CN108913711B

CN108913711B - Method for inhibiting gene horizontal transfer

Info

Publication number: CN108913711B
Application number: CN201810774970.5A
Authority: CN
Inventors: 王永刚; 杨光瑞; 王玲; 陈凯; 马建忠; 冷非凡
Original assignee: Lanzhou University of Technology
Current assignee: Lanzhou University of Technology
Priority date: 2018-07-16
Filing date: 2018-07-16
Publication date: 2022-03-04
Anticipated expiration: 2038-07-16
Also published as: CN108913711A

Abstract

The invention discloses a method for inhibiting gene horizontal transfer, and relates to the fields of molecular biology and genetic engineering. The invention discloses a method for inhibiting gene horizontal transfer, which comprises the following steps: mixing the target exogenous plasmid with the loxP gene knocked-out competent host cell. By knocking out the loiP gene of the host cell, the transformation rate is reduced, and the method has the characteristic of remarkable reduction of transformation efficiency. Compared with wild host cells, the host cells with the knocked-out loiP genes have the advantages that the transformation efficiency of the host cells to the plasmid pUC19 is reduced by 3.33 times, the transformation efficiency of the host cells to the plasmid pET-32a is reduced by 8.38 times, and the transformation efficiency of the host cells to the plasmid p1304 is reduced by 2.75 times. The method greatly reduces the absorbing capacity of host cells to foreign plasmids and has very important significance for resisting the drug resistance of microorganisms.

Description

Method for inhibiting gene horizontal transfer

Technical Field

The invention belongs to the fields of molecular biology and genetic engineering, and particularly relates to a method for inhibiting gene horizontal transfer.

Background

In recent years, the emergence of many drug-resistant microorganisms, especially when "superbacteria" that are resistant to several antibiotics, has been promoted by the abuse of antibiotics, not only increasing the cost of medical care, but also posing a serious threat to the health of people. The microorganism can obtain the drug resistance capability, and the drug resistance DNA fragments are absorbed from the external environment mainly through the modes of transformation, conjugation and transduction and further integrated into the self genome or carried for the life in the form of plasmids. The present invention provides a method capable of reducing the transformation efficiency of foreign DNA, and is expected to provide a new approach for suppressing the emergence of drug-resistant bacteria.

Disclosure of Invention

In view of the problems of the prior art, it is an object of the present invention to provide a method for inhibiting gene level transfer. The method for transforming the plasmid can effectively reduce the transformation efficiency of the plasmid and effectively solve the problem of rapid spread of drug-resistant bacteria.

In order to solve the problems, the invention is realized as follows:

a method of inhibiting gene level transfer comprising: a plasmid transformation step; the above plasmid transformation step comprises: mixing the target exogenous plasmid with the loxP gene knocked-out competent host cell.

The loiP gene is located at positions 3081913-3082671 of the genome of E.coli, has an Id of 945173, is composed of 759 bases, and is present only in E.coli. The Id of the encoded protein loiP is NP-417411.2, and the primary structure of the protein is composed of 252 amino acids; the secondary structure consisted of 64.68% alpha-helix, 7.94% extension, 5.16% beta-turn and 22.22% random coil. The loiP has a conserved domain, a metallopeptidase that preferentially cleaves targets between Phe residues. When the bacteria are subjected to a low osmotic pressure medium, it is upregulated.

The research of the invention discovers for the first time that compared with wild host cells, the method can knock out the loiP gene of the host cells and improve the transformation efficiency of exogenous plasmids thereof. Based on the achievement, in the process of transforming the plasmid, the target exogenous plasmid is mixed with the competent host cell knocked out by the loiP gene for transformation, so that the transformation efficiency of the target exogenous plasmid can be reduced, the horizontal transfer of the exogenous gene is inhibited, and the method has very important significance for resisting the rapid diffusion of drug-resistant microorganisms.

Further, in some embodiments of the present invention, the above method comprises, prior to the plasmid transformation step: knocking out a loiP gene; the step of knocking out the loiP gene comprises the following steps: mixing the targeted fragment with a competent wild-type host cell; both ends of the targeting fragment contain homologous arm sequences homologous to the loiP gene.

It should be noted that, although the loiP gene is knocked out by homologous recombination in the above gene knock-out method, in some other embodiments, the loiP gene may be knocked out by other gene knock-out methods, and any method of knocking out the loiP gene by any method, such as complete knock-out, partial knock-out, or even inactivation by inhibiting the expression of the loiP gene by an RNAi interference vector, is within the scope of the present invention as long as the method is a method of making the loiP gene of the host cell not exert its function in the process of plasmid transformation.

Further, in some embodiments of the present invention, the targeting fragment further comprises a selectable marker gene.

In order to make the host cell with the knocked-out loiP gene easy to screen in subsequent experiments, it is advantageous to introduce a screening marker gene into the targeting fragment. The operator can conveniently screen out the positive recombinants by screening the marker genes. The type of selectable marker gene may be selected according to particular needs, including, for example, but not limited to, antibiotic resistance genes, fluorescent selectable marker genes, and the like.

Further, in some embodiments of the present invention, the selection marker gene is an antibiotic resistance gene.

Further, in some embodiments of the present invention, the antibiotic resistance gene is selected from the group consisting of kanamycin resistance gene (npt II), tetracycline resistance gene (tetR), chloramphenicol resistance gene (cat), ampicillin resistance gene (ampr), and hygromycin resistance gene (hpt).

Further, in some embodiments of the present invention, the base sequence of the above-mentioned targeting fragment is shown as SEQ ID NO. 1.

The gene LoiP can be effectively knocked out by transferring the gene into a wild host cell as shown in SEQ ID NO.1, the success rate is high, a kanamycin resistance gene is introduced, and a positive recon can survive on a flat plate containing kanamycin and then is screened out.

Is a homologous arm sequence; ____ is the FRT site;

is a kan fragment sequence.

Further, in some embodiments of the present invention, the method further comprises, before the step of knocking out the loiP gene: amplifying the target fragment; the target fragment amplification step comprises: the plasmid containing kanamycin resistance gene is used as a template, and PCR amplification is carried out by using an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO. 3.

Further, in some embodiments of the present invention, after the step of knocking out the loiP gene, the method further comprises: screening positive recombinants and removing screening marker genes;

the screening step of the positive recombinants comprises the following steps: identifying positive recombinants by using primers for detecting the screening marker genes;

the positive recombinants identified above also contain a selection marker gene, which needs to be deleted by a subsequent step.

The removing step of the screening marker gene comprises the following steps: a plasmid encoding the recombinant protein FLP was introduced into the above-mentioned positive recombinants to delete the selection marker gene. The screening marker gene in the positive recon can be deleted in the step, and the mutant which does not contain the screening marker gene and is knocked out of the loiP gene and can be used as a host cell is obtained. Avoid the influence of the screening marker gene on the mutant as host cell.

The recombinant protein FLP can specifically recognize FRT sites and cut off the sequence between the two FRT sites.

Further, in some embodiments of the present invention, the competent host cell is a cell using CaCl₂Competent Escherichia coli prepared by the method.

Further, in some embodiments of the present invention, the base sequence of the loiP gene is shown in SEQ ID No. 6.

The SEQ ID NO.6 is a loiP gene sequence in Escherichia coli, and of course, in other embodiments, different strains are adopted, and the loiP gene sequence has certain difference, but the invention also belongs to the protection scope of the invention as long as the loiP gene which is homologous with the SEQ ID NO.6 is knocked out.

The beneficial effects of the invention include:

the invention provides a method for inhibiting gene level transfer, which comprises the following steps: mixing a target exogenous plasmid with a host cell with a knockout competence of a loiP gene, knocking out the loiP gene of the host cell, reducing the transformation rate, and inhibiting gene horizontal transfer, wherein the method has the characteristics of obviously reducing the transformation efficiency, such as: compared with wild E.coli DH5 alpha and E.coli DH5 alpha with a knocked-out loiP gene, the transformation efficiency of delta loiP to plasmid pUC19 is reduced by 3.33 times, the transformation efficiency to plasmid pET-32a is reduced by 8.38 times, and the transformation efficiency to plasmid p1304 is reduced by 2.75 times.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is an electrophoretogram of PCR-amplified exogenous Carna-resistant targeting fragments in example 1 of the present invention;

FIG. 2 is a PCR identification electrophoretogram of a positive recombinant sub-colony of a kanamycin-resistant targeting fragment replacing a loiP gene in example 1 of the present invention; wherein, M is Marker, L is E.coli DH5 alpha control group, L1-L5 is E.coli DH5 alpha, Kan:. DELTA.loiP positive recon;

FIG. 3 is a PCR identification electrophoresis chart of the recombined kanamycin fragment lost mutant colonies in the example 2 of the present invention; wherein, M is Marker, L1 is E.coli DH5 alpha contrast group, L2 is E.coli DH5 alpha: delta loiP, L3 is E.coli DH5 alpha: Kan: delta loiP;

FIG. 4 is a plate count chart of the plasmid pUC19 transformed mutant strain E. coli DH 5. alpha.: DeltaloiP in example 3 of the present invention; wherein, A is E.coli DH5 alpha plasmid transformed pUC19 plate; b is E.coli DH5 alpha.delta loiP transformation plasmid pUC19 plate;

FIG. 5 is a plate count chart of E.coli DH5 alpha:. DELTA.loiP transformed by plasmid pET-32a in example 3 of the present invention; wherein, C is E.coli DH5 alpha transformation plasmid pET-32a plate; d is E.coli DH5 alpha. delta. loiP transformation plasmid pET-32a plate;

FIG. 6 is a plate count chart of E.coli DH5 alpha:: Δ loiP transformed by plasmid p1304 in example 3 of the present invention; wherein, E is E.coli DH5 alpha transformation plasmid p1304 plate; f is E.coli DH5 alpha:. delta. loiP transformation plasmid p1304 plate;

FIG. 7 is a graph showing statistics of the efficiency of mutant transformation on plasmids of different sizes; among these, plasmids of different sizes were pUC19, pET-32a and p1304, respectively.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

1. And (3) amplifying an exogenous linear targeting fragment containing the kanamycin resistance gene by PCR (polymerase chain reaction) to knock out the loiP gene:

(1) the plasmid pKD4 containing the kanamycin resistance gene is used as a template, primers K-loiP-F and K-loiP-R are used for amplifying a linear targeting fragment 'homology arm + FRT + Kan sequence + FRT + homology arm' of the kanamycin resistance gene through PCR, and detection is carried out by 1% agarose gel electrophoresis after amplification is finished.

The amplification system is shown in Table 1.

TABLE 1 Linear targeting fragment PCR System for exogenous Carna resistance genes

Name of reagent	Volume of
		5×prime STAR buffer(Mg²⁺+plus)	10μL
dNTP mixture(2.5mM each)	4μL
		K-loiP-F	1μL
K-loiP-R	1μL
		Template	1μL
Primer STAR HS DNA polymerase(2.5units/μL)	0.5μL
		Sterilized distilled water	Up to 50μL

(2) PCR amplification conditions: pre-denaturation: 95 deg.C for 5 min; denaturation: at 98 ℃ for 10 s; annealing: 56 ℃ for 30 s; extension: 72 deg.C, 2min10 s; 30 cycles; 72 deg.C, 5 min.

(3) Exogenous kana resistance gene targeting fragment amplification primer

K-loiP-F：ATTTTTAGAATAATCCTGACCTTGTGCGGAAGAGAAAACgtgtaggctggagctgcttc(SEQ ID NO.2)；

K-loiP-R：TATCTGACCTACGTTCGACACCACCAGGCTTTACTTAATatgggaattagccatggtcc(SEQ ID NO.3)；

The base sequence of the amplified targeting fragment is as follows (SEQ ID NO. 1):

ATTTTTAGAATAATCCTGACCTTGTGCGGAAGAGAAAACGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAAGATCCCCTCACGCTGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAGCTTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCATATTAAGTAAAGCCTGGTGGTGTCGSSCGTAGGTCAGATA

(4) amplification results

After the increase is finished, detecting by using 1% agarose gel electrophoresis, wherein the result is shown in figure 1, and the theoretical length is 1828 bp; FIG. 1 shows that there is a band around 1800 bp; according with the theoretical value.

(5) Sequencing

Sequencing and identifying the PCR product of the target fragment, wherein the result is consistent with the theoretical sequence.

2. Preparation of coli DH5 alpha/pKD 46 Electrotransformed competent cells

Plasmid pKD46 is transformed into E.coli DH5 alpha by CaCl2 transformation method, and positive transformant E.coli DH5 alpha/pKD 46 containing plasmid pKD46 is obtained by screening. Picking single colony of E.coli DH5 alpha/pKD 46, inoculating the single colony in 2mL LB liquid culture medium, shaking at 30 ℃ for overnight culture; inoculating bacterial liquid at a ratio of 1:100, culturing in 50mL LB liquid medium containing 100mM ampicillin, and growing until the bacterial concentration is OD₆₀₀When the concentration is approximately equal to 0.2, 100mM L-arabinose is added, and the growth is continued until the specific concentration is OD₆₀₀And after the concentration is approximately equal to 0.5, transferring the bacterial liquid to a precooled centrifugal tube, carrying out ice bath for 15min, centrifuging for 10min at the temperature of 4 ℃ at the speed of 5000r/min, and discarding the supernatant. Washing with precooled 10% glycerol once, centrifuging at 4 deg.C and 5000r/min for 10min, and discarding the supernatant; adding 500 μ L of sterilized 10% glycerol at 100 times concentration ratio, resuspending thallus, making into competent cells, subpackaging each tube with 100 μ L, and storing in-80 deg.C refrigerator for use.

3. Replacement of gene loiP in E.coli DH5 alpha wild type genome by exogenous kanamycin resistance gene targeting fragment

Adding 200ng of the PCR amplified targeting fragment into 100 mu L of prepared E.coli DH5 alpha/pKD 46 to electrically transform competent cells, gently mixing uniformly, transferring into a precooled 0.1cm electric shock cup for electric shock, quickly adding 1mL of SOC liquid culture medium after electric shock (the electric shock voltage is 1.8kv, and the electric shock time is 4.5 ms.), and recovering for 2h at the temperature of 150r/min and 37 ℃. And (3) transferring 200 mu L of the recovered bacterial liquid, coating the recovered bacterial liquid on an LB solid plate containing Kan (50 mu g/mL) resistance, inverting the plate, and culturing for 16-24 h in an incubator at 37 ℃.

4. Screening and identification of positive recombinants

5 single colonies growing on the kanamycin plate were picked up randomly with sterilized toothpicks, and spotted on a new kanamycin plate for culture at 37 ℃ for 12-16 h. The randomly picked 5 single colonies were PCR amplified with identifying primers.

Primer design

Designing and identifying primers I-loiP-F and I-loiP-R by using primer5.0 primer design software according to an E.coli MG1655 reference genome sequence provided by NCBI/Gene Bank; the PCR system is shown in Table 2:

I-loiP-F：CTCTGGATCATGCTCGCAT(SEQ ID NO.4)；

I-loiP-R：GCGCCTTATCCGACCTACGT(SEQ ID NO.5)。

TABLE 2 identification of PCR systems

	Volume of
		10×PCR buffer	5μL
dNTP mixture	3μL
		I-loiP-F	2μL
I-loiP-R	2μL
		Template	Bacterial colony
DNA polymerase	1μL
		Sterilized distilled water	Up to 50μL

And (3) PCR reaction conditions: pre-denaturation: 95 deg.C for 5 min; denaturation: 95 deg.C for 1 min; annealing: 56 ℃ for 30 s; extension: 72 ℃ for 45 s; 30 cycles; 72 deg.C, 5 min.

The product was detected by electrophoresis on a 1% agarose gel. The results are shown in figure 2, W1-W5 are all positive strains, the strains which are identified as positive are named as E.coli DH5 alpha:: Kan:: delta loiP, and the strains are preserved by a slant preservation method or a glycerol preservation method for later use.

Example 2

(1) Loss of the recombinant strain E.coli DH5 alpha:: Kan:: DeltaloiP kana resistant fragment (also understood as: removal or knock-out)

Temperature-sensitive plasmid pCP20 capable of encoding recombinant protein FLP is introduced into E.coli DH5 alpha:: Kan:: delta loiP recombinant strain by an electrotransformation method, resuscitated and cultured for 1h at 30 ℃ and 150r/min, 200 mu L of the recovered and cultured liquid is taken to be coated on LB plate culture medium containing 35 mu g/mL chloramphenicol, after 8h culture at 30 ℃, the temperature is raised to 42 ℃ for overnight culture, the heat-induced FLP recombinase is expressed, and the plasmid is lost.

(2) Screening and identification of mutant strain E.coli DH5 alpha:. DELTA.loiP

Randomly picking 5 single colonies growing on a chloramphenicol plate by using sterile toothpicks, respectively inoculating each single colony on the chloramphenicol plate, an ampicillin plate and an antibiotic-free plate, culturing for 12-16 h at 37 ℃, and preliminarily identifying the colony which only can grow on the antibiotic-free plate as an E.coli DH5 alpha:: delta loiP positive mutant strain with lost plasmid; if the strain can grow on any one of ampicillin and chloramphenicol, the culture is continued at 42 ℃ until the strain can only grow on the antibiotic-free plate. The colonies which can only grow on the antibiotic-free plate are subjected to PCR identification by using identification primers I-loiP-F and I-loiP-R.

Identification of the primers used:

I-loiP-F：CTCTGGATCATGCTCGCAT(SEQ ID NO.4)；

I-loiP-R：GCGCCTTATCCGACCTACGT(SEQ ID NO.5)；

TABLE 3 identification of PCR systems

The product was detected by electrophoresis on a 1% agarose gel. As a result, as shown in FIG. 3, L1 is a PCR band of the wild type strain identifying primer; l3 is a positive mutant strain E.coli DH5 alpha after the gene loiP is successfully deleted, delta loiP identification band; l2 is a strain E.coli DH5 alpha:: kan:: delta loiP identification band after homologous replacement of gene loiP by a targeted fragment. The strain identified as a positive mutation was designated E.coli DH5 alpha:. DELTA.loiP and was preserved by the glycerol and slant storage methods. The results indicated that the loiP gene was successfully deleted.

Example 3

Determination of transformation efficiency of mutant Strain E.coli DH5 alpha:. DELTA.loiP

With 100mM CaCl₂Respectively preparing wild type E.coli DH5 alpha and mutant strain E.coli DH5 alpha, delta loiP competent cells, and diluting plasmids pUC19, pET-32a and p1304 to 5 ng/mu L. Add 2. mu.L of the mixture into 100. mu.L of each of the two competencies, mix gently, and ice-wash for 30 min. The mixture is heated for 90s at 42 ℃, ice-washed for 2min, and 900 μ L of LB culture solution is added at 37 ℃ and 180r/min for 50 min. 100 μ L of each was spread on LB plates, cultured overnight at 37 ℃ and counted.

Conversion efficiency ═ dilution x number of transformants x volume of conversion stock solution)/volume of coating bacteria solution/mass of DNA (μ g)

The results are shown in FIGS. 4-7, which show that the transformation efficiencies of competent cells of wild type E.coli DH 5. alpha. and mutant E.coli DH 5. alpha.: Δ loiP to plasmid pUC19 were 6.29X 10, respectively⁶CFU/. mu.g and 1.89X 10⁶CFU/μg；

The transformation efficiencies of the plasmids pET-32a were 4.58X 10, respectively⁶CFU/. mu.g and 5.5 in10⁵CFU/μg；

The transformation efficiencies for plasmid p1304 were 5.15X 10, respectively⁵CFU/. mu.g and 1.87X 10⁵CFU/μg；

Compared with the wild E.coli DH5 alpha, the transformation efficiency of the mutant E.coli DH5 alpha to the plasmid pUC19 by delta loiP is reduced by 3.33 times. The transformation efficiency on plasmid pET-32a was reduced by 8.38 times. The transformation efficiency for plasmid p1304 decreased by a factor of 2.75. The results are combined to show that the deletion of the gene loiP can enable 100mM CaCl₂Transformation efficiency of competent cells formed by E.coli DH5 alpha to plasmids is obviously reduced under induction, gene horizontal transfer is inhibited, and then the capacity of microorganisms to absorb drug-resistant DNA fragments from the external environment is prevented or reduced.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> university of Rituo-Risk of Lanzhou

<120> a method for inhibiting gene level transfer

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 1574

<212> DNA

<213> Artificial sequence

<400> 1

atttttagaa taatcctgac cttgtgcgga agagaaaacg tgtaggctgg agctgcttcg 60

aagttcctat actttctaga gaataggaac ttcggaatag gaacttcaag atcccctcac 120

gctgccgcaa gcactcaggg cgcaagggct gctaaaggaa gcggaacacg tagaaagcca 180

gtccgcagaa acggtgctga ccccggatga atgtcagcta ctgggctatc tggacaaggg 240

aaaacgcaag cgcaaagaga aagcaggtag cttgcagtgg gcttacatgg cgatagctag 300

actgggcggt tttatggaca gcaagcgaac cggaattgcc agctggggcg ccctctggta 360

aggttgggaa gccctgcaaa gtaaactgga tggctttctt gccgccaagg atctgatggc 420

gcaggggatc aagatctgat caagagacag gatgaggatc gtttcgcatg attgaacaag 480

atggattgca cgcaggttct ccggccgctt gggtggagag gctattcggc tatgactggg 540

cacaacagac aatcggctgc tctgatgccg ccgtgttccg gctgtcagcg caggggcgcc 600

cggttctttt tgtcaagacc gacctgtccg gtgccctgaa tgaactgcag gacgaggcag 660

cgcggctatc gtggctggcc acgacgggcg ttccttgcgc agctgtgctc gacgttgtca 720

ctgaagcggg aagggactgg ctgctattgg gcgaagtgcc ggggcaggat ctcctgtcat 780

ctcaccttgc tcctgccgag aaagtatcca tcatggctga tgcaatgcgg cggctgcata 840

cgcttgatcc ggctacctgc ccattcgacc accaagcgaa acatcgcatc gagcgagcac 900

gtactcggat ggaagccggt cttgtcgatc aggatgatct ggacgaagag catcaggggc 960

tcgcgccagc cgaactgttc gccaggctca aggcgcgcat gcccgacggc gaggatctcg 1020

tcgtgaccca tggcgatgcc tgcttgccga atatcatggt ggaaaatggc cgcttttctg 1080

gattcatcga ctgtggccgg ctgggtgtgg cggaccgcta tcaggacata gcgttggcta 1140

cccgtgatat tgctgaagag cttggcggcg aatgggctga ccgcttcctc gtgctttacg 1200

gtatcgccgc tcccgattcg cagcgcatcg ccttctatcg ccttcttgac gagttcttct 1260

gagcgggact ctggggttcg aaatgaccga ccaagcgacg cccaacctgc catcacgaga 1320

tttcgattcc accgccgcct tctatgaaag gttgggcttc ggaatcgttt tccgggacgc 1380

cggctggatg atcctccagc gcggggatct catgctggag ttcttcgccc accccagctt 1440

caaaagcgct ctgaagttcc tatactttct agagaatagg aacttcggaa taggaactaa 1500

ggaggatatt catatggacc atggctaatt cccatattaa gtaaagcctg gtggtgtcgs 1560

scgtaggtca gata 1574

<210> 2

<211> 59

<212> DNA

<213> Artificial sequence

<400> 2

atttttagaa taatcctgac cttgtgcgga agagaaaacg tgtaggctgg agctgcttc 59

<210> 3

<211> 59

<212> DNA

<213> Artificial sequence

<400> 3

tatctgacct acgttcgaca ccaccaggct ttacttaata tgggaattag ccatggtcc 59

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence

<400> 4

ctctggatca tgctcgcat 19

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

gcgccttatc cgacctacgt 20

<210> 6

<211> 759

<212> DNA

<213> Artificial sequence

<400> 6

atgaaaattc gcgccttatt ggtagcaatg agcgtggcaa cggtactgac tggttgccag 60

aatatggact ccaacggact gctctcatca ggagcggaag cttttcaggc ttacagtttg 120

agtgatgcgc aggtgaaaac cctgagcgat caggcatgtc aggagatgga cagcaaggcg 180

acgattgcgc cagccaatag cgaatacgct aaacgtctga caactattgc caatgcgcta 240

ggcaacaata tcaacggtca gccggtaaat tacaaagtgt atatggcgaa ggatgtgaac 300

gcctttgcaa tggctaacgg ctgtatccgc gtctatagcg ggctgatgga tatgatgacg 360

gataacgaag tcgaagcggt gatcggtcac gaaatggggc acgtggcgtt aggccatgtg 420

aaaaaaggaa tgcaggtggc acttggtaca aatgccgtgc gagtagctgc ggcctctgcg 480

ggcgggattg tcggaagttt atctcaatca caacttggta atctgggcga gaaattagtc 540

aattcgcaat tctcccagcg ccaggaagca gaagccgatg attattctta cgatcttctg 600

cgccaacgcg gcatcagccc ggcaggtctt gccaccagct ttgaaaaact ggcaaaactg 660

gaagaaggtc gccaaagctc aatgtttgac gaccatcctg catccgccga acgcgcccag 720

catattcgcg atcgcatgag cgcggatggg attaagtaa 759

Claims

1. A method of inhibiting gene level transfer, comprising: a plasmid transformation step; the plasmid transformation step comprises: mixing the target foreign plasmid withloiPMixing the knockout competent host cells; the competent host cell adopts CaCl₂Competent Escherichia coli prepared by the method.

2. The method according to claim 1, wherein prior to the plasmid transformation step, the method comprises:loiPgene knockout step; the above-mentionedloiPThe gene knockout step comprises: mixing the targeted fragment with a competent wild-type host cell; both ends of the targeting segment containloiPHomologous arm sequences of gene homology.

3. The method of claim 2, wherein the targeting fragment further comprises a selectable marker gene.

4. The method of claim 3, wherein the selectable marker gene is an antibiotic resistance gene.

5. The method according to claim 4, characterized in that the antibiotic resistance gene is selected from the group consisting of kanamycin resistance gene (npt II), tetracycline resistance gene (tetR), chloramphenicol resistance gene (cat), ampicillin resistance gene (ampr) and hygromycin resistance gene (hpt).

6. The method according to any one of claims 2 to 5, wherein the base sequence of the targeting fragment is represented by SEQ ID No. 1.

7. The method of claim 6, wherein the step of removing the metal layer is performed in a batch processloiPPrior to the gene knockout step, the method further comprises: amplifying the target fragment; the target fragment amplification step comprises: the plasmid containing kanamycin resistance gene is used as a template, and PCR amplification is carried out by using an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO. 3.

8. The method according to any one of claims 3 to 5, wherein the method is carried out in a reactorloiPFollowing the gene knockout step, the method further comprises: screening positive recombinants and removing screening marker genes;

the screening marker gene removing step comprises: a plasmid encoding the recombinant protein FLP was introduced into the positive recombinants to delete the selection marker gene.

9. The method according to any one of claims 2 to 5,loiPthe base sequence of the gene is shown in SEQ ID NO. 6.