CN108866176B - Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene - Google Patents
Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene Download PDFInfo
- Publication number
- CN108866176B CN108866176B CN201710559655.6A CN201710559655A CN108866176B CN 108866176 B CN108866176 B CN 108866176B CN 201710559655 A CN201710559655 A CN 201710559655A CN 108866176 B CN108866176 B CN 108866176B
- Authority
- CN
- China
- Prior art keywords
- cgg
- primer
- product
- repeat
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 108091026898 Leader sequence (mRNA) Proteins 0.000 title claims abstract description 16
- 101150082209 Fmr1 gene Proteins 0.000 title claims description 31
- 238000001514 detection method Methods 0.000 title abstract description 53
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 10
- 230000003321 amplification Effects 0.000 claims description 44
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 44
- 230000003252 repetitive effect Effects 0.000 claims description 35
- 239000012634 fragment Substances 0.000 claims description 32
- 230000004048 modification Effects 0.000 claims description 15
- 238000012986 modification Methods 0.000 claims description 15
- 239000000203 mixture Substances 0.000 claims description 12
- 238000012360 testing method Methods 0.000 claims description 5
- 230000002441 reversible effect Effects 0.000 claims description 4
- 108091093037 Peptide nucleic acid Proteins 0.000 claims description 2
- 108020004707 nucleic acids Proteins 0.000 claims description 2
- 102000039446 nucleic acids Human genes 0.000 claims description 2
- 150000007523 nucleic acids Chemical class 0.000 claims description 2
- 230000026731 phosphorylation Effects 0.000 claims description 2
- 238000006366 phosphorylation reaction Methods 0.000 claims description 2
- RYYWUUFWQRZTIU-UHFFFAOYSA-K thiophosphate Chemical compound [O-]P([O-])([O-])=S RYYWUUFWQRZTIU-UHFFFAOYSA-K 0.000 claims 1
- 108090000623 proteins and genes Proteins 0.000 abstract description 9
- 238000000034 method Methods 0.000 description 27
- 230000035772 mutation Effects 0.000 description 20
- 208000001914 Fragile X syndrome Diseases 0.000 description 14
- 230000000295 complement effect Effects 0.000 description 14
- 238000012408 PCR amplification Methods 0.000 description 11
- 108020004414 DNA Proteins 0.000 description 7
- 230000003247 decreasing effect Effects 0.000 description 7
- 238000006243 chemical reaction Methods 0.000 description 6
- 101000828537 Homo sapiens Synaptic functional regulator FMR1 Proteins 0.000 description 5
- 238000005251 capillar electrophoresis Methods 0.000 description 5
- ZHNUHDYFZUAESO-UHFFFAOYSA-N Formamide Chemical compound NC=O ZHNUHDYFZUAESO-UHFFFAOYSA-N 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 3
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 3
- 102100023532 Synaptic functional regulator FMR1 Human genes 0.000 description 3
- 239000000872 buffer Substances 0.000 description 3
- 230000007423 decrease Effects 0.000 description 3
- 201000010099 disease Diseases 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- 239000008223 sterile water Substances 0.000 description 3
- 108091029523 CpG island Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 208000036626 Mental retardation Diseases 0.000 description 2
- 101100013186 Mus musculus Fmr1 gene Proteins 0.000 description 2
- 208000002500 Primary Ovarian Insufficiency Diseases 0.000 description 2
- 210000001766 X chromosome Anatomy 0.000 description 2
- 239000007853 buffer solution Substances 0.000 description 2
- 238000003759 clinical diagnosis Methods 0.000 description 2
- 238000012217 deletion Methods 0.000 description 2
- 230000037430 deletion Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000003205 genotyping method Methods 0.000 description 2
- 238000002347 injection Methods 0.000 description 2
- 239000007924 injection Substances 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 208000027087 primary ovarian insufficiency 1 Diseases 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 238000011895 specific detection Methods 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 238000013518 transcription Methods 0.000 description 2
- 230000035897 transcription Effects 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- KWIUHFFTVRNATP-UHFFFAOYSA-N Betaine Natural products C[N+](C)(C)CC([O-])=O KWIUHFFTVRNATP-UHFFFAOYSA-N 0.000 description 1
- LSNNMFCWUKXFEE-UHFFFAOYSA-M Bisulfite Chemical compound OS([O-])=O LSNNMFCWUKXFEE-UHFFFAOYSA-M 0.000 description 1
- 206010008025 Cerebellar ataxia Diseases 0.000 description 1
- 201000010374 Down Syndrome Diseases 0.000 description 1
- 206010058314 Dysplasia Diseases 0.000 description 1
- 108700024394 Exon Proteins 0.000 description 1
- 206010064571 Gene mutation Diseases 0.000 description 1
- 108700039691 Genetic Promoter Regions Proteins 0.000 description 1
- 208000023105 Huntington disease Diseases 0.000 description 1
- 108091092195 Intron Proteins 0.000 description 1
- KWIUHFFTVRNATP-UHFFFAOYSA-O N,N,N-trimethylglycinium Chemical compound C[N+](C)(C)CC(O)=O KWIUHFFTVRNATP-UHFFFAOYSA-O 0.000 description 1
- 239000004743 Polypropylene Substances 0.000 description 1
- 108091081062 Repeated sequence (DNA) Proteins 0.000 description 1
- 208000036623 Severe mental retardation Diseases 0.000 description 1
- 238000002105 Southern blotting Methods 0.000 description 1
- 206010044565 Tremor Diseases 0.000 description 1
- 208000027642 X-Linked Genetic disease Diseases 0.000 description 1
- 208000010206 X-Linked Mental Retardation Diseases 0.000 description 1
- 208000019291 X-linked disease Diseases 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 229960003237 betaine Drugs 0.000 description 1
- 230000033228 biological regulation Effects 0.000 description 1
- 239000000969 carrier Substances 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000009223 counseling Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000004907 flux Effects 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 230000005861 gene abnormality Effects 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 230000011987 methylation Effects 0.000 description 1
- 238000007069 methylation reaction Methods 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 238000002715 modification method Methods 0.000 description 1
- 210000005036 nerve Anatomy 0.000 description 1
- -1 polypropylene Polymers 0.000 description 1
- 229920001155 polypropylene Polymers 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 238000003793 prenatal diagnosis Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000012502 risk assessment Methods 0.000 description 1
- 208000031906 susceptibility to X-linked 2 autism Diseases 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
- 238000006863 thiophosphorylation reaction Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detection system and a detection kit for the number of CGG unit repeats in a 5' untranslated region of a gene. The detection system comprises 3 primers positioned at the upstream, downstream and repeated segment boundary of the CGG repeated segment, and the number of CGG repeated units can be judged according to two results of the size of the full-length product and the number of CGG products obtained by detection. In particular, since primers at the boundaries of repeat segments bind more strongly to the corresponding template, the maximum CGG product can be determined more clearly, and thus the specific number of CGG repeats can be determined accurately, the number of repeats smaller than 60 can be determined efficiently and accurately, and the presence or absence of a genotype with a larger number of repeats can be determined clearly.
Description
Technical Field
The invention relates to the detection of the number of gene CGG unit repeats, can provide reference for the clinical diagnosis of fragile X syndrome, and belongs to the clinical molecular detection technology in the field of biomedicine.
Background
Fragile X Syndrome (FXS) is a common X chromosome linked genetic disease, and typical main symptoms are moderate to severe mental retardation, behavior and physical dysplasia and the like. The incidence rate of the Chinese medicinal preparation is second to Down syndrome in hereditary mental retardation syndrome, accounts for 10-20% of male mental retardation and accounts for 40% of X-linked mental retardation.
The occurrence of fragile X syndrome is closely related to FMR1 gene abnormality. More than 95 percent of the fragile X syndrome is caused by the CGG repetitive structure extension mutation of the 5' untranslated region of the X chromosome FMR1 gene, and less than 5 percent of the fragile X syndrome is caused by the influence of missense mutation and deletion mutation of the FMR1 gene on the normal function of the FMR1 gene.
The FMR1 gene is located in chromosome Xq27.3, 38kb in length, and contains 17 exons and 16 introns. The 5' untranslated region of the FMR1 gene has a (CGG) n trinucleotide tandem repeat sequence. The change of the number n of the CGG repeats can affect the methylation of the CGG repeat region and the upstream CpG island, affect the normal transcription of the FMR1 gene and further cause corresponding clinical symptoms.
The FMR1 gene can be classified into full mutation (full mutation), pre-mutation (mutation), intermediate (intermediate) and normal according to the number of CGG repeats. There are two clinically accepted genotyping criteria, which are established by the American College of Medical Genetics (American College of Medical Genetics) and the European Society of Human Genetics (European Society for Human Genetics), and the specific values are shown in Table 1.
TABLE 1 FMR1 genotyping criteria based on CGG repeat number
When the number of CGG repeats, n, is greater than 200, it is defined as a total mutation in the FMR1 gene. At the moment, CpG islands in FMR1 promoter regions are highly methylated, the transcription of FMR1 genes is inhibited, protein products are deleted, the related nerve functions are affected, and individuals show typical fragile X syndrome characteristics such as low intelligence, self-closing and the like; when n is between 55-200 or 59-200, it is called a premutation of FMR1 gene. The pre-mutation may generate excessive mRNA, which in turn may affect the regulation of expression of multiple proteins. The premutation is considered to be a risk factor for causing fragile X-associated primary ovarian insufficiency (FXPOI) and fragile X-associated tremor ataxia syndrome (FXTAS).
Fragile X syndrome is a dynamic gene mutation disease. On the basis of invisible inheritance of the X chromosome, the CGG repetition number n of the FMR1 gene of the offspring is likely to be changed on the basis of the CGG repetition number of the parent generation. When the number of repetitions of the parent is greater than 60, a certain proportion of CGG repetitions of the child is expanded, and the number of repetitions n of the child is increased relative to the number of the parent. When the number of the parent repeats is more than 100, the CGG repeats of the offspring are basically expanded to generate more CGG repeats, and the full mutant FMR1 gene is possibly generated to further cause fragile X syndrome.
The normal FMR1 gene typically has 1-3 AGG insertions within the CGG repeat region. The full and pre-mutant FMR1 genes may have no or only a small number of AGGs. The number of AGG is believed to be related to the genetic stability of the CGG repeats, with fewer AGG numbers presenting a greater risk of expansion of the progeny CGG repeats.
The fragile X syndrome has high incidence and carrying rate, and no effective treatment method exists at present. The repeated detection of the FMR1 gene CGG is carried out on high-risk people or people with procreation willingness, the birth of children patients is reduced through genetic counseling and prenatal diagnosis, and the method is an effective method for preventing the disease. In particular, female carriers of the pre-mutant genes are often phenotypically normal, while their progeny are at risk of an increase in CGG repeats. Therefore, the detection of CGG repeats in FMR1 gene should be able to detect the pre-mutation in addition to the full-length mutation. The classification standard of the American medical genetics institute and the European human genetics institute is combined, and the specific repetition number can be accurately determined for 40-60 repetitions so as to meet the requirements of clinical typing, risk assessment and the like.
Southern blotting is a conventional method for detecting the number of CGG repeats of the FMR1 gene. However, the method is mainly limited in that the number of the specific CGG repeats cannot be accurately judged, false negative results are easily generated due to improper operation, and the method is complicated to operate and is not suitable for large-scale clinical detection.
The number of CGG repeats can be detected by PCR. However, conventional PCR amplification using a fragment of interest containing a CGG repeat as an amplification template using only the two primers downstream of the above is not suitable for this detection. Since the number of CGG repeats may exceed 1000, too many CGG repeats mean a larger product fragment length and a higher GC content, which in turn leads to inefficient amplification of the template, resulting in false negative detection. This is particularly serious for female carrier testing.
For the high GC content of the high repetitive sample, researchers adopt a bisulfite modification method to reduce the GC content, and then perform PCR amplification to reduce the amplification difficulty caused by the high GC content. The method has high requirements on DNA and is complicated to operate, and more importantly, the method cannot effectively solve the problems of difficult amplification and false negative caused by overlong product fragment length.
For the detection of dynamic mutation diseases including fragile X syndrome, repeat-primer PCR (RP PCR) is a more effective and approved method. The method introduces a repetitive primer which is complementary with a repetitive sequence into a system, and performs PCR amplification together with a downstream reverse primer. Since the repeat primer can bind to each position on the repeat segment, a series of products of different sizes are produced (see FIG. 1A). When the number of the repetition is less, the number of the repetition can be calculated according to the size and the number of the products; when the number of the repeated sequences is large, although the large fragment product cannot be effectively amplified, various products with smaller fragments can be amplified, and the existence of the products indicates that the genes with high repetition number exist, so that the false negative result is avoided.
One problem encountered with the above method is that, since the amplification product containing longer repeats can be used as a template for a product with shorter length, after multiple rounds of PCR amplification, the amount of small fragment products will exponentially exceed the amount of large fragment products, resulting in too low amplification efficiency for the products with larger fragments, too small number of detectable effective products, and failure to make an effective judgment on the number of repeats. In fact, the initial duplicate PCR method used 3 primers in total (TP PCR) (Warner et al, J Med Genet, 1996; 33(12):10022) to overcome this problem. Adding a heterologous sequence at the 5' end of the repetitive primer, wherein the third primer is identical to the sequence, and reducing the amount of the repetitive primer, so that the repetitive primer is exhausted in the early stage of PCR amplification, and the subsequent amplification is performed by using a reverse primer on the third primer, so that the preferential amplification of a short product depending on a long product can be avoided, and the amplification capability of the long product can be improved (as shown in FIG. 1B).
Products of RP PCR or TP PCR can be detected by agarose electrophoresis, polypropylene gel electrophoresis, capillary electrophoresis and the like. The capillary electrophoresis detection has high sensitivity and high resolution, and can realize quantitative detection of the number of repetition, so the method is more suitable for the detection and has wider application.
The fragile X syndrome is characterized in that the number of repeated segments is more than 1000 compared with dynamic mutation diseases such as Huntington chorea and the like; the repeating unit is CGG, and the GC content is very high; 40-60 repeats are of great significance for clinical typing, and the number of specific CGG repeats should be accurately detected.
Even with the use of various, equally optimized PCR methods and conditions, the products of the repetitive fragment will exhibit a tendency to decrease in product quantity as the length of the product increases. Due to the slippage phenomenon during PCR, more repetitive products than the actual template are generated. This can have an effect on determining the maximum product peak in the repeat product, especially when the number of repeats is large and the corresponding repeat product peak is low, such as the case where the number of CGG repeats is in the range of 40-60 (fig. 2A). Some studies or patents (e.g., chinese patent CN 102449171B) add bases matching to a specific template sequence at the 3' end of the repetitive primer, which mainly aim to more accurately locate AGG in the CGG repeat region and cannot improve the difficulty in determining the maximum peak of the above repetitive product.
Disclosure of Invention
The invention aims to provide a detection system for the number of CGG repeating units in a 5' untranslated region of an FMR1 gene, which combines two methods of CGG repeating region full-length PCR amplification and repeat-primer PCR (RP PCR), uses 3 primers for amplification to realize the detection of the number of CGG repeating units, can effectively and accurately determine the number of repeats less than 60, and can definitely determine whether a genotype with larger number of repeats exists.
The invention also provides a corresponding detection kit of the detection system.
A primer composition for amplifying CGG repeat region on 5' untranslated region of FMR1 gene, comprising 3 primers: primer 1 located upstream of the CGG repeat, primer 2 located downstream of the CGG repeat, and primer 3 located at the boundary of the CGG repeat.
The primer 3 is as follows:
(a) the 3' end of the primer is a 9-18bp sequence repeated regularly by GCG or GCC;
(b) in the 5 'region adjacent to the 3' repeat, there is a 1-6bp sequence consistent with GGCAGC or GGCCCA.
The gene is FMR1 gene, and the primers are respectively as follows:
preferably: primer 3: AGCCGCCGCCGCCGCC, or GCGCGGCGGCGGCGGCG.
Preferably: primer 1: GCCTCAGTCAGGCGCTCAGCTCCGT the flow of the air in the air conditioner,
primer 2: ATTGGAGCCCCGCACTTCCACCACCAGCT are provided.
The primers 1, 2 and 3 are added with modifications or normal bases are replaced by modified bases, and the modifications are fluorescence group modifications, phosphorylation modifications, thiophosphorylation modifications, locked nucleic acid modifications or peptide nucleic acid modifications.
The primers 1, 2 and 3 are modified by 1 to 3 bases at the 3 'end from-2 to-15 and/or modified after the 3' end from-15, wherein the modification comprises adding other sequences at the tail end, deleting partial tail end sequences and changing partial base sequences.
The amplification is carried out in one amplification system simultaneously or in two systems respectively.
The amplification is respectively performed in two systems; in the first system amplification using primer 1 and primer 2 gave full length product, in the second system primer 3 and reverse primer 1 or primer 2 gave CGG product.
A method for judging the number of CGG repeating units in the 5' untranslated region of FMR1 gene comprises the steps of amplifying by adopting the primer composition, detecting to obtain the number of CGG products and the size and the number of full-length products, and judging the number of CGG repeating units by combining two results; when the number of repetitions deduced according to the two results is consistent, making a clear judgment on the specific number of the CGG repetitions; when the two results are inconsistent, especially when the number of CGG products is larger than the number of CGG corresponding to the size of the full-length product, the sample is indicated to have a high repetition number of CGG.
A detection kit for detecting the number of CGG repeating units in the 5' untranslated region of FMR1 gene comprises any one of the primer compositions.
The gene is FMR1 gene, and the primers are respectively as follows:
primer 1: GCCTCAGTCAGGCGCTCAGCTCCGT the flow of the air in the air conditioner,
primer 2: ATTGGAGCCCCGCACTTCCACCACCAGCT the flow of the air in the air conditioner,
primer 3: AGCCGCCGCCGCCGCC are provided.
The primers adopted by the invention comprise: primer 1 located upstream of the CGG repeat, primer 2 located downstream of the CGG repeat, and primer 3 located at the boundary of the CGG repeat (see fig. 1C).
One of the major innovations in the proposed method is that the repeat primer is complementary to the CGG border sequence (see fig. 1C).
With this design, the repeat primer can still rely on its 3' sequence to bind to various positions on the repeat segment to initiate amplification. Meanwhile, as the repetitive primer is complementary with the CGG boundary sequence, the repetitive primer is combined with the boundary more matched bases than the repetitive sequence inside, has stronger combining capacity and higher amplification efficiency. Furthermore, the amplification efficiency of the repeat product corresponding to the maximum repeat number in the system is higher than that of other repeat products, the product amount is larger than that of other products, the repeat product corresponding to the maximum repeat number is easier to determine, and various interferences caused by amplification slippage and the like are eliminated; secondly, the proportion of the amplification products of the shorter repeat fragments in the total product is relatively reduced, and the ability to efficiently amplify a larger number of repeat products is improved, even in the case where the largest repeat product cannot be amplified.
The provided method simultaneously detects the number of CGG products and the size and the number of full-length products, and combines the two results to judge the number of CGG repeating units.
As mentioned above, the number of CGG repeat units can be determined based on the number of CGG products alone or the size and number of full-length products, but are defective as clinical tests. It is difficult to clearly determine the number of repeats based only on the number of CGG products when the number of repeats is high, even slightly high (greater than 40); the inability to distinguish between normal pure and full mutation/pre-mutation heterozygous samples based on the size and quantity of the full-length product alone can result in false negative detection. The number of the CGG repeating units is judged by combining the two results, so that the defects are avoided, and the detection reliability is improved. Under the condition of low repetition number, the two detection results mutually verify; under the condition of medium repetition number, the repetition number can be more clearly judged by the result of the CGG product due to the complementarity of the repeated primer and the CGG boundary sequence, and the result is verified with the full-length result; under the condition of high repetition number, when the number of the CGG products is larger than that of the CGG corresponding to the detected size of the full-length product, the sample is proved to have the high repetition number CGG, so that false negative can be effectively avoided.
The application also provides a detection kit for detecting the number of CGG repeating units in the 5' untranslated region of the FMR1 gene based on the method.
The provided kit adopts the detection method and the detection strategy. The kit comprises a primer composition, an enzyme complex, an amplification buffer system or a mixture of the components, and also comprises components such as a known repetition number control, a capillary electrophoresis detection related reagent and the like.
The use of the provided kit mainly comprises the following steps: preparing an amplification system; PCR amplification; detecting by capillary electrophoresis; and (6) analyzing the data.
The provided kit can effectively and accurately determine the number of repeats less than 60 and can definitely determine whether a genotype with a larger number of repeats exists. In addition, the method has the detection characteristics of simple operation, strong specificity, high sensitivity, high flux, strong reliability and low cost.
Although the method of the present invention is used for detecting the number of CGG repeats in the 5 'untranslated region of FMR1 gene, the method of the present invention can be applied to the detection of CGG repeats in the 5' untranslated region of any gene.
Drawings
FIG. 1: schematic primer set-up for various methods for detecting the number of repeat units.
The boxed region is the CGG repeat region, and the arrows indicate the primers used for detection and their corresponding positions.
A, repeat primer PCR (RP PCR) primer set. The repeat primer can bind to various positions on the repeat fragment, and therefore a series of products of different sizes are produced.
B, three primer PCR (TP PCR) primer setting. A heterologous sequence is added to the 5' end of the repetitive primer, and the third primer is consistent with the sequence.
And C, setting the primer. The repeat primer is added with a sequence (open box) complementary to the CGG border sequence at the 5' end, and the repeat primer can still bind to each position on the repeat fragment, but the matched sequence is longer when it binds to the CGG border.
FIG. 2: and comparing the repeated PCR detection results of the repeated primers and the CGG boundary sequence complementary fragments with different lengths.
When the fragments complementary to the CGG border sequence 0nt (A), 1nt (B), 3nt (C) are added to the 5' end of the repetitive primer, the result of PCR detection of the repetitive fragment is performed on a female sample with the CGG repetition number of 30/55. Arrows indicate the peaks of the repeat products corresponding to 30CGG and 55 CGG.
FIG. 3: and (5) a sample detection result graph with different repetition numbers.
And (3) detecting results of different samples by using the kit, wherein the results comprise full-length products and repeated products.
A, full mutation and 30CGG heterozygous samples. B, 58 and 30CGG pre-mutation heterozygous samples. C, 29 and 30CGG normal samples. The arrow indicates the number of sample repeats corresponding to the peak of the repeat product.
Detailed Description
In the following, the detection of the number of CGG repeats in the 5' untranslated region of the FMR1 gene is merely an example, which is merely illustrative of the effectiveness of the method and does not limit the same.
Example 1: CGG repeat detection with repeat primers with different length of segments complementary to CGG border sequences
The following three primers are respectively adopted as repetitive primers to detect the CGG repetition of the sample to be detected:
primer A: GCCGCCGCCGCCGCC
And (3) primer B: AGCCGCCGCCGCCGCC
And (3) primer C: CCAGCCGCCGCCGCCGCC
The 3' ends of the three sequences are identical and are all complementary to 5 (CGG). They differ in that primer A contains only repetitive sequences, does not have sequences complementary to the CGG border sequence, and corresponds to the primers used in conventional repetitive primer PCR (RP PCR); primer B adds 1 base complementary to CGG boundary sequence at the 5' upstream of the repetitive fragment; primer C added 3 bases complementary to the CGG border sequence 5' upstream of the repeat.
The sequence of the upstream primer is as follows: FAM-GCCTCAGTCAGGCGCTCAGCTCCGT.
Besides the primers, the amplification system also comprises the following components: DNA polymerase (aptaqq, roche); amplification buffers (Suzhou Gen technology, Inc.), including dNTPs, 7-deaza-dGTP, betaine, etc.
The sample tested was a female sample with a CGG repetition number of 30/55.
The specific detection steps are as follows:
1) and preparing a PCR amplification reaction system. Each amplification reaction system comprises 5 mu L of primer mixture, 10 mu L of amplification buffer, 1 mu L of DNA polymerase, 1 mu L of sample DNA to be detected and 20 mu L of sterile water.
2) And (4) PCR amplification. The reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 94 ℃, 30 seconds, 60 ℃, 30 seconds, 72 ℃ for 2 minutes; 60 ℃ for 30 minutes.
3) And (5) carrying out capillary electrophoresis detection on the amplification product. Preparing a sample mixture (0.5 mu L of molecular weight internal standard +8.5 mu L of formamide) mixed with the molecular weight internal standard and the formamide; and (3) subpackaging 9 mu L of the sample loading mixed solution, adding 1 mu L of the amplification product, uniformly mixing, performing denaturation at 95 ℃ for 3 minutes, and performing ice bath for 3 minutes. The detection was performed according to the manual procedure of the genetic analyzer user. The detection suggests setting the sample injection time to 10 seconds, the sample injection voltage to 3kV, and the running time to 1800 seconds.
4) And (6) analyzing the data. Relevant files, including Panel, Bin, corresponding Analysis Method, ROX500 internal standard, were imported into GeneMapper software. The sample source data (. fsa file) is input, and the previously imported file is selected in the relevant parameter selection field, and the data is analyzed.
The final electrophoresis result is shown in FIG. 2. Wherein A is a graph showing the results obtained by using the repetitive primer A, B is a graph showing the results obtained by using the repetitive primer B, and C is a graph showing the results obtained by using the repetitive primer C.
As shown, the results of the tests using different repeat primers are substantially similar. The amplification products consisted of a series of products 3nt apart, corresponding to the products formed by the repeat primers binding to the CGG repeat region at different positions. Where the smallest repeat product of the fragment corresponds to 5CGG repeats, followed by one more CG for every 3nt larger peakG repeated amplification products. Since the longer product can be used as a template for the shorter product in amplification, the peak height of the product will show a decreasing trend of higher small fragments and lower large fragments. In addition, due to the AGG insertion in the CGG repeat region, there is a partial deletion of the product peak or a significant decrease in peak height, usually 5 consecutive product peaks. According to the peak patterns, the two CGG repeated region repeated units copied from FMR1 of the sample can be judged to be respectively. (CGG)9AGG(CGG)9AGG(CGG)10And (CGG)44AGG(CGG)10. The detection of AGG is not claimed in the present invention and will not be further discussed herein.
Since the peak height of the repeat product decreases with increasing fragment length, and because of possible AGG interference, it is difficult to determine the maximum product peak for samples with a large number of repeats, i.e. to determine the number of CGG repeats accurately. As shown in fig. 2A, the right arrow indicates a repeat product peak corresponding to 55 repeats, and its peak height is not significantly different from the peak heights of several adjacent product peaks nearby, which is difficult to accurately determine. In fact, for the repeat product peak with 30 repeats shown by the left arrow, it is difficult for the inexperienced person to determine it due to interference from another different copy of the amplification product. The maximum product peak is difficult to accurately judge, so that the number of CGG repeats cannot be accurately judged, which has great influence on clinical diagnosis application, and particularly when the CGG repeats are in a 40-60 repeat interval, the total mutation, the pre-mutation and the normal sample cannot be judged directly.
The above problem that it is difficult to accurately determine the maximum product peak is well improved when the repetitive primer B is used. As shown in fig. 2B, the two product peaks, shown by the arrows corresponding to 30 and 55, repeat with a peak height significantly higher than the adjacent product peak. For the 55 repeated product peak, the peak height reaches more than 5 times of the adjacent product peak; for the 30 repeat product peak, the peak height can be up to 2 times that of the adjacent product peak, although there is another copy of interference. Such a difference makes it possible to determine the maximum product peak and thus the number of CGG repetitions of the sample to be tested very simply and unambiguously. This is due to the fact that the repetitive primer B used is added with a base G at the 3' end of the repetitive fragment, so that the repetitive primer B can be completely complementary to the CGG border sequence (see FIG. 1C). Thus, the repeat primer B binds to the CGG boundary more matched bases than to the internal repeat sequence, and has stronger binding ability and higher amplification efficiency. This amplification advantage is further amplified as the PCR cycles. Finally, the product amount of the repeat product corresponding to the maximum number of repeats is larger than that of the other products, and it is easier to determine the repeat product corresponding to the maximum number of repeats.
When using repeat primer C with 3nt addition complementarity, the two product peaks corresponding to 30 and 55 repeats, as shown by the arrows in FIG. 2C, were also significantly improved. However, the amplification efficiency is higher when the base pairs are matched with more bases and combined with the CGG boundary, so that the peak height of the product of the adjacent products with less repetition number is indirectly increased while the peak height of the maximum product is increased. As a result, although the maximum product peak can be judged more clearly, the difference is not as significant as that in fig. 1B.
In conclusion, the maximum product peak is difficult to determine by using only the repeat primer (repeat primer A); the repeated primer with the segment complementary with the CGG boundary sequence at the 3' end is used, so that the peak height of the maximum product can be improved, and the peak of the maximum product can be accurately judged by cleaning; preferably, the discrimination effect of the repetitive primer B is most desirable in which a matching base is added to the 3' end of the repetitive fragment. Example 2: the detection kit disclosed by the invention is used for detecting different types of samples
The kit comprises the following components: enzyme mixed liquor, full-length primer mixed liquor, repeated primer mixed liquor, amplification buffer liquor, positive control, sterile water, internal standard and the like.
And detecting the three samples to be detected by using the kit.
The specific detection steps are as follows:
1) and preparing a PCR amplification reaction system. Each amplification reaction system comprises 2.5 mu L of full-length primer mixed liquor, 2.5 mu L of repeated primer mixed liquor, 10 mu L of amplification buffer solution, 1 mu L of DNA polymerase, 1 mu L of sample DNA to be detected and 20 mu L of sterile water.
2) And (4) PCR amplification. The reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 94 ℃, 30 seconds, 60 ℃, 30 seconds, 72 ℃ for 4 minutes; 60 ℃ for 30 minutes.
The subsequent detection procedure was the same as in example 1.
The detection of the kit is different from that of the embodiment 1 in the greatest way, the kit system uses 3 primers including an upstream primer, a repeat primer and a downstream primer, the full-length fragment is amplified while the repeat fragment is amplified, and the repeat number is comprehensively judged according to the results of the full-length product and the repeat product.
The sequence of the upstream primer is as follows: FAM-GCCTCAGTCAGGCGCTCAGCTCCGT;
the repetitive primers used were of the sequence: AGCCGCCGCCGCCGCC, respectively;
the sequence of the used downstream primer is as follows: ATTGGAGCCCCGCACTTCCACCACCAGCT are provided.
As shown in fig. 3, the full-length product peak is one in which the peak pattern, peak height and tendency are significantly different from those of the repeat product peak in the length range of about 300nt and more. Using the peak product size of the full-length product of a sample with a known number of repeats, a fitting equation of the number of repeats and the product size can be obtained, and thereby the number of CGG repeats corresponding to the full-length product can be estimated. This method is more accurate when the number of repetitions is small, and may generate a certain deviation when the number of repetitions is too large.
The following three actual test results are used to illustrate a specific method for determining the repeat number based on the results of the full-length product and the repeat product.
The result of the measurement of sample 1 is shown in FIG. 3A. A very high full-length product peak is seen at about 330nt, with a corresponding number of repeats estimated to be about 30 based on the fragment size. The repeat product peak is a series of consecutive peaks with decreasing overall trend, with a product peak with a significant increase in peak height at 230nt (indicated by the arrow). It is the 26 th product peak, corresponding to a repeat number of 30, which is consistent with the full-length product corresponding results. There are still a large number of successive decreasing product peaks in larger segments of the product peak, extending at least to 500nt, and the maximum product peak cannot be determined. These product peaks indicate that there is also one copy of the FMR1 gene, which is too large to be detected efficiently. Calculated as 500nt product peak, the number of repeats exceeded 120. Combining the repeat product and full-length product results, the sample was a heterozygous sample of 30 repeats and one high repeat number. If only full-length results are available, the sample can be judged as a female with 30 repeated homozygosity or a male with 30 repeated homozygosity, and false negative detection can be caused. This is also the necessity for a combined determination of full length and repeat results.
The result of the detection of sample 2 is shown in FIG. 3B. Two full-length product peaks are visible at about 330nt and 420nt, with corresponding repeat numbers of about 30 and about 60, estimated from their fragment sizes. The repeat product peaks are a series of consecutive peaks with decreasing overall trend, where two maximum product peaks are clearly visible (indicated by arrows). They are the 26 th and 54 th product peaks, respectively, corresponding to repeat numbers of 30 and 58, which is consistent with the full-length product corresponding results. The absence of a large number of successively decreasing product peaks similar to fig. 3A over the larger fragment interval indicates the absence of other high repeat numbers of FMR 1. Combining the repeat product and full-length product results, the sample was heterozygous for 30 repeats and 58 repeats and was clinically classified as pre-mutation heterozygous. The determination of the specific number of repeats for a 58-repeat can be difficult if only the full-length product results are used. Although fitting by adding data of different sample sizes can increase the accuracy of the fitting equation, since the electrophoretic mobility has a certain difference between different instruments, each instrument or even every detection needs to be corrected, which greatly increases the workload and the detection cost. Moreover, the full-length product peak with a large number of repeats is usually a cluster, and it is difficult to accurately determine the true product peak. On the basis of the full-length result, the number of the repeated products can be simply and definitely determined by combining the result of the repeated products, and the accurate number of the repeated products can be directly obtained because the number of the repeated products is quantized and does not need to be calculated by fitting and the like. The innovative 'repetitive primer is complementary with the CGG boundary sequence', can obviously improve the peak distinguishing division of the maximum product, and plays a key role in accurately judging the number of repetitions.
The result of detection of sample 3 is shown in FIG. 3C. Two full-length product peaks are visible at about 320-330nt, and the corresponding repeat number is estimated to be about 30 according to the fragment size, and the peaks are different from each other by one repeat. The repeat product peaks are a series of consecutive peaks with decreasing overall trend, where two maximum product peaks are clearly visible (indicated by arrows). They are the 25 th and 26 th product peaks, respectively, corresponding to a number of repeats of 29 and 30, which is consistent with the full-length product corresponding results. The absence of a large number of successively decreasing product peaks similar to fig. 3A over the larger fragment interval indicates the absence of other high repeat numbers of FMR 1. Combining the repeat product and full-length product results, the sample was heterozygous for 29 and 30 repeats and was clinically classified as normal.
SEQUENCE LISTING
<110> Beijing Microgene technology Limited
<120> detection system and detection kit for the number of CGG units in the 5' untranslated region of FMR1 gene
<130> PP17075-YWJ
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 25
<212> DNA
<213> sequence of primer 1
<400> 1
gcctcagtca ggcgctcagc tccgt 25
<210> 2
<211> 29
<212> DNA
<213> sequence of primer 2
<400> 2
attggagccc cgcacttcca ccaccagct 29
<210> 3
<211> 16
<212> DNA
<213> sequence of primer 3A
<400> 3
agccgccgcc gccgcc 16
<210> 4
<211> 17
<212> DNA
<213> sequence of primer 3B
<400> 4
gcgcggcggc ggcggcg 17
Claims (5)
1. A primer composition for amplifying CGG repeat region on 5' untranslated region of FMR1 gene, comprising 3 primers: primer 1 positioned at the upstream of the CGG repetitive fragment, primer 2 positioned at the downstream of the CGG repetitive fragment and primer 3 positioned at the boundary of the CGG repetitive fragment;
the sequence of the primer 1 is as follows: GCCTCAGTCAGGCGCTCAGCTCCGT the flow of the air in the air conditioner,
the sequence of the primer 2 is as follows: ATTGGAGCCCCGCACTTCCACCACCAGCT the flow of the air in the air conditioner,
the sequence of the primer 3 is as follows: AGCCGCCGCCGCCGCC are provided.
2. The primer composition according to claim 1, wherein a modification is added to the primers 1, 2 and 3 or a normal base is replaced with a modified base, and the modification is a fluorescent group modification, a phosphorylation modification, a phosphorothioate modification, a locked nucleic acid modification or a peptide nucleic acid modification.
3. The primer composition of claim 1, wherein the amplification is simultaneous amplification in one amplification system or separate amplification in two amplification systems.
4. The primer composition of claim 3, wherein the amplification is in two systems; in the first system amplification using primer 1 and primer 2 gave full length product, in the second system primer 3 and primer 1 in reverse gave CGG product.
5. A test kit for detecting the number of CGG repeats in the 5' untranslated region of the FMR1 gene, comprising the primer composition of any one of claims 1-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710559655.6A CN108866176B (en) | 2017-07-11 | 2017-07-11 | Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710559655.6A CN108866176B (en) | 2017-07-11 | 2017-07-11 | Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108866176A CN108866176A (en) | 2018-11-23 |
| CN108866176B true CN108866176B (en) | 2021-09-14 |
Family
ID=64325402
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710559655.6A Active CN108866176B (en) | 2017-07-11 | 2017-07-11 | Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108866176B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110157782A (en) * | 2019-03-08 | 2019-08-23 | 北京华瑞康源生物科技发展有限公司 | A kind of primer group and PCR kit for quickly detecting FMR1 gene C GG repetitive sequence |
| CN110577987B (en) * | 2019-06-24 | 2023-08-25 | 厦门百欧迅生物科技有限公司 | Detection method of FMR1 gene CGG repetitive sequence and application thereof |
| CN110564839A (en) * | 2019-08-23 | 2019-12-13 | 浙江大学 | amplification and detection method for full exons of premature ovarian failure related genes |
| CN112176046A (en) * | 2020-10-14 | 2021-01-05 | 广州市花都区人民医院 | Amplification method for analyzing CGG repeat number of upstream untranslated region of FMR1 gene |
| CN113943794B (en) * | 2021-11-04 | 2022-05-31 | 北京阅微基因技术股份有限公司 | TCF4 gene CTG repetition number detection system and detection kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102449171A (en) * | 2009-03-24 | 2012-05-09 | 奥斯瑞根公司 | PCR method for characterizing 5' untranslated region of FMR1 and FMR2 genes |
| CN106834437A (en) * | 2016-12-26 | 2017-06-13 | 广州和实生物技术有限公司 | A kind of fragile X mental retardation quick detection kit |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120115140A1 (en) * | 2009-04-29 | 2012-05-10 | Js Genetics Inc. | Molecular Diagnosis of Fragile X Syndrome Associated with FMR1 Gene |
-
2017
- 2017-07-11 CN CN201710559655.6A patent/CN108866176B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102449171A (en) * | 2009-03-24 | 2012-05-09 | 奥斯瑞根公司 | PCR method for characterizing 5' untranslated region of FMR1 and FMR2 genes |
| CN106834437A (en) * | 2016-12-26 | 2017-06-13 | 广州和实生物技术有限公司 | A kind of fragile X mental retardation quick detection kit |
Non-Patent Citations (1)
| Title |
|---|
| 动态突变与人类遗传性疾病;张晔等;《癌变.畸变.突变》;19961231;第8卷(第4期);第227-232页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108866176A (en) | 2018-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108866176B (en) | Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene | |
| Neve et al. | Rapid SNP allele frequency determination in genomic DNA pools by PyrosequencingTM | |
| Han et al. | Detection of EGFR mutation status in lung adenocarcinoma specimens with different proportions of tumor cells using two methods of differential sensitivity | |
| CN111518800B (en) | Non-quenching oligonucleotide probe for amplifying variant target gene fragment and application thereof | |
| CN111455062B (en) | Kit and platform for detecting susceptibility genes of novel coronavirus | |
| US20150292033A1 (en) | Method of determining cancer prognosis | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| CN110438223A (en) | Detect primer, probe and its kit and detection method of Kras point mutation | |
| CN106521023B (en) | A kind of kit and method detecting Chinese HPFH and δ β-thalassemia | |
| CN113846167A (en) | Molecular marker detection kit for primary liver cancer, nucleic acid composition and application | |
| CN107523621A (en) | A kind of primer sets and its kit for being used to detect fragile X mental retardation | |
| CN109207568A (en) | For detecting the fluorescence real-time detection reagent and method of mutant | |
| CN110791556A (en) | Primer group, detection method and kit for detecting MET gene exon14 jump mutation | |
| CN113637744B (en) | Application of microbial marker in judging progress of acute pancreatitis course | |
| Cagnoli et al. | Large pathogenic expansions in the SCA2 and SCA7 genes can be detected by fluorescent repeat-primed polymerase chain reaction assay | |
| US20210155981A1 (en) | System and kit for detecting the number of cgg repeats in the 5' untranslated region of fmr1 gene | |
| Kumar et al. | Analysis of DNA methylation using pyrosequencing | |
| US20150292012A1 (en) | Biomarkers for nod2 and/or rip2 activity related application | |
| US20180223367A1 (en) | Assays, methods and compositions for diagnosing cancer | |
| CN108300776A (en) | Fragile X mental retardation fast screening reagent kit | |
| CN113846168B (en) | Detection reagent for molecular marker of primary liver cancer and application thereof | |
| CN112592970A (en) | Gilbert syndrome UGT1A1 gene multi-site variation detection kit | |
| CN111471755A (en) | Biomarker combination for microsatellite instability detection, kit and application thereof | |
| CN111334572B (en) | New application of CTSZ gene methylation | |
| Paximadis et al. | Interleukin-8 genetic diversity, haplotype structure and production differ in two ethnically distinct South African populations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 100044 Room 601, 6 / F, building 10, 39 Sanlihe Road, Haidian District, Beijing Applicant after: Beijing Yuewei Gene Technology Co.,Ltd. Address before: 100089 1102, North building, Jiuling building, 21 Xisanhuan North Road, Haidian District, Beijing Applicant before: BEIJING MICROREAD GENE TECHNOLOGY Co.,Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: A detection system and detection kit for the number of CGG unit repeats in the 5 'untranslated region of FMR1 gene Granted publication date: 20210914 Pledgee: Zhongguancun Branch of Bank of Beijing Co.,Ltd. Pledgor: Beijing Yuewei Gene Technology Co.,Ltd. Registration number: Y2024110000027 |
|
| PE01 | Entry into force of the registration of the contract for pledge of patent right |