CN108913713A - Improve recombinant expression carrier and the application of trichoderma reesei transformation efficiency - Google Patents
Improve recombinant expression carrier and the application of trichoderma reesei transformation efficiency Download PDFInfo
- Publication number
- CN108913713A CN108913713A CN201810819850.2A CN201810819850A CN108913713A CN 108913713 A CN108913713 A CN 108913713A CN 201810819850 A CN201810819850 A CN 201810819850A CN 108913713 A CN108913713 A CN 108913713A
- Authority
- CN
- China
- Prior art keywords
- sequence
- trichoderma reesei
- tel2
- tel1
- transformation efficiency
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to agricultural biological technical fields, and in particular to improve recombinant expression carrier and the application of trichoderma reesei transformation efficiency.The recombinant expression carrier of raising trichoderma reesei transformation efficiency of the invention by two sections of sequence constructs in plasmid vector, and is added between two sequences the recognition site of nuclease I-CeuI.Relative to the plasmid for being not added with above-mentioned sequence, the transformation efficiency of recombinant expression carrier of the invention improves 2 times or more.
Description
Technical field
The invention belongs to agricultural biological technical fields, and in particular to improve the recombinant expression carrier of trichoderma reesei transformation efficiency
And application.
Background technique
For trichoderma reesei as one of main filamentous fungi, yield of cellulase may be up to 100g/L, be cellulase
Main production bacterial strain.Trichoderma reesei has expression quantity height, secernment efficiency height, can be carried out post translational processing, such as glycosylation, albumen
The characteristics of cutting and the formation of disulfide bond of enzyme etc. are modified.Therefore, trichoderma reesei becomes attractive genetic engineering host
Bacterium is commonly used for being overexpressed cellulase and hemicellulase genes.
Compared to Escherichia coli and saccharomyces cerevisiae the two common heterologous gene expression systems, trichoderma reesei is that many cells are micro-
Biology has thicker cell wall, is unfavorable for filamentous fungi Efficient Conversion.The common method for transformation of trichoderma reesei has following at present
4 kinds：The conversion for the protoplast that PEG is mediated, the conversion of agrobacterium tumefaciens mediation, via Particle Bombardment Transformation, Electroporation Transformation.Existing skill
In art, most commonly used trichoderma reesei method for transformation is protoplast transformation.Classical PEG protoplast transformation method is not required to
Will be by external device, easy to operate, but that there are transformants is few for the method for transformation, and the phenomenon that positive rate is low, to a certain degree
On limit the high efficient expression of target gene.
Summary of the invention
Transformant in order to solve the problems, such as trichoderma reesei existing in the prior art is few, positive rate is low, and the present invention provides
A kind of recombinant expression carrier improving trichoderma reesei transformation efficiency, can be improved the transformation efficiency of trichoderma reesei.
The object of the present invention is to provide a kind of recombinant expression carriers for improving trichoderma reesei transformation efficiency.
Another object of the present invention is to provide the method for preparing the Richter scale wood enzyme of transformation efficiency raising.
Specific embodiment according to the present invention, improve trichoderma reesei transformation efficiency recombinant expression carrier in, gene table
It is sequentially connected with sequence TEL1 and sequence TEL2 up to the downstream of the target gene of box, the nucleotide sequence of the sequence TEL1 is such as
Shown in SEQ ID NO.1, the nucleotide sequence of the sequence TEL2 is as shown in SEQ ID NO.2.
According to the common knowledge of this field, the expression casette generally comprises promoter, purpose base by upstream to downstream
Cause, terminator, riddled basins and other regulating and controlling sequences.
Sequence TEL1 and sequence TEL2 can be inserted in the downstream of terminator by specific embodiment according to the present invention,
Or the downstream of riddled basins.
The nucleotide sequence SEQ ID NO.1 of sequence TEL1：
attaccctgttatccctaTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGG
GTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGtaactataacggtcctaaggtagcgaa
The nucleotide sequence SEQ ID NO.2 of sequence TEL2：
taactataacggtcctaaggtagcgaaCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC
CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAGCGATCGC
Specific embodiment according to the present invention is connected with nuclease I-CeuI identification between sequence TEL1 and sequence TEL2
Site.
Specific embodiment according to the present invention, the structure of the expression casette are from upstream to downstream and are followed successively by starting
Son, target gene, terminator, sequence TEL1, sequence TEL2, are connected with nuclease I-CeuI between sequence TEL1 and sequence TEL2
Recognition site.
Specific embodiment according to the present invention, promoter is cbh1 in the expression casette of recombinant expression carrier of the present invention
Promoter, the target gene are Dsred gene, and the terminator is cbh1 terminator；The structure of the recombinant expression carrier
For pPcbh1-Dsred-Tcbh1-pyr4-TEL1-TEL2, the nucleotide sequence of sequence TEL1 is as shown in SEQ ID NO.1, sequence
Nuclease I-CeuI recognition site is connected between column TEL1 and sequence TEL2.
The present invention provides the applications for the recombinant expression carrier for improving trichoderma reesei transformation efficiency.
The present invention provides the methods for improving trichoderma reesei transformation efficiency, and the method includes using the recombinant expression of transformation
Carrier converts the step of trichoderma reesei, is sequentially connected in the downstream of the target gene of the expression casette of the recombinant expression carrier
There are the nucleotide sequence of sequence TEL1 and sequence TEL2, the sequence TEL1 as shown in SEQ ID NO.1, the sequence TEL2's
Nucleotide sequence is as shown in SEQ ID NO.2.
Specific embodiment according to the present invention, the method for improving trichoderma reesei transformation efficiency, includes the following steps：
(1) expression casette is introduced into plasmid, obtains recombinant expression carrier, wherein the purpose of the expression casette
The downstream of gene has been sequentially connected with sequence TEL1 and sequence TEL2, the nucleotide sequence of the sequence TEL1 such as SEQ ID NO.1
Shown, the nucleotide sequence of the sequence TEL2 is as shown in SEQ ID NO.2；
(2) recombinant expression carrier is transformed into trichoderma reesei, obtains recombinant bacterial strain；
(3) recombinant bacterial strain is cultivated.
Specific embodiment according to the present invention, the method for improving trichoderma reesei transformation efficiency, in step (1), by sequence
Nuclease I-CeuI recognition site is connected between TEL1 and sequence TEL2.
Specific embodiment according to the present invention, the method for improving trichoderma reesei transformation efficiency, in step (1), building
PPcbh1-Dsred-Tcbh1-pyr4-TEL1-TEL2 plasmid expression vector.
Beneficial effects of the present invention：
Present invention calling sequence TEL1 and sequence TEL2 in the expression casette of recombinant expression carrier, wherein sequence TEL2
In the sequence that continuously repeats comprising 15 5 '-CCCTAA-3 ', and include in sequence TEL1 and the repeat region reverse complemental
Sequence.After being inserted into recombinant expression carrier in Richter scale wood enzyme, transformation efficiency improves 2 compared to the carrier for being not added with above-mentioned sequence
Times or more.
Detailed description of the invention
Fig. 1 shows the expression of Dsred gene in lactose flat band method detection transformant；
Fig. 2 shows copy number of the Dsred gene in transformant.
Specific embodiment
Embodiment 1
1. the recombinant plasmid of building expression red fluorescent protein：pPcbh1-Dsred-Tcbh1-Pyr4,pPcbh1-
Dsred-Tcbh1-Pyr4-TEL1-TEL2
Cbh1 promoter and TEL2 are connected in a manner of Overlap；DsRed and Tcbh1 are connected in a manner of Overlap；
Tri- segments of Pcbh1-TEL2, Dsred-Tcbh1, Pyr4-AmpR-Ori are connected by seamless spliced mode, obtain middle interstitial
Grain carrier.By TEL2-Pcbh1 segment, Dsred-Tcbh1 segment, Pyr4-AmpR-Ori segment, according to seamless spliced kit
Method connection.After being sequenced successfully, intermediate plasmid vector pPcbh1-Dsred-Tcbh1-Pyr4-TEL2 has just been obtained.It will be intermediate
Plasmid vector and TEL1 segment I-CeuI and SpeI double digestion after recycling segment, connect two segments with T4 ligase.22℃
1h is connected, after converting Escherichia coli Trans1, monoclonal verifying positive transformant is chosen, obtains recombinant plasmid vector pPcbh1-
Dsred-Tcbh1-Pyr4-TEL1-TEL2。
Pyr4-AmpR-Ori, cbh1 promoter, DsRed, cbh1 terminator are connected in seamless spliced mode.37℃
30min is connected, after converting Escherichia coli Trans1, chooses monoclonal verifying positive transformant.After being sequenced successfully, plasmid is just obtained
pPcbh1-Dsred-Tcbh1-Pyr4。
2. being transformed into trichoderma reesei with sequence plasmid containing TEL and the control plasmid without TEL sequence
Trichoderma reesei TU-6 is inoculated on potato culture medium (PDA) plate, 28 DEG C of stationary culture 7d wait for that it produces spore, by spore
Son is scraped and is inoculated in the PDB culture medium that 100ml contains uracil, 28 DEG C, 160rpm shaking overnight incubation.200 mesh mistakes
Filter collect sprout mycelia, the yeast wall breaking enzyme of 10mg/ml is added, 30 DEG C digestion 2-3 hours.It, will after collecting protoplast
Plasmid converts trichoderma reesei TU-6 bacterial strain.In the present invention, each conversion mixing liquid culture medium pours into 10 plates, to facilitate conversion
The counting of sub- number.
3. the counting of recombinant conversion
After recombinant plasmid transformed TU-6, after culture 4-5 days, to sequence plasmid containing TEL and the control plasmid without TEL sequence
Transformant number is counted, and the results are shown in Table 1：
The comparison of 1 transformant number of table
According to the experimental results, after sequence TEL being added, transformant quantity is improved more than 2 times.
4. naked-eye observation Dsred gene expression red fluorescent protein
Trichoderma reesei TU-6 bacterial strain is converted with the plasmid containing TEL and Dsred expression cassette, after culture 5-7 days.To monoclonal
After growing, the single transformant of picking is inoculated in 24 orifice plates of the lactose medium containing MM-, cultivates 5-7 days in 28 DEG C.During culture,
The color of observation conversion daughter colony, as shown in Figure 1, conversion daughter colony takes on a red color, it is seen that Dsred gene obtains in Richter scale wood enzyme
Expression.
5. extracting the genome of representative transformant
In order to verify in plasmid after addition TEL sequence, if it is to be inserted into trichoderma reesei TU-6 in the form of low-copy, this
Invention selects representative transformant from different promoters sample, extracts fungal gene group.
After the growth of representative transformant inoculation PDA plate, producing spore 7d, after meeting MM-glucose seed culture medium 2d, collect
Mycelia simultaneously press dry, and is sub-packed in 2ml EP pipe, freezes in liquid nitrogen rapidly.When extraction, divide 30s, extracting method with machine grinding mycelia 1
Referring to fungal agents box Fungal DNA Kit.
6. the identification of the plasmid vector copy number of transformant
The method that the identification of the copy number of transformant uses qRT-PCR, selects the cbh1 gene of single copy number as in
Ginseng, target gene of the DsRed as detection.
In different promoters, 4 plants of representative transformants having with fluorescence intensity of each selection, by genomic DNA
For concentration dilution to 1-2ng/ μ L, taking 1 μ l is template；With primer qcbh1F (5'-ATTCGGCGGATCCTCTTTCTC-3') and
Qcbh1R (5'-TGTGGAGGAGGTCTCGTTGTC-3') expands cbh1 gene, with primer pair qDsredF (5'-
GAGAAGCTGTACCCCCAGGAC-3') and qDsredR (5'-TGCCGGGCAGCTGCACGGGCT-3') expands Dsred gene.
The copy number of Dsred gene is with 2-△△CtMethod relative quantification.
DsRed gene and sequence TEL physical link on a plasmid vector, so DsRed copy number number can be with
Verify whether sequence TEL is inserted into trichoderma reesei in the form of low-copy.The qualification result of transformant copy number as shown in Fig. 2,
It can be seen that sequence TEL can guide Dsred gene to exist in the form of the low-copy of 1-2 copy in trichoderma reesei.
Sequence table
<110>Institute of Feeds,China Academy of Agriculture Sciences
<120>Improve recombinant expression carrier and the application of trichoderma reesei transformation efficiency
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 135
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
attaccctgt tatccctatt agggttaggg ttagggttag ggttagggtt agggttaggg 60
ttagggttag ggttagggtt agggttaggg ttagggttag ggttagggta actataacgg 120
tcctaaggta gcgaa 135
<210> 2
<211> 125
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
taactataac ggtcctaagg tagcgaaccc taaccctaac cctaacccta accctaaccc 60
taaccctaac cctaacccta accctaaccc taaccctaac cctaacccta accctaagcg 120
atcgc 125
Claims (9)
1. improving the recombinant expression carrier of trichoderma reesei transformation efficiency, which is characterized in that in the gene of the recombinant expression carrier
The downstream of the target gene of expression cassette has been sequentially connected with sequence TEL1 and sequence TEL2, and the nucleotide sequence of the sequence TEL1 is such as
Shown in SEQ ID NO.1, the nucleotide sequence of the sequence TEL2 is as shown in SEQ ID NO.2.
2. the recombinant expression carrier according to claim 1 for improving trichoderma reesei transformation efficiency, which is characterized in that sequence
Nuclease I-CeuI recognition site is connected between TEL1 and sequence TEL2.
3. the recombinant expression carrier according to claim 1 for improving trichoderma reesei transformation efficiency, which is characterized in that the base
Promoter, target gene, terminator, sequence TEL1, sequence TEL2, sequence are followed successively by because the structure of expression cassette is from upstream to downstream
Nuclease I-CeuI recognition site is connected between TEL1 and sequence TEL2.
4. the recombinant expression carrier according to claim 3 for improving trichoderma reesei transformation efficiency, which is characterized in that described to open
Mover is cbh1 promoter, and the target gene is Dsred gene, and the terminator is cbh1 terminator.
5. the application of the recombinant expression carrier described in claim 1 for improving trichoderma reesei transformation efficiency.
6. a kind of method for improving trichoderma reesei transformation efficiency, which is characterized in that the method includes using the recombination table of transformation
The step of converting trichoderma reesei up to carrier, sequentially connects in the downstream of the target gene of the expression casette of the recombinant expression carrier
The nucleotide sequence of sequence TEL1 and sequence TEL2, the sequence TEL1 are connected to as shown in SEQ ID NO.1, the sequence TEL2
Nucleotide sequence as shown in SEQ ID NO.2.
7. it is according to claim 6 improve trichoderma reesei transformation efficiency method, which is characterized in that the method includes with
Lower step：
(1) expression casette is introduced into plasmid, obtains recombinant expression carrier, wherein the target gene of the expression casette
Downstream be sequentially connected with the nucleotide sequence of sequence TEL1 and sequence TEL2, the sequence TEL1 as shown in SEQ ID NO.1,
The nucleotide sequence of the sequence TEL2 is as shown in SEQ ID NO.2；
(2) trichoderma reesei is converted using the recombinant expression carrier that step (1) obtains, obtains recombinant bacterial strain；
(3) recombinant bacterial strain is cultivated.
8. the method according to claim 7 for improving trichoderma reesei transformation efficiency, which is characterized in that in step (1), in sequence
It arranges and connects nuclease I-CeuI recognition site between TEL1 and sequence TEL2.
9. the method according to claim 7 for improving trichoderma reesei transformation efficiency, which is characterized in that in step (1), building
The structure of expression casette be from upstream to downstream and be followed successively by promoter, target gene, terminator, sequence TEL1, sequence TEL2,
Nuclease I-CeuI recognition site is connected between sequence TEL1 and sequence TEL2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810819850.2A CN108913713A (en) | 2018-07-24 | 2018-07-24 | Improve recombinant expression carrier and the application of trichoderma reesei transformation efficiency |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810819850.2A CN108913713A (en) | 2018-07-24 | 2018-07-24 | Improve recombinant expression carrier and the application of trichoderma reesei transformation efficiency |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108913713A true CN108913713A (en) | 2018-11-30 |
Family
ID=64416434
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810819850.2A Pending CN108913713A (en) | 2018-07-24 | 2018-07-24 | Improve recombinant expression carrier and the application of trichoderma reesei transformation efficiency |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108913713A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1330717A (en) * | 1998-10-06 | 2002-01-09 | 马克·阿龙·埃马尔法尔布 | Transformation system in field of flamentrous fungel hosts in chrysosporium |
| WO2008073914A2 (en) * | 2006-12-10 | 2008-06-19 | Dyadic International Inc. | Expression and high-throughput screening of complex expressed dna libraries in filamentous fungi |
| CN102304540A (en) * | 2011-08-26 | 2012-01-04 | 华东理工大学 | Expression equipment for expressing exogenous protein by secretion in trichoderma reesei and application of expression equipment |
| CN104011067A (en) * | 2011-12-22 | 2014-08-27 | 杜邦营养生物科学有限公司 | Polypeptides having glucoamylase activity and method of producing the same |
-
2018
- 2018-07-24 CN CN201810819850.2A patent/CN108913713A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1330717A (en) * | 1998-10-06 | 2002-01-09 | 马克·阿龙·埃马尔法尔布 | Transformation system in field of flamentrous fungel hosts in chrysosporium |
| WO2008073914A2 (en) * | 2006-12-10 | 2008-06-19 | Dyadic International Inc. | Expression and high-throughput screening of complex expressed dna libraries in filamentous fungi |
| CN102304540A (en) * | 2011-08-26 | 2012-01-04 | 华东理工大学 | Expression equipment for expressing exogenous protein by secretion in trichoderma reesei and application of expression equipment |
| CN104011067A (en) * | 2011-12-22 | 2014-08-27 | 杜邦营养生物科学有限公司 | Polypeptides having glucoamylase activity and method of producing the same |
Non-Patent Citations (6)
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107858346B (en) | Method for knocking out saccharomyces cerevisiae chromosome | |
| CN108728486A (en) | A kind of construction method of eggplant CRISPR/Cas9 gene knockout carriers and application | |
| CN107177625A (en) | The artificial carrier's system and directed mutagenesis method of a kind of rite-directed mutagenesis | |
| CN109536525B (en) | A kind of Dunaliella salina chloroplast homologous recombination empty carrier and its application | |
| CN1427079A (en) | Construction method of multigene carrier and its application | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| CN113604472B (en) | CRISPR/Cas gene editing system applied to Trichoderma reesei | |
| CN116515649B (en) | Transgenic method for improving heat stress resistance of beauveria bassiana | |
| CN105837672B (en) | Resistance relevant protein RtHKT1 and its encoding gene and application | |
| CN102433330B (en) | Recombinant plasmid for genetic transformation of pleurotus eryngii and application thereof | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN105274112B (en) | A kind of promoter of induced expression in acid condition | |
| CN108913713A (en) | Improve recombinant expression carrier and the application of trichoderma reesei transformation efficiency | |
| CN110592073A (en) | Method for directionally genetically modifying aspergillus oryzae gene based on CRISPR technology | |
| CN107177622B (en) | A kind of Agrobacterium tumefaciens mediated Italian mould genetic transforming method | |
| CN103173483B (en) | Using Candida glycerolgenesis feature 5.8S sequences as the pURGAP vector constructions of integration site and its application | |
| CN106636177A (en) | FLP/FRT gene knockout method of Candida amazonensis | |
| CN107058321B (en) | Application of miR156 and precursor thereof in regulation and control of wheat tillering number | |
| CN109234277B (en) | Cbh1 directionally-modified promoter Su-m3 with improved transcription efficiency and application thereof | |
| CN109234276B (en) | Su-m1 promoter with improved transcription efficiency and application thereof | |
| CN108841737A (en) | One plant of high yield nucleic acid saccharomyces cerevisiae engineered yeast containing Rpf1p gene and its construction method and application | |
| CN112481290B (en) | Method for improving citric acid fermentation production level based on morphological gene co-interference | |
| CN109825507B (en) | Plant drought-induced synthetic promoter SP18 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200825 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Applicant after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences Address before: 100081 Beijing, Zhongguancun, South Street, No. 12, No. Applicant before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181130 |