group of primer center taps: PCR reaction system (total system is configured on ice
It is 20ul) specific as follows:
PCR reaction condition
2.2 pairs of first group of primers (including connector) carry out the segmentation amplification of mitochondrial DNA complete sequence
Configuration PCR reaction system (total system 10ul) is specific as follows on ice:
PCR reaction condition
Wherein, it is denaturalized, anneals, extending 35 circulations of progress.
Primer sequence
Design of primers: commentail primer is added on the basis of 61 pairs of primers in 2.1
CT-F:ACACTGACGACATGGTTCTACA~mt-F
CT-R:TACGGTAGCAGAGACTTGGTCT~mt-R
The cooperation PCR amplification of 2.3 two groups of primers
Configuration PCR reaction system (total system 10ul) is specific as follows on ice:
PCR reaction condition
2.1,2.2,2.3 pcr amplification product
Above-mentioned PCR reaction product is subjected to electroresis appraisal.2% agarose gel electrophoresis, 120V electrophoresis 30min.Then exist
Imaging is exposed in gel image scanning imaging system (T2A Imaging System, bio-rad).
Fig. 2 agarose electrophoresis is shown: the full amplimer amplified fragments of 61 pairs of mitochondrias are single band, length 350bp
Left and right, meets the requirements.
Fig. 3 agarose electrophoresis is shown: the result of the PCR of 16 pairs of primer 2s and any two pairs of primers 1.General primer expands piece
The independent amplified fragments of primer 1 of connector are added in section, and primer 1 increases with primer 2 mixing amplified fragments in ladder, prompt 4 pairs of primers
2 16 kinds of combinations meet the requirements.
Fig. 4 agarose electrophoresis is shown: the PCR result of 61 pairs of primers 1 and any pair of primer 2.General primer amplified fragments,
The independent amplified fragments of primer 1 of connector are added, primer 1 increases with primer 2 mixing amplified fragments in ladder, prompts 61 pairs of primers 1
Meet the requirements.
3, PCR product mixing sequencing and data analysis
16 samples are taken, totally 16 kinds of combinations are marked with 4 pairs of primer 2s.The 61 PCR reactions of singleton sample, totally 976
Each 1ul of PCR reaction system is mixed, after mixing product, take part using commercialization PCR product purification kit into
Row purifying.Sample after purification send conventional two generations sequencing, and sequencing uses Illumina Hiseq2500PE250.Read each
Section both ends primer 2 sequence determines each piece in IlluminaHiSeq sequencing result according to the corresponding relationship of primer 2 and sample
The source of section, unrecognized segment abandon.By the segment of same source, head and the tail splicing is carried out, it is complete to obtain 16 sample mitochondrias
Genome sequence.
Sequencing data passes through Quality Control, and the display quality of data is good, is detailed in Fig. 5.Sample builds the Quality Control result of library and sequencing
It is detected through agarose gel electrophoresis, the sample fragment of 16 sample barcode PCR amplifications mixing is big as the result is shown
It is small in 450bp or so, complete fragment, size is suitable.Using spectrophotometry sample OD260/280 >=1.8, meets and build library
It is required that.3.3G data volume is obtained in sequencing, and Q30 content is 85%, and after carrying out data filtering, the mass value of the base of sample is basic
30 or more, illustrate that sequencing quality is preferable.Base distribution figure shows, no AT, GC segregation phenomenon.
16 samples after data are analyzed, average sequencing depth reaches 1000 × more than, and cover the full base of mitochondria
It is preferable using this method coverage and harmony on the whole because of a group sequence.It is detailed in Fig. 6.
4, this method sequencing result is compared with conventional method
Compared with this method is sequenced with classics Sanger.
Using HaploGrep2 Update 2.1.0, by treated, Barcode sequencing sequence carries out mitochondria haplotype
Classification, obtains result such as table 2.Take 4 samples at random: No. 9, No. 10, No. 12, No. 13 progress Sanger sequencings.Sanger sequencing
As a result see Fig. 7.
No. 9 sample B arcode sequencing and typings are A type, and the site mt.16362 occur and fail classification mutation.It is surveyed in Sanger
In sequence, single times of A type site characteristic mt.663G of mitochondria and N-type mt.8701A, mt.9540T, mt.10398A are found,
The mutation of mt.10873T, mt.15301G characteristic.Also there is same unfiled mutation in the site mt.16362.
No. 10 sample B arcode sequencing and typings are c-type.In Sanger sequencing, single times of c-type characteristic of mitochondria is found
The site mt.16327T and the mutation of M8 type mt.16298C characteristic.
No. 12 sample B arcode sequencing and typings are F1a type.In Sanger sequencing, single times of F1a type feature of mitochondria is found
Property the site mt.4086T and N-type mt.8701A characteristic mutation.
No. 13 sample B arcode sequencing and typings are F2a+@16291.In Sanger sequencing, single times of F2a of mitochondria is found
The type site characteristic mt.1630G and the mutation of R type mt.12795C, mt.16223C characteristic.Also have together in the site mt.16291
The unfiled mutation of sample.
2 16 test sample mitochondria haplotypes of table
This method is compared with two generations sequencing after long segment amplification
2 samples are randomly choosed, No. 12 and No. 13, two generations were sequenced after carrying out long segment amplification, Haplotypes and we
Method is obtained a result consistent with this method.(see Table 3 for details)
42 test sample long segment mtDNA amplification sequencing haplotypes of table
Sequence table
<110>Zhejiang University
Hong Kong University
<120>a kind of mitochondria genome sequencing method based on high-flux sequence
<160> 130
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>unknown (Unknown)
<400> 1
gcaatacact gaaaatgttt agacg 25
<210> 2
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 2
ttacgccggc ttctattgac 20
<210> 3
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 3
actaacccca gggttggtca 20
<210> 4
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 4
atatgaagca ccgccaggtc 20
<210> 5
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 5
acaaaactgc tcgccagaac 20
<210> 6
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 6
ggccctgttc aactaagcac 20
<210> 7
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 7
gaaacttaag ggtcgaaggt gga 23
<210> 8
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 8
ttgcgccagg tttcaatttc 20
<210> 9
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 9
ccactccacc ttactaccag aca 23
<210> 10
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 10
cttggacaac cagctatcac 20
<210> 11
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 11
gcacacccgt ctatgtagca 20
<210> 12
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 12
caattgggtg tgaggagttc 20
<210> 13
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 13
aagcagccac caattaagaa 20
<210> 14
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 14
gcggtgcctc taatactggt 20
<210> 15
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 15
gcaaatctta ccccgcctgt 20
<210> 16
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 16
gttgggttct gctccgaggt 20
<210> 17
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 17
cctaacaaac ccacaggtcc 20
<210> 18
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 18
ttcgtacagg gaggaatttg 20
<210> 19
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 19
tgatctgagt tcagaccgga 20
<210> 20
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 20
aacgttgggg cctttgcgta 20
<210> 21
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 21
gcaatggcat tcctaatgct 20
<210> 22
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 22
ttgggctact gctcgcagtg 20
<210> 23
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 23
cctagccgtt tactcaatcc 20
<210> 24
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 24
gaagaatagg gcgaaggggc 20
<210> 25
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 25
ccgaagggga gtccgaacta 20
<210> 26
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 26
ccgaagggga gtccgaacta 20
<210> 27
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 27
cctaccactc accctagcat tac 23
<210> 28
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 28
cgagcttagc gctgtgatga 20
<210> 29
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 29
attaatcccc tggcccaacc 20
<210> 30
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 30
agaggggtgc cttgggtaac 20
<210> 31
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 31
aggaatagcc ccctttcact 20
<210> 32
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 32
tagggtcgtg gtgctggagt 20
<210> 33
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 33
aatagcagtt ctaccgtaca 20
<210> 34
<211> 19
<212> DNA
<213>unknown (Unknown)
<400> 34
gtgtgattga ggtggagta 19
<210> 35
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 35
caccatcacc ctccttaacc 20
<210> 36
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 36
ggtttaagtc ccattggtct agt 23
<210> 37
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 37
accccactct gcatcaactg 20
<210> 38
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 38
ctcatgcgcc gaataatagg 20
<210> 39
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 39
gatgttcgcc gaccgttgac 20
<210> 40
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 40
atagcagatg cgagcaggag 20
<210> 41
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 41
cctactcctg ctcgcatctg 20
<210> 42
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 42
tgaggttgcg gtctgttagt 20
<210> 43
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 43
ccgtcctaat cacagcagtc 20
<210> 44
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 44
tgattatggt agcggaggtg 20
<210> 45
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 45
tggcttccta gggtttatcg 20
<210> 46
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 46
gcctgagaat aggggaaatc 20
<210> 47
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 47
gcccacttcc actatgtcct 20
<210> 48
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 48
gtggggggca tccatatagt 20
<210> 49
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 49
ttcgaagcga aaagtcctaa 20
<210> 50
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 50
agggcataca ggactaggaa 20
<210> 51
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 51
gacgctactt cccctatcat 20
<210> 52
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 52
caggtcgcct ggttctagga 20
<210> 53
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 53
ggccaccaat ggtactgaac 20
<210> 54
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 54
acgggcccta tttcaaagat 20
<210> 55
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 55
gtggagcaaa ccacagtttc 20
<210> 56
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 56
ggcaatgaat gaagcgaaca 20
<210> 57
<211> 18
<212> DNA
<213>unknown (Unknown)
<400> 57
taccacctac ctccctca 18
<210> 58
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 58
tggttggtgt aaatgagtga 20
<210> 59
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 59
cactaaagga cgaacctgat 20
<210> 60
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 60
attgctaggg tggcgcttcc 20
<210> 61
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 61
gccgtacgcc taaccgctaa 20
<210> 62
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 62
ggcctagtat gaggagcgtt 20
<210> 63
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 63
ccctctcagc cctcctaatg 20
<210> 64
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 64
ctcctgatgc gagtaatacg 20
<210> 65
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 65
cctacccccc aattaggagg 20
<210> 66
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 66
ttagttggcg gatgaagcag 20
<210> 67
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 67
ccacaggctt ccacggactt 20
<210> 68
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 68
gcactcgtaa ggggtggatt 20
<210> 69
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 69
tcaacaccct cctagcctta 20
<210> 70
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 70
agtcgaaatc attcgttttg 20
<210> 71
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 71
ccctaagtct ggcctatgag tga 23
<210> 72
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 72
taggccatat gtgttggaga ttg 23
<210> 73
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 73
ctagtctttg ccgcctgcga 20
<210> 74
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 74
gataagtggc gttggcttgc 20
<210> 75
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 75
ccctaacaac ccccctccta 20
<210> 76
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 76
ttcttgggca gtgagagtga 20
<210> 77
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 77
gctcccttcc cctactcatc 20
<210> 78
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 78
cgtaggcaga tggagcttgt 20
<210> 79
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 79
tctcaacccc ctgacaaaac 20
<210> 80
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 80
ggttagcgag gcttgctaga 20
<210> 81
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 81
cgcactcaca gtcgcatcat 20
<210> 82
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 82
gatgtcgggg ttgagggata 20
<210> 83
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 83
aaccctcatt cacacgagaa 20
<210> 84
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 84
taaggatggg gggaattagg 20
<210> 85
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 85
aacagctatc cattggtctt 20
<210> 86
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 86
gtaacgaaca atgctacagg 20
<210> 87
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 87
acccaaacaa cccagctctc 20
<210> 88
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 88
tcatgctaag gcgaggatga 20
<210> 89
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 89
ccgagcagat gccaacacag 20
<210> 90
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 90
agtggtgata gcgcctaagc 20
<210> 91
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 91
tcttactcat ccgcttccac 20
<210> 92
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 92
aatgctaggc tgccaatggt 20
<210> 93
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 93
ccgggtccat catccacaac 20
<210> 94
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 94
aatcctgcga ataggcttcc 20
<210> 95
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 95
gcttccccac ccttactaac 20
<210> 96
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 96
ggagtagggg caggttttgg 20
<210> 97
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 97
ctccaacata ctcggattct acc 23
<210> 98
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 98
tattggtgcg ggggctttgt 20
<210> 99
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 99
ttcccccgag caatctcaat 20
<210> 100
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 100
tagggggaat gatggttgtc 20
<210> 101
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 101
accccactaa aacactcacc 20
<210> 102
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 102
cgtattgggg tcattggtgt 20
<210> 103
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 103
ttctcgcacg gactacaacc 20
<210> 104
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 104
cctcgcccga tgtgtaggaa 20
<210> 105
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 105
cccacatcac tcgagacgta 20
<210> 106
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 106
tgaagggcaa gatgaagtga 20
<210> 107
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 107
ccatacattg ggacagacct 20
<210> 108
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 108
aattgtgtag gcgaatagga 20
<210> 109
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 109
ccctagccaa ccccttaaac 20
<210> 110
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 110
atactacaag gacaggccca ttt 23
<210> 111
<211> 16
<212> DNA
<213>unknown (Unknown)
<400> 111
gatcacaggt ctatca 16
<210> 112
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 112
ttaagtgctg tggccagaag 20
<210> 113
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 113
ccactttcca cacagacatc 20
<210> 114
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 114
tttgaggagg taagctacat 20
<210> 115
<211> 16
<212> DNA
<213>unknown (Unknown)
<400> 115
aataccaact atctcc 16
<210> 116
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 116
attcatggtg gctggcagta 20
<210> 117
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 117
tggggaagca gatttgggta 20
<210> 118
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 118
tcaagggacc cctatctgag 20
<210> 119
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 119
caaacctacc cacccttaac 20
<210> 120
<211> 18
<212> DNA
<213>unknown (Unknown)
<400> 120
catcgtgatg tcttattt 18
<210> 121
<211> 21
<212> DNA
<213>unknown (Unknown)
<400> 121
ctcccactcc catactacta a 21
<210> 122
<211> 18
<212> DNA
<213>unknown (Unknown)
<400> 122
cattgctgcg tgcttgat 18
<210> 123
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 123
tgtcacacga acactgacga catggttcta ca 32
<210> 124
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 124
agcgactagc acactgacga catggttcta ca 32
<210> 125
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 125
atagatagac acactgacga catggttcta ca 32
<210> 126
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 126
cacgtgtcgc acactgacga catggttcta ca 32
<210> 127
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 127
tgtcacacga tacggtagca gagacttggt ct 32
<210> 128
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 128
agcgactagc tacggtagca gagacttggt ct 32
<210> 129
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 129
atagatagac tacggtagca gagacttggt ct 32
<210> 130
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 130
cacgtgtcgc tacggtagca gagacttggt ct 32
Claims (3)
1. a kind of mitochondria genome sequencing method based on high-flux sequence, which is characterized in that specific step is as follows:
(1) whole blood cells total genomic dna is extracted；
(2) two groups of primers are designed, wherein first group of primer includes that 61 pairs of primers, 1,61 pairs of primers 1 cover mitochondria full-length genome,
And comprising adhesive bond, primer sequence is respectively as shown in NO.1~122 SEQ ID；Second group of primer, draws comprising multiple forward directions
The reaction primer of object and identical quantity, any forward primer can be matched with either direction primer, form primer 2；It is described just
It include the adhesive bond matched with the adhesive bond of first group of primer to primer and reverse primer, for marking different samples；
Forward primer in second group of primer includes NO.123~126 SEQ ID, and reverse primer includes NO.127~130 SEQ ID；
(3) by the whole blood cells total genomic dna in multiple and different sources, PCR amplification is carried out respectively using cross-mixing one-step method,
The length of amplicon is not more than 450bp；
(4) all amplicons that step 3 obtains are mixed and carries out building library using Illumina Hiseq2500 PE250 after purification
And sequencing；
(5) sequencing data is analyzed.
2. the method according to claim 1, wherein step 3 specifically:
In PCR reaction, while primer 1 and primer 2 progress PCR amplification is added；For each whole blood cells total genomic dna,
61 PCR amplifications are carried out using the same primer 2 and 61 primers 1, it is complete to obtain the covering mitochondria with primer 2 feature
61 amplicons of genome；For not having to the whole blood cells total genomic dna in source, feature is carried out using different primer 2s
Label；PCR system is as follows:
PCR reaction condition is as follows:
3. the method according to claim 1, wherein the step (5) specific steps are as follows: according to step
In rapid 3, the corresponding relationship of primer 2 and whole blood cells total genomic dna source is determined every in IlluminaHiSeq sequencing result
The source of one segment, unrecognized segment abandon.By the segment of same source, head and the tail splicing is carried out.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810786284.XA CN108949942B (en) | 2018-07-17 | 2018-07-17 | Mitochondrial whole genome sequencing method based on high-throughput sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810786284.XA CN108949942B (en) | 2018-07-17 | 2018-07-17 | Mitochondrial whole genome sequencing method based on high-throughput sequencing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108949942A true CN108949942A (en) | 2018-12-07 |
| CN108949942B CN108949942B (en) | 2020-08-11 |
Family
ID=64481547
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810786284.XA Active CN108949942B (en) | 2018-07-17 | 2018-07-17 | Mitochondrial whole genome sequencing method based on high-throughput sequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108949942B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110648720A (en) * | 2019-09-25 | 2020-01-03 | 广州微远基因科技有限公司 | Metagenome sequencing quality control prediction evaluation method and model |
| CN111172255A (en) * | 2019-12-24 | 2020-05-19 | 中国烟草总公司郑州烟草研究院 | Screening and identifying method of CRISPR/Cas9 gene editing mutant |
| CN111378732A (en) * | 2018-12-27 | 2020-07-07 | 北京希望组生物科技有限公司 | Mitochondrial genome sequencing primer, kit and method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694635A (en) * | 2015-02-12 | 2015-06-10 | 北京百迈客生物科技有限公司 | Method for constructing high-flux simplified genome sequencing library |
| US9150916B2 (en) * | 2011-06-24 | 2015-10-06 | Beat Christen | Compositions and methods for identifying the essential genome of an organism |
| CN105200530A (en) * | 2015-10-13 | 2015-12-30 | 北京百迈客生物科技有限公司 | Method for establishing multi-sample hybrid library suitable for high-flux whole-genome sequencing |
| CN105907748A (en) * | 2016-05-10 | 2016-08-31 | 广州嘉检医学检测有限公司 | Mitochondrial genome library based on high-throughput sequencing and building method thereof |
| CN106350590A (en) * | 2016-09-06 | 2017-01-25 | 承启医学（深圳）科技有限公司 | DNA library construction method for high-throughput sequencing |
| CN108220393A (en) * | 2018-01-26 | 2018-06-29 | 广州海思医疗科技有限公司 | A kind of method of high-throughput quick detection mitochondrial gene mutation or missing |
-
2018
- 2018-07-17 CN CN201810786284.XA patent/CN108949942B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9150916B2 (en) * | 2011-06-24 | 2015-10-06 | Beat Christen | Compositions and methods for identifying the essential genome of an organism |
| CN104694635A (en) * | 2015-02-12 | 2015-06-10 | 北京百迈客生物科技有限公司 | Method for constructing high-flux simplified genome sequencing library |
| CN105200530A (en) * | 2015-10-13 | 2015-12-30 | 北京百迈客生物科技有限公司 | Method for establishing multi-sample hybrid library suitable for high-flux whole-genome sequencing |
| CN105907748A (en) * | 2016-05-10 | 2016-08-31 | 广州嘉检医学检测有限公司 | Mitochondrial genome library based on high-throughput sequencing and building method thereof |
| CN106350590A (en) * | 2016-09-06 | 2017-01-25 | 承启医学（深圳）科技有限公司 | DNA library construction method for high-throughput sequencing |
| CN108220393A (en) * | 2018-01-26 | 2018-06-29 | 广州海思医疗科技有限公司 | A kind of method of high-throughput quick detection mitochondrial gene mutation or missing |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111378732A (en) * | 2018-12-27 | 2020-07-07 | 北京希望组生物科技有限公司 | Mitochondrial genome sequencing primer, kit and method |
| CN111378732B (en) * | 2018-12-27 | 2022-08-23 | 北京希望组生物科技有限公司 | Mitochondrial genome sequencing primer, kit and method |
| CN110648720A (en) * | 2019-09-25 | 2020-01-03 | 广州微远基因科技有限公司 | Metagenome sequencing quality control prediction evaluation method and model |
| CN110648720B (en) * | 2019-09-25 | 2020-06-19 | 广州微远基因科技有限公司 | Metagenome sequencing quality control prediction evaluation method and model |
| CN111172255A (en) * | 2019-12-24 | 2020-05-19 | 中国烟草总公司郑州烟草研究院 | Screening and identifying method of CRISPR/Cas9 gene editing mutant |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108949942B (en) | 2020-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bennett et al. | Toward the $1000 human genome | |
| CN108949942A (en) | A kind of mitochondria genome sequencing method based on high-flux sequence | |
| WO2020233094A1 (en) | Molecular linker for ngs library construction, preparation method therefor and use thereof | |
| KR20130045636A (en) | Ssr primer derived from paeonia lactiflora and use thereof | |
| CA2906725C (en) | Characterization of biological material using unassembled sequence information, probabilistic methods and trait-specific database catalogs | |
| CN109337997B (en) | Camellia polymorphism chloroplast genome microsatellite molecular marker primer and method for screening and discriminating kindred species | |
| Boyanton, Jr et al. | DNA pyrosequencing–based identification of pathogenic Candida species by using the internal transcribed spacer 2 region | |
| CN111549146B (en) | Universal macro-barcode amplification primer for mitochondria of amphibians and application method thereof | |
| CN110863056A (en) | Method, reagent and application for accurately typing human DNA | |
| CN107841566B (en) | Composite amplification system for rapidly mutating short tandem repeat sequence of Y chromosome, kit and application | |
| CN108060237B (en) | Forensic medicine composite detection kit based on 55Y chromosome SNP genetic markers | |
| CN104988148B (en) | A kind of swamp type water buffalo SSR primers and its application | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN107815489B (en) | Method for screening plant high polymorphism molecular marker locus | |
| CN107365839B (en) | Primer for identifying deer animals and application thereof | |
| CN106086223B (en) | A kind of STR parting kit based on ZNA primer | |
| Matsumoto et al. | A novel approach to automated genotyping of Mycobacterium tuberculosis using a panel of 15 MIRU VNTRs | |
| WO2016119448A2 (en) | Artificial exogenous reference molecule for comparing types and natural abundance between microorganisms of different species and genera | |
| CN108546762A (en) | A kind of kit in 35 insertion/deletion sites for medical jurisprudence individual identification | |
| CN106755418A (en) | A kind of extron assembles sequence measurement | |
| CN108517364B (en) | Forensic medicine composite detection kit based on 56Y chromosome SNP genetic markers | |
| CN105331740B (en) | A kind of primer and method of quick 1 type of differentiation duck hepatitis A virus and 3 type PCR-HRM | |
| CN108823327A (en) | Camphor tree full-length genome SSR molecular marker and its preparation method and application | |
| CN108642190B (en) | Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers | |
| CN105219851B (en) | A kind of burnt sequencing quantitatively detects the method to methylate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |