CN108912225A - One kind being based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel and purposes - Google Patents
One kind being based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel and purposes Download PDFInfo
- Publication number
- CN108912225A CN108912225A CN201810843478.9A CN201810843478A CN108912225A CN 108912225 A CN108912225 A CN 108912225A CN 201810843478 A CN201810843478 A CN 201810843478A CN 108912225 A CN108912225 A CN 108912225A
- Authority
- CN
- China
- Prior art keywords
- vhh
- antibody
- concentration
- goat capripoxvirus
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/535—Production of labelled immunochemicals with enzyme label or co-enzymes, co-factors, enzyme inhibitors or enzyme substrates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/01—DNA viruses
- G01N2333/065—Poxviridae, e.g. avipoxvirus
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides one kind to be based on the anti-capripox virus VHH-4-1 of two-humped camel and purposes, belong to field of biotechnology, include anti-goat capripoxvirus VHH-4-1, screening, expression, purifying, functionalization label and the activity verifying of VHH-4-1, concentration, the purifying of goat capripoxvirus, the optimization etc. of kit indices.Kit provided by the invention is avoided primary antibody, secondary antibody and antiantibody, is improved sensitivity, stability, shorten the time, saved resource due to the VHH-4-1 for having used functionalization to mark.Breach the defects of traditional Elisa method is time-consuming, laborious.It is proposed of the invention is the methods for clinical diagnosis for establishing sensitive goat capripoxvirus, and the infection mechanism for studying virus lays the foundation；Also Elisa kit is competed for the goat capripoxvirus antibody solid phase that the present invention develops provide key mark object；In addition, improving sensitivity through cell expansion culture, concentration, after purification as envelope antigen using goatpox Attenuate vaccine.
Description
Technical field
The invention belongs to field of biology, are related to Bactrian camel source, in particular to a kind of based on the anti-goatpox disease of Bactrian camel source
Malicious VHH-4-1 and purposes.
Background technique
Sheep pox is to cause sheep, goat fever, few hair or hairless portion by sheep pox/goat capripoxvirus or mixed infection
A kind of mucocutaneous acute, the hot, highly contagious disease that papule or bleb occurs in position, it is institute that disease incidence, case fatality rate are high
There is one kind the most serious in animal acne disease.Because of itself and sheep infective warts（It is commonly called as sore mouth virus）There are similar in clinical symptoms
Property, the intercrossing of serological reaction and taking place frequently for visceratonia sheep pox cause bigger difficulty to making a definite diagnosis for the disease.
Single domain antibody（VHH）It is to be currently available with stable structure, fully functional, in combination with antigen most brief summary
Structure unit, due to its immunogenicity is low, easy expression, affinity is high, heat-resisting the features such as, it is targeting diverting agent, chemical sensor, antitoxin
Serum and antiviral immunity preparation, are increasingly being applied to the fields such as biological detection, diagnosis, pharmacy, become current molecular
The important target molecule of image research.In recent years researcher successively apply foot-and-mouth disease virus resistant VHH, swine fever virus resistant VHH and
Resisting porcine circovirus VHH etc. not only carries out foot and mouth disease virus, swine fever virus and the external tracer study of pig circular ring virus, at the same also into
The study on monitoring of corresponding serum antibody is gone（Di Wang et al. Characterization of single-domain
antibodies against Foot and Mouth Disease Virus (FMDV) serotype O from a
camelid and imaging of FMDV in baby hamster kidney-21 cells with single-
domain antibody-quantum dots probes[J] BMC Veterinary Research (2015) 11:120.
Shunli Yang et al. A phage-displayed single domain antibody fused to alkaline
phosphatase for detection of porcine circovirus type2[J]. Journal of
Virological Methods 213 (2015) 84–92. Specific detection of foot-and-mouth
disease serotype Asia 1 virus by carboxyl-magnetic beads conjugated with
single-domain antibody BMC Biotechnology (2015) 15:83.）.Wang etc. is with recombinant rat lung
As antigen, the single domain antibody Nb17 of SPA can be specifically bound and prove that the single domain of anti-SPA is anti-SPA by being generated by immune alpaca
It is integrated to physical efficiency high-affinity rat lung, then by acting on the research of rat acute and chronic toxicity to Nb17 antibody
It was found that Nb17 antibody not will lead to the apparent Histological change of Organism of Rats, therefore determine that it is peace that Nb17 antibody, which is applied to rat,
Complete.（Wang SM, He X, Li N, et al. A novel nanobody specific for re spiratory
Surfactant protein A has potential for lung targeting [ J ] .Int J Nanomed, 2015,
10：2857-2869. ）Single domain antibody is also used widely in canine parvovirus, canine distemper.But it is needed when carrying out ELISA
Primary antibody, secondary antibody are used, it is time-consuming and laborious, experimental implementation process is cumbersome, it is at high cost；In addition, using some albumen is expressed as packet
By antigen, reduce accuracy and sensibility.
Summary of the invention
Time-consuming, laborious using primary antibody, secondary antibody in the prior art in order to solve, at high cost, accuracy and sensibility are low not
Foot, the present invention develop the key mark object of anti-capripox virus, provide a kind of anti-based on the anti-goat capripoxvirus single domain of Bactrian camel source
Body VHH-4-1.
To solve the above problems, present invention employs following technical proposals：
Present invention firstly provides one kind to be based on the anti-capripox virus VHH-4-1 of two-humped camel, specifically includes following steps：
Step（1）:Amplification obtains about 400bp genetic fragment：
Using hunchbacked source single domain antibody homology arm primer from construction cDNA antibody library（See publication number 201610281583.9）Middle expansion
Increase single domain antibody gene, 900bp VH-CH1-CH2Hinge area, 600bp are VHH-CH2 hinge area, and VHH about 400bp coagulates respectively
Glue recycles 900 and 600bp band, expands 400bp segment again on this basis, and gel recycles all 400 bands, carries respectively with T
Body is attached, and converts JM109 competent cell, is chosen spot, is shaken bacterium, identification, verifies suitable sequence and be sequenced.
The 50ul reaction system of foundation is：25ul Ex Taq mix 25ul, specific aim upstream and downstream each 1ul of primer, template
1ul（CDNA library plasmid）, ddH2O 22ul, amplification condition：95 DEG C of 3min, 95 DEG C of 50s, 54 DEG C of 50s, 35times,
72℃ 50s.Three segments are consistent.
Step（2）:Fragment sequence compares：
The sequence for obtaining 400bp or so band is compared with Fig. 1 single domain antibody frame, the sequence for meeting frame structure is then recognized
To be anti-capripox virus VHH single domain antibody sequence.
The present invention is to the expression and verifying obtained above based on the anti-capripox virus VHH in camel source：
VHH vector construction of the present invention and the expression of VHH albumen, purifying, functionalization：Including VHH-4-1 gene and efficient protokaryon table
Up to the building of carrier pMal-c2X, which utilizes " tac " strong promoter and malE transcription start signal, target gene to be inserted into
Escherichia coli malE gene downstream, N-terminal have amalgamation and expression maltose-binding protein MBP label, are convenient for albumen solubility table
It reaches, expression product is the fusion protein of purpose gene and MBP, is positioned at periplasmic, and C-terminal has His label, convenient for albumen parent
And chromatographic purifying.
Step（1）：VHH-4-1 vector construction and expression：Above-mentioned VHH-4-1 sequence is cloned and is connected to pMal-c2X table
Up to carrier, BL21 competent cell is converted, suitable clones carry out a small amount of inducing expressions；
A small amount of expression products are detected through SDS-PAGE and find differential band；
To the 100ml thallus of great expression harvest, through 200W, ultrasonic 3s suspends 4s, and 99 ultrasounds of ultrasound crack, 12000rpm,
4 DEG C of centrifugations, 50min collect supernatant and precipitating, and a small amount of sample is taken to do SDS-PAGE detection, carry out recombinant protein solubility point
Analysis, remaining supernatant and be deposited in -80 DEG C of refrigerator it is spare；
The expression condition of the VHH-4-1 albumen is：Thallus ultrasonication parameter is set as 200 W of power, 3 s of ultrasound, pause 4
S, 99 circulations；IPTG inducer is to final concentration of 0.5 mM, 30 DEG C of induction 3h.
When VHH-4-1 protein purification, finally eluting albumen with buffer is NTA-200, i.e. the NTA base of the imidazoles containing 200mM
Plinth buffer, VHH-4-1 protein concentration is 5.6ng/ul after purification.
Step（2）：The verifying of VHH-4-1 protein active
2.1 purifying proteins and culture, concentration, the WB activity verifying of purified goat acne Attenuate vaccine：
Firstly, recovery vero cell, 1:3 secondary cultures, be inoculated with goatpox Attenuate vaccine, while set do not connect poison be compare, F5 generation
Expand culture afterwards, centrifugation removes cell fragment, is concentrated by ultrafiltration, purifying, with positive and negative serum orthogonal reaction, determines that antigen most preferably wraps
By concentration, MBP ELIAS secondary antibody optium concentration verifies the reactivity and reaction density of VHH-4-1；Then 1:100 dilutions are dense
Contracting virus, is added 4x albumen sample-loading buffer, boils 10min, loading 20ul carries out SDS-PAGE electrophoresis, while adding albumen
Antigen is gone to pvdf membrane, condition with half-dried transferring film method by Marker：Film is transferred to 5% skimmed milk power by 2.5A, 25V, 10min
In TBST solution, 2h is closed, TBST is rinsed, VHH primary antibody 1:500,4 DEG C of overnight incubations, MBP ELIAS secondary antibody 1:1000,37 DEG C incubate
Educate 2h.Finally with Enhanced chemiluminescence (ECL) observation exposure band.That have trace band is the VHH-4- for having reactivity
1。
The verifying of 2.2 VHH-4-1 purifying protein neutralization activities：
2.2.1 goatpox Attenuate vaccine cell toxicant valence is measured：
Divide kind after 96 porocyte culture plates, 48h according to a certain percentage in normal vero cell, inhales and abandon culture solution, 10 times of multiple proportions
The cell toxicant cultivated in dilution 4.1,8 holes i.e. one are classified as a repetition, and altogether plus 10 gradients, the 11st and 12 are classified as negative control,
It observed after 144h, calculate TCID50。
2.2.2 fixed virus, dilution VHH-4-1 are carried out in cell and are tested：
On 96 hole Microtitration plates, with dilution by VHH-4-1 make a series of doubling dilutions (filtration sterilization to prevent pollution
Cell), making its dilution is respectively 1:2,1:4,1:8,1:16,1:32,1:64,1:128, every hole content is 50ul, each dilute
Degree of releasing makees 4 holes.Make 200TCID by malicious valence after measured50Dilution（It is mixed with equivalent certain proportion dilution VHH-4-1, malicious valence is
100TCID50）, i.e. every hole is added 50ul virus liquid, seals lid, is placed in 37 DEG C of incubators and 1h.
Cell suspension is added, when preparing cell suspension, concentration is to be degree in the single layer that covers with interior for 24 hours：In serum-virus
It after 1h, takes out, 100ul cell suspension is added in every hole.Set 5%CO2 37 DEG C of incubator cultures, since culture 3d observe note day by day
Record, 144h sentence eventually.
Set up control：Positive and negative serum control is inactivated：It is positive and negative serum is parallel with VHH-4-1 progress tries
It tests, cytopathy should not occur in positive serum controls, and cytopathy should occur in negative serum control；Meanwhile 0.1TCID50Disease
Malicious hole should not cause cytopathy, and 100TCID50Hole must cause cytopathy, and otherwise the test is untenable；In addition, setting
It attentions normal cell control well, minimum dilution VHH-4-1 is toxicity control hole.Calculate to obtain neutralization index as having greater than 50
The anti-capripox virus VHH-4-1 single domain antibody of neutralization activity.
Above-mentioned gained VHH-4-1 meets in expressing, having in supernatant after vector construction, expression and activity verifying
With and reactivity the VHH-4-1 being only truly, be specifically shown in, SEQ ID NO:1：
CATGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGTAGCCT
CTGGATTCAACTTCAGTCGCTATGACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGAGACTCGAGTGGGTCTCCACG
TCTAAGAGGATTGATAATACATACTACCCATACGATGCAGATTTCGTGAAGGGCCGATTCACCATCTCCAGAGACAA
TGCCAAGAACACGCTATACCTCCAATTGAACAGCCTGAAAACTGAGGACACGGCCATGTATTACTGTAGCCGGTCAG
GGATTGGCGAGACCGTCTCCGTTAAGAGTAAGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
The present invention marks the purifying of VHH-4-1 albumen and functionalization, specific as follows：
Step（1）：The purifying of VHH-4-1 albumen：
1.1 by the VHH-4-1 strain further expansion culture of above-mentioned identification, after inducing expression, collects thallus, ultrasound centrifugation, and
Supernatant is filtered with 0.45 μm of filter, for use；
1.2 take Ni column to drain off, and wash 3-5 column volume, wash 3 column volumes with the EDTA of 0.1M；3-5 column volume is washed,
NTA-0 (pH8.0) washes 3 column volumes；NiSO4 washes 5 column volumes, drains off；Low pH4.0 equilibrium liquid washes 3 column volumes；NTA-0
(pH8.0) it is identical as NTA-0 pH to be washed till efflux；
1.3 use 1ml/min loading flow velocity loading；It is complete to sample solution stream；
1.4 wash pillar with 20mM, 60mM, 200mM and 500mM imidazoles collects trickle respectively, and it is pure that SDS-PAGE analyzes albumen
Degree and concentration, band is most bright as to elute protein concentration with corresponding concentration.
Wash-out concentration 200mM imidazoles when the VHH-4-1 protein purification, the concentration 5.6ng/ after VHH-4-1 protein purification
ul。
Step（2）：Functionalization label：
The functionalization of the VHH-4-1 albumen, i.e. horseradish peroxidase carry out protein labeling, labeling method：HRP is dissolved in steaming
In distilled water, Fresh sodium periodate aqueous solution is added, mixes, sets 4 DEG C, 30min is oxidized to the polysaccharide of HRP molecular surface
Aldehyde radical is added glycol water, antibody purification is added after room temperature 30min, mix, and fill bag filter, makes on aldehyde radical and antibody
Amino form schiff alkali and combine, be then sucked out, add sodium borohydride solution, reduction forms stable enzymic-labelled antibody, institute
It must be the antibody of HRP label.
In the kit after antigen, concentrated antigen, VHH-4-1 and functionalization active concentration determination：
Using indirect Elisa detection method, antigen, concentrated antigen and functionalization protein active concentration 96 are determined with upright titration experiments
Laterally coating various concentration dilutes antigen, concentrated antigen respectively on orifice plate, and next day, closing, 37 ° are incubated for, and board-washing is longitudinal to be added not
With concentration dilution VHH-4-1 antibody, functionalization VHH-4-1 antibody protein, 37 ° of incubations, VHH-4-1 antibody uses anti-MBP enzyme mark
Secondary antibody, then plus substrate colour developing, when measurement function protein active concentration, directly add substrate to develop the color, and last sulfuric acid terminates.Gained
It is concentrated antigen and functionalization VHH-4-1 protein active concentration that best OD450, which corresponds to dilution,.
Antigen coat concentration 1 in the kit:160, concentrated antigen peridium concentration 1:800, VHH-4-1 single domain antibodies are anti-
Answer potency 1:640, after functionalization marks, reaction potency is 1:1000.
Compared with the prior art, the advantages of the present invention are as follows：The present invention passes through based on the anti-capripox virus antibody library in hunchbacked source
It successfully screens specificity and has that relative molecular mass is small, stability is strong, soluble good, antigen knot for one kind of capripox virus
Advantages and the anti-goat capripoxvirus VHH-4-1 single domain antibodies with neutralization activity such as good, the easy expression of performance are closed, it is sensitive to establish
The methods for clinical diagnosis of capripox virus, the infection mechanism for studying virus lay the foundation；Also developing for the present invention has completely certainly
The capripox virus antibody solid phase competition Elisa kit of main intellectual property provides key mark object；In addition, weak using goatpox
Malicious seedling through cell expansion culture, concentration, after purification be used as envelope antigen, improve sensitivity and recall rate.It is controlled for sheep pox early stage
It treats and diagnosis provides new technological means.
The present invention successfully screens one plant of anti-goat capripoxvirus single domain antibody VHH-4-1, which is expressed with soluble form, easily
In purifying, specificity is good, does not react with sore mouth virus, small anti-Attenuate vaccine antigen and normal vero cell, is neutralized with certain proportion
Goat capripoxvirus, concentrated antigen peridium concentration 1:800, enzyme label after VHH-4-1, neutralize antigen active reach 1:1000,
It determines and sets up Elisa kit indices, which shortens because primary antibody, secondary antibody and antiantibody is omitted
Reaction time has saved resource, and the solid phase competitive ELISA method of foundation is accurate, stablizes, is reliable, not only simplifies test operation step
Suddenly, the time has been greatly shortened, and has reduced costs；Because of envelope antigen（1:800）For concentration, the weak poison of purified goat acne totivirus
Strain, improves sensitivity and stability, breaches the defects of traditional Elisa method is time-consuming, laborious, belong to pioneering.
Detailed description of the invention
Fig. 1 .VHH gene frame diagram；
Fig. 2 is the fragments gel electrophoretogram for directly expanding cDNA library and obtaining；
Fig. 3 is that set expands the real VHH genetic fragment gel electrophoresis figure of gained after Fig. 2 genetic fragment；
Fig. 4 is VHH4-1 inducing expression SDS-PAGE analysis；
In Fig. 4：Before 1 inducing expression, 2 is after inducing expression, M are molecular weight of albumen Marker；
Fig. 5 is VHH4-1 albumen soluble analysis SDS-PAGE figure；
In Fig. 5：M is molecular weight of albumen Marker, supernatant after inducing expression, and 2 is precipitate after inducing expression；
Fig. 6 is VHH4-1 protein SDS-PAGE figure after purification；
In Fig. 6：1 is molecular weight of albumen Marker, and 2 elute VHH4-1 albumen for 200mM imidazoles；
Fig. 7 is normal vero cell；
Fig. 8 is the vero cell that lesion occurs after being inoculated with goatpox Attenuate vaccine；
Fig. 9 is the WB activity proof diagram that VHH4-1 albumen and purifying antigen carry out；
Figure 10 is enzyme mark VHH4-1 protein active proof diagram.
Specific embodiment
The present invention is described in further detail with reference to the accompanying drawings and embodiments.
Experimental material and reagent：YEAST EXTRACT ,TRYPTONE （OXOID）, ampicillin sodium（Merck）, sulphur
Sour kanamycins（Amresco）, dialysis cartridge（Haidylena）, Minimum Essential Medium, 1:250 Trypsin
（Purchased from GIBCO company）, Sodium Pyruvate（Purchased from Shanghai Zheng Xiang chemical reagent research institute）, prepare cell culture fluid and pancreatin cell
Digestive juice；Newborn bovine serum（Purchased from Lanzhou Rong Ye Biotechnology Co., Ltd）；Premix Taq version2.0 ,DNA
GelExtraction Kit、DNA ligation Kit、TaKaRa MiniBEST DNA Fragment Purification
Kit, JM109 competent cell and PCR related reagent are purchased from TaKaRa；MBP ELIAS secondary antibody is purchased from abcam, sheep pox antibody
Detection kit is purchased from R&D company；Other biochemical reagents are that domestic analysis is pure.
One kind being based on the anti-capripox virus VHH-4-1 of Bactrian camel source, including based on the anti-goat capripoxvirus VHH-4-1's of two-humped camel
Screening, the vector construction of VHH-4-1 and expression, the purifying of VHH-4-1 supernatant protein, activity identification, functionalization and application.
Embodiment
1. a kind of screening based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel
1.1 expand single domain antibody gene, 900bp using hunchbacked source single domain antibody homology arm primer from construction cDNA antibody library
For VH-CH1-CH2 hinge area, 600bp is VHH-CH2 hinge area, and VHH about 400bp, gel recycles 900 and 600bp item respectively
Band, expands 400bp again on this basis, connects after gel recycling with carrier T, conversion JM109 competent cell, choose spot, shake bacterium,
Identification, verifies suitable sequence and is sequenced.50ul reaction system：25ul Ex Taq mix 25ul, specific aim upstream and downstream are drawn
Object each 1ul, template 1ul（CDNA library plasmid）, ddH2O 22ul, amplification condition：95 DEG C of 3min, 95 DEG C of 50s, 54 DEG C
50s, 35times, 72 DEG C of 50s.Three segments are consistent.
1.2 gained sequences are compared with Fig. 1 single domain antibody frame, and the sequence for meeting frame structure is then considered single domain
Antibody sequence can carry out downstream experiment；
1.3 result：After one expands, set expands, 900bp and 600bp band is successfully obtained（Such as Fig. 2）, obtained after carrying out set expansion to it
400bp or so band（Such as Fig. 3）, gel-purified, recycling 400bp segment, after T clone, sequencing, preliminary screening goes out one and meets
The sequence of frame（Such as SEQ ID NO:1）, it is labeled as：VHH-4-1.
The anti-goat capripoxvirus VHH-4-1 single domain antibody sequence is SEQ ID NO:1：
CATGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGTAGCCT
CTGGATTCAACTTCAGTCGCTATGACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGAGACTCGAGTGGGTCTCCACG
TCTAAGAGGATTGATAATACATACTACCCATACGATGCAGATTTCGTGAAGGGCCGATTCACCATCTCCAGAGACAA
TGCCAAGAACACGCTATACCTCCAATTGAACAGCCTGAAAACTGAGGACACGGCCATGTATTACTGTAGCCGGTCAG
GGATTGGCGAGACCGTCTCCGTTAAGAGTAAGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
A kind of vector construction based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel of 2, and expression 2.1 are by above-mentioned VHH-4-1
PMal-c2X expression vector is cloned and be connected to sequence, converts BL21 competent cell, and suitable clones carry out a small amount of inducing expressions；
2.2 pairs of a small amount of expression products detect through SDS-PAGE and find differential band；
The 100ml thallus of 2.3 pairs of great expressions harvest, through 200W, ultrasonic 3s suspends 4s, and 99 ultrasounds of ultrasound crack,
12000rpm, 4 DEG C of centrifugations, 50min collect supernatant and precipitating, a small amount of sample are taken to do SDS-PAGE detection, carry out recombinant protein
Soluble analysis, remaining supernatant and be deposited in -80 DEG C of refrigerator it is spare.
2.4 result VHH-4-1 are correctly cloned in expression vector, in Fig. 4 this it appears that poor after a small amount of inducing expressions
Different band illustrates that VHH-4-1 successfully obtains expression；The 100ml thallus of great expression, supernatant precipitate SDS-PAGE solubility point
Analysis such as Fig. 5, illustrates that supernatant precipitating has expression.
A kind of purifying based on the anti-goat capripoxvirus VHH-4-1 supernatant protein of two-humped camel of 3,
The 3.1 strain further expansion cultures identified above-mentioned 2 shake and train 1L, and after inducing expression, 4000rpm, 15min collect bacterium
Body, such as 2.3 ultrasound centrifugations, filter 0.45 μm of filter of supernatant, for use；
3.2 take Ni column to drain off, and wash 3-5 column volume, wash 3 column volumes with the EDTA of 0.1M；3-5 column volume is washed,
NTA-0 (pH8.0) washes 3 column volumes；NiSO4 washes 5 column volumes, drains off.
3.3 low pH4.0 equilibrium liquids wash 3 column volumes；It is identical as NTA-0 pH that NTA-0 (pH8.0) is washed till efflux.
3.4 use 1ml/min loading flow velocity loading；It is complete to sample solution stream.
Until 3.5 NTA-0 (pH8.0) are washed till the constant basket of G250.
3.6 wash pillar with 20mM, 60mM, 200mM and 500mM imidazoles respectively（Until the constant basket of detection G250）, point
It Shou Ji not trickle, SDS-PAGE analysis purity of protein and concentration.
3.7 one column volume of washing, 20% ethyl alcohol seal column.
3.8 results find that 200mM imidazoles elution effect is carried out, and acquisition albumen is purer, concentration after various conditions are groped
Up to 1mg/ml, 500ml bacterium sees Fig. 6 up to 5 mg/ml.
A kind of activity identification based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel
The WB activity of 4.1 VHH-4-1 purifying proteins and the goatpox Attenuate vaccine of culture, concentration, purifying is verified
Recovery vero cell first, 1:3 secondary cultures, be inoculated with goatpox Attenuate vaccine, while set do not connect poison be control, F5 for after
Expand culture, centrifugation removes cell fragment, is concentrated by ultrafiltration, purifying, with positive and negative serum orthogonal reaction, determines that antigen is most preferably coated with
Concentration, MBP ELIAS secondary antibody optium concentration verify the reactivity and reaction density of VHH-4-1；Then 1:100 dilution concentrations
4x albumen sample-loading buffer is added in virus, boils 10min, loading 20ul carries out SDS-PAGE electrophoresis, while adding albumen
Antigen is gone to pvdf membrane, condition with half-dried transferring film method by Marker：Film is transferred to 5% skimmed milk power by 2.5A, 25V, 10min
In TBST solution, 2h is closed, TBST is rinsed, VHH-4-1 primary antibody 1:500,4 DEG C of overnight incubations, MBP ELIAS secondary antibody 1:1000,37
DEG C be incubated for 2h.Finally with Enhanced chemiluminescence (ECL) observation exposure band.
As a result：Sick cell occurs after normal and inoculation goatpox Attenuate vaccine and sees Fig. 7 and 8, antigen is successfully obtained, through orthogonal
Reaction, concentration, the best peridium concentration 1 of antigen after purification:800, VHH-4-1 reaction densities are 1:1000, illustrate the anti-sheep in hunchbacked source
Poxvirus single domain antibody VHH-4-1 has and the preferable reactivity worth of goat capripoxvirus.Fig. 9 trace band further confirms VHH-
4-1 albumen can be identified by goat capripoxvirus, generate specific band, have reactivity.
The verifying of 4.2 VHH-4-1 purifying protein neutralization activities
4.2.1 goatpox Attenuate vaccine cell toxicant valence is measured
Divide kind after 96 porocyte culture plates, 48h according to a certain percentage in normal vero cell, inhales and abandon culture solution, 10 times of multiple proportions
The cell toxicant cultivated in dilution 4.1,8 holes i.e. one are classified as a repetition, and altogether plus 10 gradients, the 11st and 12 are classified as negative control,
It observed after 144h, calculate TCID50。
4.2.1 fixed virus, dilution VHH-4-1 are carried out in cell and are tested
On 96 hole Microtitration plates, VHH-4-1 is made into a series of doubling dilutions with dilution, makes its dilution be respectively
1:2,1:4,1:8,1:16,1:32,1:64,1:128, every hole content is 50ul, and each dilution makees 4 holes.By poison after measured
Valence makees 200TCID50Dilution（It is mixed with equivalent certain proportion dilution VHH-4-1, malicious valence is 100TCID50）, i.e., every hole is added
50ul virus liquid seals lid, is placed in 37 DEG C of incubators and 1h.
Cell suspension is added, when preparing cell suspension, concentration is to be degree in the single layer that covers with interior for 24 hours：In serum-virus
It after 1h, takes out, 100ul cell suspension is added in every hole.Set 5%CO2 37 DEG C of incubator cultures, since culture 3d observe note day by day
Record, 144h sentence eventually.
Set up control：Positive and negative serum control is inactivated：It is positive and negative serum is parallel with VHH-4-1 progress tries
It tests, cytopathy should not occur in positive serum controls, and cytopathy should occur in negative serum control；Meanwhile 0.1TCID50Disease
Malicious hole should not cause cytopathy, and 100TCID50Hole must cause cytopathy, and otherwise the test is untenable；In addition, setting
It attentions normal cell control well, minimum dilution VHH-4-1 is toxicity control hole.
4.2.3 result：Various controls are set up, and when being determined, tested hole 100%CPE occurs and is judged to feminine gender；50% or more is thin
There is Protector for the positive in born of the same parents；The result of fixed virus dilute serum neutralization test calculates, and is to calculate that 50% cell hole can be protected
The VHH-4-1 dilution of cytopathy is not generated, which is the neutralize antibody titers of the VHH-4-1.It calculates：
TCID50TCID50 is 2.1 after neutralizing for 4.25, VHH-4-1, and the difference between the two 2.15, antilogarithm is about 141, is greater than 50,
Illustrate that VHH-4-1 single domain antibody has and neutralizes goatpox Attenuate vaccine cytotoxicity.
The functionalization and application of 5, VHH-4-1 purifying proteins
5.1 VHH-4-1 albumen after purification is marked
5mg HRP is dissolved in 0.5ml distilled water, and Fresh 0.06mol/L sodium periodate aqueous solution 0.5ml is added, and mixing sets 4
DEG C, 30min is added 0.16mol/L glycol water 0.5ml, the aqueous solution of the antibody purification containing 5mg is added after room temperature 30min
1ml is mixed, and is filled bag filter, and with 0.05mol/L, the carbonate buffer solution of PH9.5 slowly stirs dialysis 6h in 4 DEG C of refrigerators
（Overnight）, then it is sucked out, adds sodium borohydride solution 5mg/ml, 0.2ml, gained is the antibody of HRP label.
5.2 functionalization antibody titers and specific detection
1:20-1:2560 vertical setting of types dilute envelope antigen, next day, and board-washing is closed, and 1:80-1:2560 dilution enzyme labelled antibodies, it is orthogonal anti-
It answers, verifying enzyme mark VHH-4-1 activity；It is weak that various concentration coating experiment prepares sore mouth virus, small anti-Attenuate vaccine antigen and goatpox
Malicious seedling and normal vero cell carry out specific detection.
For 5.3 results after HRP enzyme label, VHH-4-1 enzyme labelled antibody potency is determined as 1:1000, see Figure 10；VHH-4-1
Enzyme labelled antibody is only reacted with goatpox Attenuate vaccine, is not reacted with sore mouth virus, small anti-Attenuate vaccine antigen and normal vero cell, can
See that VHH-4-1 enzyme labelled antibody specificity is good.
Sequence table
Organization Applicant
----------------------
Street :The Chengguan District, Lanzhou City, Gansu Province saltern level ground Bao Xujia 1
City :Lanzhou
State :Gansu
Country :China
PostalCode : 730046
PhoneNumber : 0931-8343385
FaxNumber : 0931-8340977
EmailAddress : jingningcaixiong@163.com
<110> OrganizationName :Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
Application Project
-------------------
<120> Title :One kind being based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel and purposes
<130> AppFileReference : Characterization of Asia 1 sdAb from Camels
Bactrianus (C. bactrianus) and Conjugation with Quantum Dots for Imaging FMDV
in BHK-21 Cells
<140> CurrentAppNumber :
<141> CurrentFilingDate : ____-__-__
Sequence
--------
<213> OrganismName : Peganum harmala
<400> PreSequenceString :
catgtgcagc tggtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60
tcctgtgtag cctctggatt caacttcagt cgctatgaca tgagctgggt ccgccaggct 120
ccagggaaga gactcgagtg ggtctccacg tctaagagga ttgataatac atactaccca 180
tacgatgcag atttcgtgaa gggccgattc accatctcca gagacaatgc caagaacacg 240
ctatacctcc aattgaacag cctgaaaact gaggacacgg ccatgtatta ctgtagccgg 300
tcagggattg gcgagaccgt ctccgttaag agtaagggcc aggggaccca ggtcaccgtc 360
tcctca 366
<212> Type : DNA
<211> Length : 366
SequenceName : SEQ ID NO:1
SequenceDescription :
Organization Applicant
----------------------
Street :The Chengguan District, Lanzhou City, Gansu Province saltern level ground Bao Xujia 1
City :Lanzhou
State :Gansu
Country :China
PostalCode : 730046
PhoneNumber : 0931-8343385
FaxNumber : 0931-8340977
EmailAddress : jingningcaixiong@163.com
<110> OrganizationName :Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
Application Project
-------------------
<120> Title :One kind being based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel and purposes
<130> AppFileReference : Characterization of Asia 1 sdAb from Camels
Bactrianus (C. bactrianus) and Conjugation with Quantum Dots for Imaging FMDV
in BHK-21 Cells
<140> CurrentAppNumber :
<141> CurrentFilingDate : ____-__-__
Sequence
--------
<213> OrganismName : Peganum harmala
<400> PreSequenceString :
catgtgcagc tggtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60
tcctgtgtag cctctggatt caacttcagt cgctatgaca tgagctgggt ccgccaggct 120
ccagggaaga gactcgagtg ggtctccacg tctaagagga ttgataatac atactaccca 180
tacgatgcag atttcgtgaa gggccgattc accatctcca gagacaatgc caagaacacg 240
ctatacctcc aattgaacag cctgaaaact gaggacacgg ccatgtatta ctgtagccgg 300
tcagggattg gcgagaccgt ctccgttaag agtaagggcc aggggaccca ggtcaccgtc 360
tcctca 366
<212> Type : DNA
<211> Length : 366
SequenceName : SEQ ID NO:1
SequenceDescription :
Claims (10)
1. one kind is based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel, it is characterised in that：Utilize hunchbacked source single domain antibody homology arm primer
It expanded from construction cDNA antibody library, screen to obtain anti-goat capripoxvirus single domain antibody VHH-4-1, sequence is SEQ ID NO:
1：
CATGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGTAGCCT
CTGGATTCAACTTCAGTCGCTATGACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGAGACTCGAGTGGGTCTCCACG
TCTAAGAGGATTGATAATACATACTACCCATACGATGCAGATTTCGTGAAGGGCCGATTCACCATCTCCAGAGACAA
TGCCAAGAACACGCTATACCTCCAATTGAACAGCCTGAAAACTGAGGACACGGCCATGTATTACTGTAGCCGGTCAG
GGATTGGCGAGACCGTCTCCGTTAAGAGTAAGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
2. according to claim 1 a kind of based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel, it is characterised in that：Specific packet
Include following steps:
Step（1）:Amplification obtains about 400bp genetic fragment：
Single domain antibody gene, 900bp VH- are expanded from construction cDNA antibody library using hunchbacked source single domain antibody homology arm primer
CH1-CH2 hinge area, 600bp are VHH-CH2 hinge area, and VHH about 400bp, gel recycles 900 and 600bp band respectively, herein
On the basis of expand 400bp segment again, gel recycles all 400 bands, is attached respectively with carrier T, converts JM109 competence
Cell chooses spot, shakes bacterium, identification, verifies suitable sequence and be sequenced;
The 50ul reaction system of foundation is：25ul Ex Taq mix 25ul, specific aim upstream and downstream each 1ul of primer, template cDNA
Library plasmid 1ul, ddH2O 22ul, amplification condition：95 DEG C of 3min, 95 DEG C of 50s, 54 DEG C of 50s, 35times, 72 DEG C
50s;Three segments are consistent;
Step（2）:Fragment sequence compares：
The sequence for obtaining 400bp or so band is compared with single domain antibody frame, the sequence for meeting frame structure is anti-sheep
Poxvirus VHH-4-1 single domain antibody sequence.
3. according to claim 1 a kind of based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel, it is characterised in that：To VHH-
After the vector construction of 4-1 and expression, the purifying of VHH-4-1 supernatant protein, functionalization label, VHH-4-1 enzyme labelled antibody potency is 1:
1000, VHH-4-1 enzyme labelled antibodies are only reacted with goatpox Attenuate vaccine.
4. according to claim 1 a kind of based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel, it is characterised in that：VHH-4-1
Vector construction and expression, it is specific as follows：
PMal-c2X expression vector is cloned and be connected to obtained VHH-4-1 sequence, converts BL21 competent cell, suitable gram
It is grand to carry out a small amount of inducing expressions；
A small amount of expression products are detected through SDS-PAGE and find differential band；
To the 100ml thallus of great expression harvest, through 200W, ultrasonic 3s suspends 4s, and 99 ultrasounds of ultrasound crack, 12000rpm,
4 DEG C of centrifugations, 50min collect supernatant protein and precipitating；The expression condition of VHH-4-1 albumen is：Thallus ultrasonication parameter
It is set as 200 W of power, 3 s of ultrasound, 4 s of pause, 99 circulations；To final concentration of 0.5 mM, 30 DEG C induce IPTG inducer
3h。
5. according to claim 3 a kind of based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel, it is characterised in that：VHH-4-1
The purifying of supernatant protein, it is specific as follows：
By the VHH-4-1 strain further expansion culture of above-mentioned identification, after inducing expression, thallus is collected, ultrasound centrifugation is used in combination
0.45 μm of filter filters supernatant, for use；
It takes Ni column to drain off, washes 3-5 column volume, wash 3 column volumes with the EDTA of 0.1M；Wash 3-5 column volume, NTA-0
(pH8.0) 3 column volumes are washed；NiSO45 column volumes are washed, are drained off；Low pH4.0 equilibrium liquid washes 3 column volumes；NTA-0
(pH8.0) it is identical as NTA-0 pH to be washed till efflux；
With 1ml/min loading flow velocity loading；It is complete to sample solution stream；
Wash pillar with 20mM, 60mM, 200mM and 500mM imidazoles and collect trickle respectively, SDS-PAGE analyze purity of protein and
Concentration, band is most bright as to elute protein concentration with corresponding concentration；
Wash-out concentration 200mM imidazoles when obtaining VHH-4-1 protein purification, the concentration 5.6ng/ul after VHH-4-1 protein purification.
6. according to claim 3 or 4 a kind of based on the anti-capripox virus VHH-4-1 of two-humped camel, it is characterised in that：It is described
In VHH-4-1 albumen and when experimental verification, neutralization index 102.15, it is greater than 50.
7. according to claim 3 or 4 a kind of based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel, it is characterised in that：
VHH-4-1 purifying protein and culture, concentration, the WB activity verifying of purified goat acne Attenuate vaccine, VHH-4-1 protein concentration is 1：
640。
8. according to claim 7 a kind of based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel, it is characterised in that：Goatpox
Attenuate vaccine is through cell expansion culture, concentration and product after purification, peridium concentration 1:800.
9. according to claim 4 a kind of based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel, it is characterised in that:VHH-4-
The functionalization of 1 albumen marks：I.e. horseradish peroxidase carries out protein labeling, labeling method：HRP is dissolved in distilled water, is added
Enter Fresh sodium periodate aqueous solution, mix, set 4 DEG C, 30min makes the polysaccharide of HRP molecular surface be oxidized to aldehyde radical, is added
Antibody purification is added after room temperature 30min in glycol water, mixes, and fill bag filter, forms aldehyde radical with the amino on antibody
Schiff alkali and combine, be then sucked out, add sodium borohydride solution, reduction forms stable enzymic-labelled antibody, and gained is HRP mark
The antibody of note.
10. a kind of purposes based on the anti-capripox virus VHH-4-1 of two-humped camel described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810843478.9A CN108912225B (en) | 2018-07-27 | 2018-07-27 | Bactrian camel-based anti-goatpox virus VHH-4-1 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810843478.9A CN108912225B (en) | 2018-07-27 | 2018-07-27 | Bactrian camel-based anti-goatpox virus VHH-4-1 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108912225A true CN108912225A (en) | 2018-11-30 |
| CN108912225B CN108912225B (en) | 2020-06-09 |
Family
ID=64417411
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810843478.9A Active CN108912225B (en) | 2018-07-27 | 2018-07-27 | Bactrian camel-based anti-goatpox virus VHH-4-1 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108912225B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115469105A (en) * | 2022-11-01 | 2022-12-13 | 龙阔（苏州）生物工程有限公司 | One-step method rapid detection kit for African swine fever ELISA antibody |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050196755A1 (en) * | 2000-11-17 | 2005-09-08 | Maurice Zauderer | In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells |
| WO2009048839A2 (en) * | 2007-10-10 | 2009-04-16 | Kyowa Hakko Kirin Co., Ltd. | Vaccinia virus h3l and b5r specific monoclonal antibodies and methods of making and using same |
| CN105754951A (en) * | 2016-02-16 | 2016-07-13 | 中国农业科学院兰州兽医研究所 | Anti-sheeppox virus K3L protein monoclonal antibody and application thereof |
| CN105887208A (en) * | 2016-05-03 | 2016-08-24 | 中国农业科学院兰州兽医研究所 | Anti-goatpox virus bactrian camel VHH heavy-chain single-domain antibody cDNA library and preparation method thereof |
| CN106075429A (en) * | 2016-08-16 | 2016-11-09 | 中国农业科学院兰州兽医研究所 | A kind of goatpox, sheep pox, sore mouth virus three cell weak-toxic vaccine and its production and use |
| CN106546742A (en) * | 2016-11-01 | 2017-03-29 | 甘肃省畜牧兽医研究所 | A kind of gold mark detection test paper bar based on goat capripoxviruses and preparation method thereof |
| CN107894506A (en) * | 2017-12-27 | 2018-04-10 | 中国动物疫病预防控制中心 | Detect enzyme linked immunological kit and its application of capripox virus antibody |
-
2018
- 2018-07-27 CN CN201810843478.9A patent/CN108912225B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050196755A1 (en) * | 2000-11-17 | 2005-09-08 | Maurice Zauderer | In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells |
| WO2009048839A2 (en) * | 2007-10-10 | 2009-04-16 | Kyowa Hakko Kirin Co., Ltd. | Vaccinia virus h3l and b5r specific monoclonal antibodies and methods of making and using same |
| CN105754951A (en) * | 2016-02-16 | 2016-07-13 | 中国农业科学院兰州兽医研究所 | Anti-sheeppox virus K3L protein monoclonal antibody and application thereof |
| CN105887208A (en) * | 2016-05-03 | 2016-08-24 | 中国农业科学院兰州兽医研究所 | Anti-goatpox virus bactrian camel VHH heavy-chain single-domain antibody cDNA library and preparation method thereof |
| CN106075429A (en) * | 2016-08-16 | 2016-11-09 | 中国农业科学院兰州兽医研究所 | A kind of goatpox, sheep pox, sore mouth virus three cell weak-toxic vaccine and its production and use |
| CN106546742A (en) * | 2016-11-01 | 2017-03-29 | 甘肃省畜牧兽医研究所 | A kind of gold mark detection test paper bar based on goat capripoxviruses and preparation method thereof |
| CN107894506A (en) * | 2017-12-27 | 2018-04-10 | 中国动物疫病预防控制中心 | Detect enzyme linked immunological kit and its application of capripox virus antibody |
Non-Patent Citations (1)
| Title |
|---|
| 吴国华等: "羊痘病毒双抗体夹心ELISA检测方法的建立", 《江西农业大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115469105A (en) * | 2022-11-01 | 2022-12-13 | 龙阔（苏州）生物工程有限公司 | One-step method rapid detection kit for African swine fever ELISA antibody |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108912225B (en) | 2020-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111366728A (en) | Immunochromatography kit for detecting novel coronavirus SARS-CoV-2 | |
| CN107573417A (en) | Mycoplasma pneumoniae chimeric antigen, the antigen detecting agent and both preparation methods | |
| CN105695420A (en) | Mouse bone marrow hybridoma cell strains, monoclonal antibody generated by same and application | |
| CN107407679B (en) | Immunological detection method and kit for mycoplasma pneumoniae | |
| CN109187993A (en) | A kind of foot and mouth disease A-type virus sIgA antibody ELISA detection kit and its application | |
| CN105859843A (en) | Preparation method of respiratory syncytial virus antigen and rapid respiratory syncytial virus antibody detection kit prepared from antigen | |
| CN109053883B (en) | Binding protein of NS1 protein | |
| KR20210031946A (en) | NS1 protein binding protein and application | |
| CN109374887A (en) | Bovine viral diarrhea virus antigen colloidal gold detection kit and its application | |
| CN112462061A (en) | Kit for detecting H1N1, RSV-A and ADV3 and application thereof | |
| CN113024640A (en) | Epitope peptide antigen detection neutralizing antibody kit based on screening of binding domain of new coronavirus RBD and ACE2 receptors | |
| CN112946294A (en) | Novel coronavirus 2019-nCoV antibody detection test strip and preparation method and application thereof | |
| CA3111163A1 (en) | Ns1-binding protein | |
| CA3111159A1 (en) | Ns1-binding protein | |
| CN106188248A (en) | A kind of Epstein-Barr virus antigen preparation procedure and utilize the quick detection kit of detection Epstein-Barr virus antibody prepared by this antigen | |
| CN108912225A (en) | One kind being based on the anti-goat capripoxvirus VHH-4-1 of two-humped camel and purposes | |
| CN106046124A (en) | Preparation method of coxsackievirus antigen and rapid detection kit prepared by utilizing antigen and used for detecting coxsackievirus antibody | |
| CN112300252B (en) | Prediction of 2019-nCoV coronavirus nucleocapsid protein epitope polypeptide and application of polypeptide in detection | |
| CN108912226A (en) | One kind being based on the anti-goat capripoxvirus VHH-4-2 of two-humped camel and purposes | |
| CN214750354U (en) | Novel coronavirus antigen and antibody combined intelligent detection device | |
| CN112225783B (en) | HCV recombinant antigen and mutant thereof | |
| CN109374886A (en) | Infectious bovine rhinotrachetis virus antibody assay kit and its application | |
| CN108761091A (en) | Double-antibody method quickly detects the test strips of HPV antibody, test card and preparation method thereof | |
| Zhang et al. | Development of a potential diagnostic monoclonal antibody against capsid spike protein VP27 of the novel goose astrovirus | |
| CN107098980A (en) | A kind of fusion protein for detecting Detecting Rubella Virus Antibodies In Human Sera and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |