CN108893485A - A kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR - Google Patents
A kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR Download PDFInfo
- Publication number
- CN108893485A CN108893485A CN201810770762.8A CN201810770762A CN108893485A CN 108893485 A CN108893485 A CN 108893485A CN 201810770762 A CN201810770762 A CN 201810770762A CN 108893485 A CN108893485 A CN 108893485A
- Authority
- CN
- China
- Prior art keywords
- casr
- sirna
- plasmid
- cell
- caco
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR comprising following steps：A, siRNA-CaSR recombinates the building of interference plasmid：B, statistical procedures；C, the identification of plasmid is constructed.It designs through the above steps, the present invention stablizes the Caco-2 cell strain of expression siCaSR by building, the constructed SiRNA expression vector of observation influences the expression of CaSR mRNA and albumen, provides a useful experimental tool for effect of the follow-up study CaSR in the diarrhea that RV infects and its induces.
Description
Technical field
The biological study technical field that the present invention relates to CaSR in rotavirus infection diarrhea, more particularly to it is a kind of
RNA interferes the method for building up of the Caco-2 stable cell line of calcium-sensing receptor CaSR.
Background technique
Calcium-sensing receptor（Calcium sensing receptor, CaSR）It is the conservative ancient G-protein coupled cell of C class
Surface receptor is originally found in bovine parathyroid chief cell, and subsequent research finds it in the different tissues of mammal
In have expression；Wherein, the major function of CaSR is to maintain the balance of intraor extracellular calcium ion and take part in intercellular signal
Conduction, the proliferation and the processes such as differentiation that control the expression of gene, Apoptosis and cell.CaSR is expressed in entire gastrointestinal tract
In, serve in adjusting intestinal juice transhipment and osmotic pressure adjusting key.
In addition, correlative study shows that CaSR takes part in the diarrhea of the endotaxin inductions such as cholera toxin and large intestine heat-stable toxin
Generation.CaSR is in rotavirus at present（Rotavirus, RV）Biological function in infectious diarrhea is not yet clear.Intestines are thin
Permissive cell strain of the born of the same parents like cell strain Caco-2 as RV is usually used in the correlation of the intestinal cell structure and function damage of RV induction
Research.RNA perturbation technique refers to the silenced gene expression for inducing homologous sequence in the cell by external source or endogenous double-stranded RNA
The phenomenon that, RNA interference at present is widely used in the functional study of various genes.
Summary of the invention
The purpose of the present invention is to provide a kind of foundation of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR
The method for building up of method, the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR can construct the interference of CaSR gene
Stablize expression Caco-2 cell strain, the biological function for follow-up study CaSR provides vehicles cells.
In order to achieve the above objectives, the present invention is achieved through the following technical solutions.
A kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR, includes following steps,
Specifically：
A, siRNA-CaSR recombinates the building of interference plasmid：
A1, pass through retrieval ncbi database and designated rna interference sequence, selection 5 '-AAGGAGATCGAGTTTCTGT-3 ' conduct
The interference sequence of experimental group synthesizes corresponding DNA sequence dna；For the DNA sequence dna of synthesis, positive-sense strand is： 5'-TC-
CCAAGGAGATCGAGTTTCTGTTCAAGAGACAGAAACTCGATCTC-CTTTT-3 ', antisense strand are：5'-
CAAAAAAAGGAGATCGAGTTTCT-GTCTCTTGAACAGAAACTCGATCTCCTT-3 ', the TC- in positive-sense strand
CCAAGGAGATCGAGTTTCTGT, ACAGAAACTCGATCTC-CTTTT are to target CaSR interference sequence, in antisense strand
CAAAAAAAGGAGATCGAGTTTCT-GT, ACAGAAACTCGATCTCCTT are targeting CaSR interference sequence；Interference sequence warp
Other coded sequences of Blast analysis, sequence and people are without homology；5 '-GAGTTAACGTGAGGTACTT-3 ' are chosen as yin
Property control interference sequence；Oligonucleotide chain forms double-strand by annealing, is connected to the siRNA by enzyme digestion in Bbs I and carries
Body, enzyme is purchased from TIANGEN biotech firm in the Bbs I；Positive interference plasmid is named as siRNA-CaSR, and negative control interferes matter
Grain is named as siRNA-scrambled, and blank control plasmid is named as siRNA-empty；
The extraction of a2, siRNA-CaSR recombination interference plasmid：Extremely by recombinant plasmid transformedE.coli In DH5 α bacterial strain, 37 DEG C
12 h are cultivated in insulating box, select positive colony in solid medium with ampicillin, with containing 1: 1000 ammonia benzyl antibiosis
100 mL LB fluid nutrient mediums of element, 200 rpm, 37 DEG C of culture 12-16 h；Utilize the matter for being purchased from TIANGEN biotech firm
Grain extracts kit simultaneously carries out plasmid extraction according to the plasmid extraction kit specification of TIANGEN biotech firm；The matter of extraction
Grain measures concentration and purity by NanoDrop nucleic acid-protein titrator, and extracted plasmid is sequenced；
A3, cell culture：The DMEM culture solution of the 10% new fetal calf serum of inactivation is added after Caco-2 cell recovery, in dioxy
Change and is cultivated in carbon incubator；It digested, passed on 0.25% trypsin solution when cell adherent growth is to 80%,
And logarithmic growth phase cell carries out plasmid transfection experiment；
A4, plasmid transfection：By Caco-2 cell inoculation in 12 orifice plates, it is divided into experimental group, negative control group and blank control
Group, each hole paving 2 × 105A cell, using purchased from PolyPlus company lipofectamine JetPei and according to
JetPei reagent specification is transfected, and 37 DEG C, 5% CO are put into2Constant incubator carries out cell culture；Transfection is for 24 hours after -48h
Transfection positive cells strain is screened with puromycin；In its luciferase expression feelings of fluorescence microscopy microscopic observation after cell transfecting 72-96h
Condition；
A5, puromycin concentration mensuration：By the Caco-2 cell inoculation through transfecting in 12 orifice plates, each hole paving 2 × 105It is a
Cell is cultivated for 24 hours in carbon dioxide incubator, and the every hole of experimental group is separately added into 1,2,3,4,5,6,7,8,9,10,11,12 μ
G/ml puromycin carries out the screening of minimum lethal concentration (MLC), determines that minimum lethal concentration (MLC) is and carries out subsequent cell sieve by this concentration
Choosing culture；
A6, real-time quantitative PCR detection CaSR mRNA expression：Caco-2 cell transfecting simultaneously cultivates 48h, and TRIZOL method extracts cell
Total serum IgE；After RNA concentration mensuration, by Superscript First-strand Synthesis System for RT-PCR
Kit prepares RT reaction solution and carries out cDNA reverse transcription reaction；PCR amplification, CaSR-F are carried out with 2 × mix of SYBR: 5'-
GGGCTCTTTCCTATTCAT ' -3, CaSR-R:5'-GCTGTTTATCTCCTCTATG-'3；Internal reference GAPDH-F:5'
CTCCTCCTGTTCGACAGTCAGC-3 ', GAPDH-R: 5'-CCCAATACGACCAAATCCGTT-3'；Amplification condition is：
95°C 10min；94 °C of 25s, 60 °C of 45s, 72 °C of 30s, 45 circulations；Experiment is independent to be repeated 3 times；
The expression of a7, Western Blot detection CaSR albumen：Experimental group and control group that 48h is cultivated after transfection is thin
Born of the same parents take out, and the extraction that the lysate containing 1% protease inhibitors carries out total protein is added；Using the dense of BCA method test sample albumen
Degree；SDS-PAGE electrophoresis is carried out after taking appropriate amount of sample that 95 DEG C of 5 × sample-loading buffer denaturation are added, resolving gel concentration 8% is dense
Contracting gum concentration 5% goes to albumen electricity on PVDF, and room temperature closes 2h；Dilution 1 is added：1000 primary antibody, 4 DEG C are incubated overnight, and wash
Dilution 1 is added in film afterwards three times:The fluorescence secondary antibody of 10000 far infrared label, room temperature, which is protected from light, is incubated for 2h；With Western blot
The development of far infrared visualizer, records result；Experiment repeats three times every time；
B, statistical procedures：In triplicate, quantitative data is with mean ± standard deviation for all experiments（）It indicates；Each group
The expression quantity of the mRNA of CaSR uses-△△Ct method calculates；The protein expression of each group CaSR carries out phase with GAPDH expression
To quantitative；All experimental datas are handled with 16 statistical software of SPSS；P< 0. 05 shows that difference is statistically significant；
C, the identification of plasmid is constructed：
C1, plasmid order-checking identification：The correct recombinant bacterial strain of Preliminary Identification cultivates extraction purification plasmid and carries out Sequence Detection, will
Resulting sequence results are compared with implementation sequence learns that sequencing result is consistent with designed, prompts used in this experiment
Sequence size and direction of insertion it is correct；
C2, the luciferase expression for transfecting cell are horizontal：SiRNA-CaSR, siRNA-scrambled, siRNA-empty transfect cell
After 48h, in fluorescence microscopy microscopic observation cellular morphology and luciferase expression situation；
The influence of c3, siRNA to CaSR mRNA expression：The mRNA of real-time quantitative PCR testing goal gene C aSR
Expression；
The influence of c4, siRNA to CaSR protein expression level：It extracts respectively and has transfected siRNA-CaSR, siRNA-
The Caco-2 total protein of cell of Scramble and siRNA-empty, Western Blot detect the expression of CaSR albumen,
As the result is shown：Compared with siRNA-scrambled and siRNA-CaSR transfection group, recombination interference plasmid siRNA-CaSR transfection
CaSR protein expression level is substantially reduced in group.
Wherein, people clones colon adenocarcinoma cell Caco-2 cell strain and is purchased from Wuhan University's collection, now by Guangdong medical courses in general
Institute of oncology of Sino-U.S. of university saves；SiRNA plasmid is synthesized by Ji Kai genome company；E.coli DH5 α bacterial strain is Guangdong doctor
Institute of oncology of Sino-U.S. of university of section laboratory is saved.
Wherein, puromycin, ampicillin are purchased from Solarbio company；Cell culture medium DMEM, fetal calf serum purchase
From Gibico company；Enzyme, plasmid extraction kit are purchased from TIANGEN biotech firm in Bbs I；DNTP, lipofectamine
JetPei is purchased from PolyPlus company；TRIZOL, PCR primer, Super Script III reverse
Transcriptase kit purchases Invitrogen company；The anti-human CaSR albumen primary antibody of mouse and the anti-human GAPDH primary antibody of mouse are purchased from
Santa Cruze company；680 goat-anti-mouse IgG of Alexa Flour is purchased from Thermo Scientific company.
Wherein, the LB fluid nutrient medium is prepared using following methods, specifically：Weigh tryptone 10g, yeast mentions
Object 5g, sodium chloride 10g are taken, 1L is settled to, sufficiently shakes up rear high pressure sterilization.
Beneficial effects of the present invention are：The Caco-2 of RNA interference calcium-sensing receptor CaSR of the present invention a kind of stablizes
The method for building up of cell strain comprising have following steps：A, siRNA-CaSR recombinates the building of interference plasmid：A1, pass through retrieval
Ncbi database and designated rna interference sequence choose interference sequence of the 5 '-AAGGAGATCGAGTTTCTGT-3 ' as experimental group
Column, synthesize corresponding DNA sequence dna；For the DNA sequence dna of synthesis, positive-sense strand is： 5'-TC-
CCAAGGAGATCGAGTTTCTGTTCAAGAGACAGAAACTCGATCTC-CTTTT-3 ', antisense strand are：5'-
CAAAAAAAGGAGATCGAGTTTCT-GTCTCTTGAACAGAAACTCGATCTCCTT-3 ', the TC- in positive-sense strand
CCAAGGAGATCGAGTTTCTGT, ACAGAAACTCGATCTC-CTTTT are to target CaSR interference sequence, in antisense strand
CAAAAAAAGGAGATCGAGTTTCT-GT, ACAGAAACTCGATCTCCTT are targeting CaSR interference sequence；Interference sequence warp
Other coded sequences of Blast analysis, sequence and people are without homology；5 '-GAGTTAACGTGAGGTACTT-3 ' are chosen as yin
Property control interference sequence；Oligonucleotide chain forms double-strand by annealing, is connected to the siRNA by enzyme digestion in Bbs I and carries
Body, enzyme is purchased from TIANGEN biotech firm in the Bbs I；Positive interference plasmid is named as siRNA-CaSR, and negative control interferes matter
Grain is named as siRNA-scrambled, and blank control plasmid is named as siRNA-empty；A2, siRNA-CaSR recombination interference
The extraction of plasmid：Extremely by recombinant plasmid transformedE.coli In DH5 α bacterial strain, 12 h are cultivated in 37 DEG C of insulating boxs, in the blueness of benzyl containing ammonia
Select positive colony in the solid medium of mycin, with contain 1: 1000 ammonia benzyl antibiotic 100 mL LB fluid nutrient mediums, 200
Rpm, 37 DEG C of culture 12-16 h；Using the plasmid extraction kit purchased from TIANGEN biotech firm and according to TIANGEN biology
The plasmid extraction kit specification of company carries out plasmid extraction；The plasmid of extraction is surveyed by NanoDrop nucleic acid-protein titrator
Determine concentration and purity, and extracted plasmid is sequenced；A3, cell culture：10% is added after Caco-2 cell recovery to go out
The DMEM culture solution of new fetal calf serum living, is cultivated in carbon dioxide incubator；When cell adherent growth is to 80%
It digested, passed on 0.25% trypsin solution, and logarithmic growth phase cell carries out plasmid transfection experiment；A4, plasmid turn
Dye：By Caco-2 cell inoculation in 12 orifice plates, it is divided into experimental group, negative control group and blank control group, each hole paving 2 ×
105A cell, using the lipofectamine JetPei purchased from PolyPlus company and according to JetPei reagent explanation
Book is transfected, and 37 DEG C, 5% CO are put into2Constant incubator carries out cell culture；It is screened after transfecting -48h for 24 hours with puromycin
Transfection positive cells strain；In its luciferase expression situation of fluorescence microscopy microscopic observation after cell transfecting 72-96h；A5, puromycin
Concentration mensuration：By the Caco-2 cell inoculation through transfecting in 12 orifice plates, each hole paving 2 × 105A cell, in carbon dioxide
Cultivated in incubator for 24 hours, the every hole of experimental group be separately added into 1,2,3,4,5,6,7,8,9,10,11,12 μ g/ml puromycins into
The screening of row minimum lethal concentration (MLC) determines that minimum lethal concentration (MLC) is and carries out subsequent cell screening and culturing by this concentration；A6, in real time
Quantitative PCR detection CaSR mRNA expression：Caco-2 cell transfecting simultaneously cultivates 48h, and TRIZOL method extracts cell total rna；Through RNA
After concentration mensuration, RT is prepared by Superscript First-strand Synthesis System for RT-PCR kit
Reaction solution carries out cDNA reverse transcription reaction；PCR amplification, CaSR-F are carried out with 2 × mix of SYBR: 5'-
GGGCTCTTTCCTATTCAT ' -3, CaSR-R:5'-GCTGTTTATCTCCTCTATG-'3；Internal reference GAPDH-F:5'
CTCCTCCTGTTCGACAGTCAGC-3 ', GAPDH-R: 5'-CCCAATACGACCAAATCCGTT-3'；Amplification condition is：
95°C 10min；94 °C of 25s, 60 °C of 45s, 72 °C of 30s, 45 circulations；Experiment is independent to be repeated 3 times；a7,Western
The expression of Blot detection CaSR albumen：The experimental group for cultivating 48h after transfection and cellular control unit are taken out, is added and contains 1%
The lysate of protease inhibitors carries out the extraction of total protein；Using the concentration of BCA method test sample albumen；Appropriate amount of sample is taken to add
SDS-PAGE electrophoresis is carried out after entering 95 DEG C of 5 × sample-loading buffer denaturation, gum concentration 5% is concentrated, by egg in resolving gel concentration 8%
White appliances are gone on PVDF, and room temperature closes 2h；Dilution 1 is added：1000 primary antibody, 4 DEG C are incubated overnight, and wash film and dilution is added afterwards three times
1:The fluorescence secondary antibody of 10000 far infrared label, room temperature, which is protected from light, is incubated for 2h；Developed with Western blot far infrared visualizer,
Record result；Experiment repeats three times every time；B, statistical procedures：In triplicate, quantitative data is with mean ± mark for all experiments
It is quasi- poor（）It indicates；The expression quantity of the mRNA of each group CaSR uses-△△Ct method calculates；The protein expression of each group CaSR with
GAPDH expression carries out relative quantification；All experimental datas are handled with 16 statistical software of SPSS；P< 0. 05 shows difference
It is different statistically significant；C, the identification of plasmid is constructed：C1, plasmid order-checking identification：The correct recombinant bacterial strain of Preliminary Identification, culture mention
Take plasmid purification and carry out Sequence Detection, resulting sequence results and implementation sequence are compared learn sequencing result with
Designed is consistent, and the sequence size and direction of insertion for prompting this experiment used are correct；C2, the luciferase expression water for transfecting cell
It is flat：It is thin under the microscope in fluorescence microscopy after siRNA-CaSR, siRNA-scrambled, siRNA-empty transfect cell 48h
Born of the same parents' form and luciferase expression situation；The influence of c3, siRNA to CaSR mRNA expression：Real-time quantitative PCR detects mesh
Gene C aSR mRNA expression；The influence of c4, siRNA to CaSR protein expression level：It extracts and transfects respectively
The Caco-2 total protein of cell of siRNA-CaSR, siRNA-Scramble and siRNA-empty, Western Blot detection
The expression of CaSR albumen, as the result is shown：Compared with siRNA-scrambled and siRNA-CaSR transfection group, recombination interference
CaSR protein expression level is substantially reduced in plasmid siRNA-CaSR transfection group.It designs through the above steps, the present invention passes through
The Caco-2 cell strain of expression siCaSR is stablized in building, observes constructed SiRNA expression vector to CaSR mRNA and albumen
Expression influences, and provides a useful experimental tool for effect of the follow-up study CaSR in the diarrhea that RV infects and its induces.
Detailed description of the invention
Next with reference to the accompanying drawing the present invention will be described, but the embodiment in attached drawing is not constituted to limit of the invention
System.
Fig. 1 is the Caco-2 cell fluorescence expression for transfecting recombinant plasmid：A is the transfection siRNA-CaSR of screening
Caco-2 stable cell line；B is the Caco-2 stable cell line of the transfection siRNA-scrambled of screening；C is the transfection of screening
The Caco-2 stable cell line of siRNA-empty.
Fig. 2 is that the expression for the mRNA that real-time quantitative PCR detects CaSR illustrates table.
Fig. 3 is the expression explanatory diagram that Western blot detects CaSR albumen.
Specific embodiment
A kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR, which is characterized in that including
There are following steps, specifically：
A, siRNA-CaSR recombinates the building of interference plasmid：
A1, pass through retrieval ncbi database and designated rna interference sequence, selection 5 '-AAGGAGATCGAGTTTCTGT-3 ' conduct
The interference sequence of experimental group synthesizes corresponding DNA sequence dna；For the DNA sequence dna of synthesis, positive-sense strand is： 5'-TC-
CCAAGGAGATCGAGTTTCTGTTCAAGAGACAGAAACTCGATCTC-CTTTT-3 ', antisense strand are：5'-
CAAAAAAAGGAGATCGAGTTTCT-GTCTCTTGAACAGAAACTCGATCTCCTT-3 ', the TC- in positive-sense strand
CCAAGGAGATCGAGTTTCTGT, ACAGAAACTCGATCTC-CTTTT are to target CaSR interference sequence, in antisense strand
CAAAAAAAGGAGATCGAGTTTCT-GT, ACAGAAACTCGATCTCCTT are targeting CaSR interference sequence；Interference sequence warp
Other coded sequences of Blast analysis, sequence and people are without homology；5 '-GAGTTAACGTGAGGTACTT-3 ' are chosen as yin
Property control interference sequence；Oligonucleotide chain forms double-strand by annealing, is connected to the siRNA by enzyme digestion in Bbs I and carries
Body, enzyme is purchased from TIANGEN biotech firm in the Bbs I；Positive interference plasmid is named as siRNA-CaSR, and negative control interferes matter
Grain is named as siRNA-scrambled, and blank control plasmid is named as siRNA-empty；
The extraction of a2, siRNA-CaSR recombination interference plasmid：Extremely by recombinant plasmid transformedE.coli In DH5 α bacterial strain, 37 DEG C
12 h are cultivated in insulating box, select positive colony in solid medium with ampicillin, with containing 1: 1000 ammonia benzyl antibiosis
100 mL LB fluid nutrient mediums of element, 200 rpm, 37 DEG C of culture 12-16 h；Utilize the matter for being purchased from TIANGEN biotech firm
Grain extracts kit simultaneously carries out plasmid extraction according to the plasmid extraction kit specification of TIANGEN biotech firm；The matter of extraction
Grain measures concentration and purity by NanoDrop nucleic acid-protein titrator, and extracted plasmid is sequenced；
A3, cell culture：The DMEM culture solution of the 10% new fetal calf serum of inactivation is added after Caco-2 cell recovery, in dioxy
Change carbon incubator（37℃ ,5% CO2）In cultivated；With 0.25% trypsin solution when cell adherent growth is to 80%
It digested, passed on, and logarithmic growth phase cell carries out plasmid transfection experiment；
A4, plasmid transfection：By Caco-2 cell inoculation in 12 orifice plates, it is divided into experimental group, negative control group and blank control
Group, each hole paving 2 × 105A cell, using purchased from PolyPlus company lipofectamine JetPei and according to
JetPei reagent specification is transfected, and 37 DEG C, 5% CO are put into2Constant incubator carries out cell culture；Transfection is for 24 hours after -48h
Transfection positive cells strain is screened with puromycin；In its luciferase expression feelings of fluorescence microscopy microscopic observation after cell transfecting 72-96h
Condition；
A5, puromycin concentration mensuration：By the Caco-2 cell inoculation through transfecting in 12 orifice plates, each hole paving 2 × 105It is a
Cell, in carbon dioxide incubator（37℃ ,5% CO2）Middle culture for 24 hours, the every hole of experimental group is separately added into 1,2,3,4,5,6,7,
8,9,10,11,12 μ g/ml puromycins carry out the screening of minimum lethal concentration (MLC), determine that minimum lethal concentration (MLC) is and by this concentration
Carry out subsequent cell screening and culturing；
A6, real-time quantitative PCR detection CaSR mRNA expression：Caco-2 cell transfecting simultaneously cultivates 48h, and TRIZOL method extracts cell
Total serum IgE；After RNA concentration mensuration, by Superscript First-strand Synthesis System for RT-PCR
Kit prepares RT reaction solution and carries out cDNA reverse transcription reaction；PCR amplification, CaSR-F are carried out with 2 × mix of SYBR: 5'-
GGGCTCTTTCCTATTCAT ' -3, CaSR-R:5'-GCTGTTTATCTCCTCTATG-'3；Internal reference GAPDH-F:5'
CTCCTCCTGTTCGACAGTCAGC-3 ', GAPDH-R: 5'-CCCAATACGACCAAATCCGTT-3'；Amplification condition is：
95°C 10min；94 °C of 25s, 60 °C of 45s, 72 °C of 30s, 45 circulations；Experiment is independent to be repeated 3 times；
The expression of a7, Western Blot detection CaSR albumen：Experimental group and control group that 48h is cultivated after transfection is thin
Born of the same parents take out, and the extraction that the lysate containing 1% protease inhibitors carries out total protein is added；Using the dense of BCA method test sample albumen
Degree；SDS-PAGE electrophoresis is carried out after taking appropriate amount of sample that 95 DEG C of 5 × sample-loading buffer denaturation are added, resolving gel concentration 8% is dense
Contracting gum concentration 5% goes to albumen electricity on PVDF, and room temperature closes 2h；Dilution 1 is added：1000 primary antibody, 4 DEG C are incubated overnight, and wash
Dilution 1 is added in film afterwards three times:The fluorescence secondary antibody of 10000 far infrared label, room temperature, which is protected from light, is incubated for 2h；With Western blot
The development of far infrared visualizer, records result；Experiment repeats three times every time；
B, statistical procedures：In triplicate, quantitative data is with mean ± standard deviation for all experiments（）It indicates；Each group
The expression quantity of the mRNA of CaSR uses-△△Ct method calculates；The protein expression of each group CaSR carries out phase with GAPDH expression
To quantitative；All experimental datas are handled with 16 statistical software of SPSS；P< 0. 05 shows that difference is statistically significant；
C, the identification of plasmid is constructed：
C1, plasmid order-checking identification：The correct recombinant bacterial strain of Preliminary Identification cultivates extraction purification plasmid and carries out Sequence Detection, will
Resulting sequence results are compared with implementation sequence learns that sequencing result is consistent with designed, prompts used in this experiment
Sequence size and direction of insertion it is correct；
C2, the luciferase expression for transfecting cell are horizontal：SiRNA-CaSR, siRNA-scrambled, siRNA-empty transfect cell
After 48h, in fluorescence microscopy microscopic observation cellular morphology and luciferase expression situation, as shown in Figure 1；
The influence of c3, siRNA to CaSR mRNA expression：The mRNA of real-time quantitative PCR testing goal gene C aSR
Expression；As shown in Fig. 2, in transfection siRNA-CaSR group CaSR mrna expression amount significantly lower than siRNA-Scramble and
SiRNA- empty plasmid transfection group；Compared with siRNA-empty, aP < 0.05；Compared with siRNA- scrambled, bP <
0.05；
The influence of c4, siRNA to CaSR protein expression level：It extracts respectively and has transfected siRNA-CaSR, siRNA-
The Caco-2 total protein of cell of Scramble and siRNA-empty, Western Blot detect the expression of CaSR albumen,
As the result is shown：As shown in figure 3, recombinating interference plasmid compared with siRNA-scrambled and siRNA-CaSR transfection group
CaSR protein expression level is substantially reduced in siRNA-CaSR transfection group.
Wherein, people clones colon adenocarcinoma cell Caco-2 cell strain and is purchased from Wuhan University's collection, now by Guangdong medical courses in general
Institute of oncology of Sino-U.S. of university saves；SiRNA plasmid is synthesized by Ji Kai genome company；E.coli DH5 α bacterial strain is Guangdong doctor
Institute of oncology of Sino-U.S. of university of section laboratory is saved.
Wherein, puromycin, ampicillin are purchased from Solarbio company；Cell culture medium DMEM, fetal calf serum purchase
From Gibico company；Enzyme, plasmid extraction kit are purchased from TIANGEN biotech firm in Bbs I；DNTP, lipofectamine
JetPei is purchased from PolyPlus company；TRIZOL, PCR primer, Super Script III reverse
Transcriptase kit purchases Invitrogen company；The anti-human CaSR albumen primary antibody of mouse and the anti-human GAPDH primary antibody of mouse are purchased from
Santa Cruze company；680 goat-anti-mouse IgG of Alexa Flour is purchased from Thermo Scientific company.
Wherein, the LB fluid nutrient medium is prepared using following methods, specifically：Weigh tryptone 10g, yeast mentions
Object 5g, sodium chloride 10g are taken, 1L is settled to, sufficiently shakes up rear high pressure sterilization.
It designs through the above steps, the present invention stablizes the Caco-2 cell strain of expression siCaSR by building, observes institute's structure
The SiRNA expression vector built influences the expression of CaSR mRNA and albumen, is that follow-up study CaSR is infected and its induced in RV
Effect in diarrhea provides a useful experimental tool.
The above is only a preferred embodiment of the present invention, for those of ordinary skill in the art, according to the present invention
Thought, there will be changes in the specific implementation manner and application range, and the content of the present specification should not be construed as to the present invention
Limitation.
Claims (4)
1. a kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR, which is characterized in that include
Following steps, specifically：
A, siRNA-CaSR recombinates the building of interference plasmid：
A1, pass through retrieval ncbi database and designated rna interference sequence, selection 5 '-AAGGAGATCGAGTTTCTGT-3 ' conduct
The interference sequence of experimental group synthesizes corresponding DNA sequence dna；For the DNA sequence dna of synthesis, positive-sense strand is： 5'-TC-
CCAAGGAGATCGAGTTTCTGTTCAAGAGACAGAAACTCGATCTC-CTTTT-3 ', antisense strand are：5'-
CAAAAAAAGGAGATCGAGTTTCT-GTCTCTTGAACAGAAACTCGATCTCCTT-3 ', the TC- in positive-sense strand
CCAAGGAGATCGAGTTTCTGT, ACAGAAACTCGATCTC-CTTTT are to target CaSR interference sequence, in antisense strand
CAAAAAAAGGAGATCGAGTTTCT-GT, ACAGAAACTCGATCTCCTT are targeting CaSR interference sequence；Interference sequence warp
Other coded sequences of Blast analysis, sequence and people are without homology；5 '-GAGTTAACGTGAGGTACTT-3 ' are chosen as yin
Property control interference sequence；Oligonucleotide chain forms double-strand by annealing, is connected to the siRNA by enzyme digestion in Bbs I and carries
Body, enzyme is purchased from TIANGEN biotech firm in the Bbs I；Positive interference plasmid is named as siRNA-CaSR, and negative control interferes matter
Grain is named as siRNA-scrambled, and blank control plasmid is named as siRNA-empty；
The extraction of a2, siRNA-CaSR recombination interference plasmid：Extremely by recombinant plasmid transformedE.coliIn DH5 α bacterial strain, 37 DEG C of perseverances
12 h are cultivated in incubator, select positive colony in solid medium with ampicillin, with containing 1: 1000 ammonia benzyl antibiotic
100 mL LB fluid nutrient mediums, 200 rpm, 37 DEG C of culture 12-16 h；Utilize the plasmid for being purchased from TIANGEN biotech firm
Extracts kit simultaneously carries out plasmid extraction according to the plasmid extraction kit specification of TIANGEN biotech firm；The plasmid of extraction
Concentration and purity are measured by NanoDrop nucleic acid-protein titrator, and extracted plasmid is sequenced；
A3, cell culture：The DMEM culture solution of the 10% new fetal calf serum of inactivation is added after Caco-2 cell recovery, in dioxy
Change and is cultivated in carbon incubator；It digested, passed on 0.25% trypsin solution when cell adherent growth is to 80%,
And logarithmic growth phase cell carries out plasmid transfection experiment；
A4, plasmid transfection：By Caco-2 cell inoculation in 12 orifice plates, it is divided into experimental group, negative control group and blank control
Group, each hole paving 2 × 105A cell, using purchased from PolyPlus company lipofectamine JetPei and according to
JetPei reagent specification is transfected, and 37 DEG C, 5% CO are put into2Constant incubator carries out cell culture；Transfection is for 24 hours after -48h
Transfection positive cells strain is screened with puromycin；In its luciferase expression feelings of fluorescence microscopy microscopic observation after cell transfecting 72-96h
Condition；
A5, puromycin concentration mensuration：By the Caco-2 cell inoculation through transfecting in 12 orifice plates, each hole paving 2 × 105It is a thin
Born of the same parents cultivate for 24 hours in carbon dioxide incubator, and the every hole of experimental group is separately added into 1,2,3,4,5,6,7,8,9,10,11,12 μ g/
Ml puromycin carries out the screening of minimum lethal concentration (MLC), determines that minimum lethal concentration (MLC) is and carries out subsequent cell screening by this concentration
Culture；
A6, real-time quantitative PCR detection CaSR mRNA expression：Caco-2 cell transfecting simultaneously cultivates 48h, and TRIZOL method extracts cell
Total serum IgE；After RNA concentration mensuration, by Superscript First-strand Synthesis System for RT-PCR
Kit prepares RT reaction solution and carries out cDNA reverse transcription reaction；PCR amplification, CaSR-F are carried out with 2 × mix of SYBR: 5'-
GGGCTCTTTCCTATTCAT ' -3, CaSR-R:5'-GCTGTTTATCTCCTCTATG-'3；Internal reference GAPDH-F:5'
CTCCTCCTGTTCGACAGTCAGC-3 ', GAPDH-R: 5'-CCCAATACGACCAAATCCGTT-3'；Amplification condition is：
95°C 10min；94 °C of 25s, 60 °C of 45s, 72 °C of 30s, 45 circulations；Experiment is independent to be repeated 3 times；
The expression of a7, Western Blot detection CaSR albumen：Experimental group and control group that 48h is cultivated after transfection is thin
Born of the same parents take out, and the extraction that the lysate containing 1% protease inhibitors carries out total protein is added；Using the dense of BCA method test sample albumen
Degree；SDS-PAGE electrophoresis is carried out after taking appropriate amount of sample that 95 DEG C of 5 × sample-loading buffer denaturation are added, resolving gel concentration 8% is dense
Contracting gum concentration 5% goes to albumen electricity on PVDF, and room temperature closes 2h；Dilution 1 is added：1000 primary antibody, 4 DEG C are incubated overnight, and wash
Dilution 1 is added in film afterwards three times:The fluorescence secondary antibody of 10000 far infrared label, room temperature, which is protected from light, is incubated for 2h；With Western blot
The development of far infrared visualizer, records result；Experiment repeats three times every time；
B, statistical procedures：In triplicate, quantitative data is with mean ± standard deviation for all experiments（）It indicates；Each group CaSR
MRNA expression quantity use-△△Ct method calculates；It is relatively fixed that the protein expression of each group CaSR is carried out with GAPDH expression
Amount；All experimental datas are handled with 16 statistical software of SPSS；P< 0. 05 shows that difference is statistically significant；
C, the identification of plasmid is constructed：
C1, plasmid order-checking identification：The correct recombinant bacterial strain of Preliminary Identification cultivates extraction purification plasmid and carries out Sequence Detection, will
Resulting sequence results are compared with implementation sequence learns that sequencing result is consistent with designed, prompts used in this experiment
Sequence size and direction of insertion it is correct；
C2, the luciferase expression for transfecting cell are horizontal：SiRNA-CaSR, siRNA-scrambled, siRNA-empty transfect cell
After 48h, in fluorescence microscopy microscopic observation cellular morphology and luciferase expression situation；
The influence of c3, siRNA to CaSR mRNA expression：The mRNA of real-time quantitative PCR testing goal gene C aSR
Expression；
The influence of c4, siRNA to CaSR protein expression level：It extracts respectively and has transfected siRNA-CaSR, siRNA-
The Caco-2 total protein of cell of Scramble and siRNA-empty, Western Blot detect the expression of CaSR albumen,
As the result is shown：Compared with siRNA-scrambled and siRNA-CaSR transfection group, recombination interference plasmid siRNA-CaSR transfection
CaSR protein expression level is substantially reduced in group.
2. a kind of foundation side of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR according to claim 1
Method, it is characterised in that：People clones colon adenocarcinoma cell Caco-2 cell strain and is purchased from Wuhan University's collection, now by Guangdong medical courses in general
Institute of oncology of Sino-U.S. of university saves；SiRNA plasmid is synthesized by Ji Kai genome company；E.coliDH5 α bacterial strain is Guangdong medical courses in general
Institute of oncology of Sino-U.S. of university laboratory is saved.
3. a kind of foundation side of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR according to claim 1
Method, it is characterised in that：Puromycin, ampicillin are purchased from Solarbio company；Cell culture medium DMEM, fetal calf serum purchase
From Gibico company；Enzyme, plasmid extraction kit are purchased from TIANGEN biotech firm in Bbs I；DNTP, lipofectamine
JetPei is purchased from PolyPlus company；TRIZOL, PCR primer, Super Script III reverse
Transcriptase kit purchases Invitrogen company；The anti-human CaSR albumen primary antibody of mouse and the anti-human GAPDH primary antibody of mouse are purchased from
Santa Cruze company；680 goat-anti-mouse IgG of Alexa Flour is purchased from Thermo Scientific company.
4. a kind of foundation side of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR according to claim 1
Method, which is characterized in that the LB fluid nutrient medium is prepared using following methods, specifically：Weigh tryptone 10g, yeast mentions
Object 5g, sodium chloride 10g are taken, 1L is settled to, sufficiently shakes up rear high pressure sterilization.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810770762.8A CN108893485A (en) | 2018-07-13 | 2018-07-13 | A kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810770762.8A CN108893485A (en) | 2018-07-13 | 2018-07-13 | A kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108893485A true CN108893485A (en) | 2018-11-27 |
Family
ID=64349701
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810770762.8A Pending CN108893485A (en) | 2018-07-13 | 2018-07-13 | A kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108893485A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101594908A (en) * | 2007-01-03 | 2009-12-02 | 加利福尼亚大学董事会 | Transfection is used for the treatment of the apparatus and method of gene, siRNA, shRNA carrier and the other biological medical diagnosis and the medicine of large animal and people's arthritis and other plastic surgery's diseases in the body born of the same parents |
| CN103343125A (en) * | 2013-06-18 | 2013-10-09 | 山西医科大学 | shRNA for inhibiting colon cancer cell PRPS2 expression, construction method of vector of shRNA, and use of shRNA |
| CN107858351A (en) * | 2017-11-01 | 2018-03-30 | 扬州大学 | A kind of applications of double-strand siRNA in the medicine for preparing malignant tumour |
-
2018
- 2018-07-13 CN CN201810770762.8A patent/CN108893485A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101594908A (en) * | 2007-01-03 | 2009-12-02 | 加利福尼亚大学董事会 | Transfection is used for the treatment of the apparatus and method of gene, siRNA, shRNA carrier and the other biological medical diagnosis and the medicine of large animal and people's arthritis and other plastic surgery's diseases in the body born of the same parents |
| CN103343125A (en) * | 2013-06-18 | 2013-10-09 | 山西医科大学 | shRNA for inhibiting colon cancer cell PRPS2 expression, construction method of vector of shRNA, and use of shRNA |
| CN107858351A (en) * | 2017-11-01 | 2018-03-30 | 扬州大学 | A kind of applications of double-strand siRNA in the medicine for preparing malignant tumour |
Non-Patent Citations (2)
| Title |
|---|
| GUANGMING LIU ET AL: "Vitamin D mediates its action in human colon carcinoma cells in a calcium-sensing receptor-dependent manner: downregulates malignant cell behavior and the expression of thymidylate synthase and survivin and promotes cellular sensitivity to 5-FU", 《INTERNATIONAL JOURNAL OF CANCER》 * |
| 梁霄 等: "小干扰RNA沉默细胞外钙敏感受体抑制人脐静脉内皮细胞钙内流和NO生成", 《生理学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107828738A (en) | A kind of dnmt rna deficiency Chinese hamster ovary celI system and preparation method and application | |
| JP2009534036A5 (en) | ||
| CN106282347A (en) | HoxC11 as biomarker preparation adenocarcinoma of lung pre-diagnostic reagent in application | |
| CN104673934A (en) | Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof | |
| CN103834692B (en) | A kind of lentiviral vectors for expressing lncRNA and application thereof | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN105219881A (en) | The test kit of a kind of detection by quantitative ERCC1-202 and application | |
| CN109913423A (en) | A kind of the recombination Vero cell line and application of stable expression pig Delta coronavirus N protein | |
| CN109402171A (en) | A kind of Bursaphelenchus xylophilus RNAi controlling gene and its application | |
| CN110747199B (en) | Bee stress-resistance related gene NF-Y and application thereof | |
| CN107828872A (en) | The detection reagent of Pygo2 gene expressions in Wnt signal paths based on peptide nucleic acid probe | |
| CN105624162B (en) | For the siRNA of mammal R-Spondin2 gene targets, ShorthairpinRNA and carrier and application | |
| CN102220330A (en) | MiRNA-gma-miR56b related to drought resistance of plants and application thereof | |
| CN102558336B (en) | The albumen and application of PRR11 genes and its coding | |
| CN108893485A (en) | A kind of method for building up of the Caco-2 stable cell line of RNA interference calcium-sensing receptor CaSR | |
| CN104711240B (en) | The application of Avianreovirus σ A albumen and its relevant biological material | |
| CN104531760B (en) | The short hairpin RNA interference plasmid and its application process of Dp71 albumen | |
| CN105586344B (en) | Inhibit siRNA and its application of influenza virus related gene | |
| CN113185558B (en) | Galactose modified detection probe capable of being identified by OGT (one glass solution) | |
| CN109172597A (en) | Adjust substance and its application of the histone methylated level of rDNA gene chromatin | |
| CN104762274B (en) | The application of Avianreovirus σ NS albumen and its relevant biological material | |
| CN103215309B (en) | The method of express polypeptide | |
| CN105925576B (en) | SiRNA, ShorthairpinRNA and carrier and application for mammal R Spondin3 gene targets | |
| CN110241085A (en) | A kind of human bladder cancer's T24/DDP cell strain that NPM1 is knocked out | |
| CN105462906A (en) | Fluorescence-labeled escherichia coli capable of planting animal intestine and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181127 |