CN108866176A - The detection architecture and detection kit of a kind of pair of FMR1 gene 5 ' non-translational region CGG unit number of iterations - Google Patents
The detection architecture and detection kit of a kind of pair of FMR1 gene 5 ' non-translational region CGG unit number of iterations Download PDFInfo
- Publication number
- CN108866176A CN108866176A CN201710559655.6A CN201710559655A CN108866176A CN 108866176 A CN108866176 A CN 108866176A CN 201710559655 A CN201710559655 A CN 201710559655A CN 108866176 A CN108866176 A CN 108866176A
- Authority
- CN
- China
- Prior art keywords
- primer
- cgg
- product
- sequence
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 53
- 101150082209 Fmr1 gene Proteins 0.000 title claims description 32
- 239000012634 fragment Substances 0.000 claims abstract description 39
- 230000003252 repetitive effect Effects 0.000 claims abstract description 24
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 11
- 230000003321 amplification Effects 0.000 claims description 31
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 31
- 238000000034 method Methods 0.000 claims description 27
- 239000000203 mixture Substances 0.000 claims description 16
- 230000004048 modification Effects 0.000 claims description 12
- 238000012986 modification Methods 0.000 claims description 12
- 230000008859 change Effects 0.000 claims description 6
- 230000015572 biosynthetic process Effects 0.000 claims description 3
- 238000003786 synthesis reaction Methods 0.000 claims description 3
- 108091093037 Peptide nucleic acid Proteins 0.000 claims description 2
- 108020004707 nucleic acids Proteins 0.000 claims description 2
- 102000039446 nucleic acids Human genes 0.000 claims description 2
- 150000007523 nucleic acids Chemical class 0.000 claims description 2
- 230000026731 phosphorylation Effects 0.000 claims description 2
- 238000006366 phosphorylation reaction Methods 0.000 claims description 2
- 238000006863 thiophosphorylation reaction Methods 0.000 claims description 2
- 108090000623 proteins and genes Proteins 0.000 abstract description 9
- 239000000047 product Substances 0.000 description 120
- 230000000295 complement effect Effects 0.000 description 15
- 230000035772 mutation Effects 0.000 description 13
- 208000001914 Fragile X syndrome Diseases 0.000 description 12
- 238000012408 PCR amplification Methods 0.000 description 11
- 238000004519 manufacturing process Methods 0.000 description 8
- 238000012360 testing method Methods 0.000 description 8
- 101000828537 Homo sapiens Synaptic functional regulator FMR1 Proteins 0.000 description 7
- 102100023532 Synaptic functional regulator FMR1 Human genes 0.000 description 7
- 230000007423 decrease Effects 0.000 description 7
- 238000006243 chemical reaction Methods 0.000 description 6
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 6
- 108020004414 DNA Proteins 0.000 description 5
- 238000005251 capillar electrophoresis Methods 0.000 description 5
- ZHNUHDYFZUAESO-UHFFFAOYSA-N Formamide Chemical compound NC=O ZHNUHDYFZUAESO-UHFFFAOYSA-N 0.000 description 4
- 239000000872 buffer Substances 0.000 description 4
- 201000010099 disease Diseases 0.000 description 4
- 230000002068 genetic effect Effects 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 3
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 3
- 210000001766 X chromosome Anatomy 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- 239000008223 sterile water Substances 0.000 description 3
- 206010008025 Cerebellar ataxia Diseases 0.000 description 2
- 206010044565 Tremor Diseases 0.000 description 2
- 230000004087 circulation Effects 0.000 description 2
- 229940079593 drug Drugs 0.000 description 2
- 239000003814 drug Substances 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 238000007689 inspection Methods 0.000 description 2
- 230000011987 methylation Effects 0.000 description 2
- 238000007069 methylation reaction Methods 0.000 description 2
- 230000009467 reduction Effects 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 238000013518 transcription Methods 0.000 description 2
- 230000035897 transcription Effects 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- LSNNMFCWUKXFEE-UHFFFAOYSA-M Bisulfite Chemical compound OS([O-])=O LSNNMFCWUKXFEE-UHFFFAOYSA-M 0.000 description 1
- 201000010374 Down Syndrome Diseases 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 108700024394 Exon Proteins 0.000 description 1
- 206010064571 Gene mutation Diseases 0.000 description 1
- 108700039691 Genetic Promoter Regions Proteins 0.000 description 1
- 208000023105 Huntington disease Diseases 0.000 description 1
- 102000002568 Multienzyme Complexes Human genes 0.000 description 1
- 108010093369 Multienzyme Complexes Proteins 0.000 description 1
- 208000002500 Primary Ovarian Insufficiency Diseases 0.000 description 1
- 208000026928 Turner syndrome Diseases 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 229960003237 betaine Drugs 0.000 description 1
- 230000033228 biological regulation Effects 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 239000006227 byproduct Substances 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000012790 confirmation Methods 0.000 description 1
- 239000000470 constituent Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 230000003247 decreasing effect Effects 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 230000004907 flux Effects 0.000 description 1
- KWIUHFFTVRNATP-UHFFFAOYSA-N glycine betaine Chemical compound C[N+](C)(C)CC([O-])=O KWIUHFFTVRNATP-UHFFFAOYSA-N 0.000 description 1
- 239000000017 hydrogel Substances 0.000 description 1
- 230000008676 import Effects 0.000 description 1
- 206010025482 malaise Diseases 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 229920000058 polyacrylate Polymers 0.000 description 1
- 238000003793 prenatal diagnosis Methods 0.000 description 1
- 208000027087 primary ovarian insufficiency 1 Diseases 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012502 risk assessment Methods 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses the detection architecture and detection kit of a kind of gene 5 ' non-translational region CGG unit number of iterations.The detection architecture includes 3 primers positioned at CGG repeated fragment upstream, downstream and repeated fragment boundary, can be judged according to two results of full length product size and CGG product amounts that detection obtains to CGG repetitive unit quantity.Particularly, since the primer and corresponding template binding ability that are located at repeated fragment boundary are stronger, it can more clearly determine maximum CGG product, to accurately decision making to the duplicate particular number of CGG, it can efficiently and accurately determine less than 60 duplicate repeat numbers, and can clearly determine whether to have bigger repeat number genotype.
Description
Technical field
The present invention relates to being detected to gene C GG unit number of iterations, can be mentioned to be clinical in fragile X syndrome diagnosis
For reference, belong to the clinical molecular detection technique in field of biomedicine.
Background technique
Fragile X syndrome (Fragile X Syndrome, FXS) is a kind of common X-linkage heredity
Disease, typical cardinal symptom are feeblemindedness of the moderate to severe, additionally abnormal etc. with behavior and anthropometic.It is fallen ill
Rate is only second to Down syndrome in heredity mentally disabled syndrome, accounts for the 10-20% of male's feeblemindedness, accounts for the chain intelligence of X
Power it is low 40%.
The generation of fragile X syndrome and FMR1 gene unconventionality are closely related.95% or more fragile X chromosome is comprehensive
Simulator sickness morbidity is caused by the extension mutation of X chromosome FMR1 gene 5 ' non-translational region CGG repetitive structure, and 5% or less is by FMR1
Gene missense mutation and deletion mutation influence caused by the normal function of FMR1 gene.
FMR1 gene is located at chromosome x q27.3, overall length 38kb, contains 17 exons, 16 intrones.FMR1 gene 5 '
There are (CGG) n trinucleotide tandem repetitive sequences for non-translational region.CGG number of repetition n change can influence the duplicate block CGG and
The methylation of the upstream island CpG influences the normal transcription of FMR1 gene, and then causes corresponding clinical symptoms.
According to CGG repeat number, FMR1 gene can be divided into full mutation (full mutation), premutation
(premutation), osculant (intermediate) and normal.At present there are two clinical generally acknowledged genotypic categorization standards,
Respectively by United States Medicine science of heredity meeting (American College of Medical Genetics) and European human genetics
Meeting (European Society for Human Genetics) is formulated, and specific value is shown in Table 1.
Table 1, the FMR1 genotype criteria for classifying based on CGG repeat number
When CGG repeat number n is greater than 200, it is defined as the full mutation of FMR1 gene.The island FMR1 promoter region CpG height at this time
Methylation, the transcription of FMR1 gene is suppressed, and protein product missing, nervous function associated therewith is affected, individual performance
For the typical fragile X syndrome feature such as feeblemindedness, self-closing；When n is between the section 55-200 or 59-200, referred to as
The premutation of FMR1 gene.Premutation can generate excessive mRNA, and then influence the expression regulation of multiple albumen.Premutation is recognized
For be cause fragile X correlation Turner syndrome (fragile X-associated primary ovarian
Insufficiency, FXPOI) and fragile X associated tremor ataxia syndrome (fragile X-associated tremor
And ataxia syndrome, FXTAS) risk factor.
Fragile X syndrome is a kind of dynamic gene mutation diseases.In X chromosome stealth hereditary basis, filial generation
FMR1 gene C GG repeat number n is possible to change on the basis of parent CGG repeat number.When parent repeat number is greater than 60,
Filial generation CGG repeats have certain proportion that can extend, and filial generation repeat number n will increase with respect to parent.When parent repeat number is greater than 100
When, filial generation CGG repeats to be bound to extend substantially, generates more CGG and repeats, it is possible to produce the FMR1 base being mutated entirely
Cause, and then cause fragile X syndrome.
Normal FMR1 gene generally has 1-3 AGG insertion inside the duplicate block CGG.Full mutation and premutation FMR1 base
Because be possible to without or only less AGG.The quantity of AGG is considered related with CGG repetition genetic stability, and AGG quantity is got over
Few, the risk that filial generation CGG occurs repeatedly extension is bigger.
Fragile X syndrome disease incidence is high, and carrying rate is high, there is no effective treatment method at present.To high risk people
Group or the person that has vegetative characters carry out FMR1 gene C GG and repeat to detect, and reduce infant by genetic counselling and pre-natal diagnosis
Birth is the effective ways for preventing the disease.Particularly, the usual phenotype of the female carrier of premutation gene is normal, and its filial generation
There is CGG to repeat increased risk.So being directed to the duplicate detection of FMR1 gene C GG, on the basis of detection full mutation, can be right
Premutation detect.40-60 can be repeated with European human genetics meeting classification standard in conjunction with United States Medicine science of heredity
It wants accurately determine specific repeat number, to meet the demands such as clinical classification and risk assessment.
Southern trace is the conventional method for detecting FMR1 gene C GG number of iterations.But this method primary limitation is,
It is unable to judge accurately specific CGG repeat number, misoperation is also easy to produce false negative result, the cumbersome clinic that is unsuitable for is examined on a large scale
It surveys.
CGG number of iterations can be detected by PCR method.But only with two primers of upstream and downstream carry out it is conventional,
To be not appropriate for carrying out this detection comprising the PCR amplification that the duplicate target fragment of CGG is amplification template.Because of CGG number of iterations
It can exceed that 1000, excessive CGG repeat to mean bigger product sheet segment length and higher G/C content, and then lead to not
Effectively template is expanded, causes detection false negative.For female carrier detects, consequence is especially serious for this.
For the high GC content of high repeated sample, there is researcher to reduce G/C content using bisulphite modified method,
Then PCR amplification is carried out, it is difficult to reduce high GC bring amplification.This method is high to DNA requirement, cumbersome, more crucially,
This method is difficult for too long product sheet segment length bring amplification and false negative still can not be solved effectively.
For the dynamic mutation disease detection including fragile X syndrome, primer PCR (repeat- is repeated
Primed PCR, RP PCR) it is method that is more effective and getting the nod.This method introduces complementary with repetitive sequence in system
Repetition primer, carry out PCR amplification jointly with reverse downstream primer.It can be with each position on repeated fragment due to repeating primer
In conjunction with so a series of different size of products (such as Figure 1A) can be generated.When repeat number is less, according to primer size and quantity
Number of iterations can be extrapolated；When repeating more, although large fragment product can not be expanded effectively, the lesser various productions of segment
Object can expand, their presence prompt avoids generating false negative result with the presence of high repeat number gene.
The above method, which suffers from a problem that, is, produces due to can be used as short length comprising longer duplicate amplified production
The template of object, after taking turns PCR amplification, small fragment product amount can be more than large fragment product amount with exponential form more, cause larger
Fragment products amplification efficiency is too low, and the effective product amounts that can be detected are very few, and effective judgement cannot be made to repeat number.It is practical
On, initial repetition primer PCR method has used 3 primers (triplet repeat-primed PCR, TP PCR) altogether
(Warner etc., J Med Genet, 1996；33(12):10022) to overcome the problems, such as this.Repeating, one section of the end of primer 5 ' addition is different
Source sequence, Article 3 primer is consistent with this section of sequence, and will repeat primer amount and lower, and repeats primer in this way in PCR amplification
Early stage is depleted, and subsequent amplification is carried out by reverse primer in Article 3 primer, can rely on long product in this way to avoid short product
Preferential amplification is improved to long product amplification ability (such as Figure 1B).
The product of RP PCR or TP PCR can pass through the side such as agarose electrophoresis, polyacrylate hydrogel electrophoresis, Capillary Electrophoresis
Method detection.Due to capillary electrophoresis detection high sensitivity, high resolution, quantitative detection repeat number can be realized, so being more suitable for
Such detection, application are more extensive.
Fragile X syndrome for the dynamic mutations disease such as Huntington chorea, its main feature is that, repeat piece
Segment number is more, up to 1000 or more；Repetitive unit is CGG, and G/C content is very high；40-60 repeats to have clinical classification important
Meaning should be able to accurately detect specific CGG number of iterations.
Even if repeated fragment product still can be presented to be increased with product length using the PCR method and condition of various equal optimizations
Add the trend that product amount is successively decreased.Due to the slip phenomenon during PCR, the product of repeat numbers more than actual template can be generated.
This can be impacted to determining to repeat maximum product peak in product, especially repeat number is more, corresponding repeated fragment product peak
When being worth lower, such as CGG repeat number the 40-60 range the case where (such as Fig. 2A).Some researchs or patent (such as Chinese patent CN
The positions such as the end of primer 3 ' 102449171B) are being repeated plus in the base of specific template sequences match, and main purpose is to CGG
AGG in duplicate block is more accurately positioned, and the above-mentioned difficulty repeated in product in maximum product peak judgement can not be improved.
Summary of the invention
The object of the present invention is to provide a kind of detection architectures of FMR1 gene 5 ' non-translational region CGG repetitive unit quantity, should
Detection architecture combines the duplicate block CGG overall length PCR amplification, and repeats primer PCR (repeat-primed PCR, RP PCR) two
Kind method, is expanded with 3 primers, is realized the detection to CGG repetitive unit quantity, can efficiently and accurately be determined less than 60
Duplicate repeat number, and can clearly determine whether to have bigger repeat number genotype.
The present invention also provides the corresponding detection kits of the detection architecture.
For expanding the Primer composition of the duplicate block CGG on FMR1 gene 5 ' non-translational region, including 3 primers：Positioned at CGG
The primer 1 of repeated fragment upstream, the primer 2 positioned at CGG repeated fragment downstream, the primer 3 positioned at CGG repeated fragment boundary.
The primer 3 is：
(a), 3 ' end of primer is, with the sequence of the duplicate 9-18bp of GCG or GCC rule；
(b), in the 5 ' regions adjacent with 3 ' repetitive sequences, there is 1-6bp sequence consistent with GGCAGC or GGCCCA.
The gene is FMR1 gene, and the primer is respectively：
It is preferred that：Primer 3：AGCCGCCGCCGCCGCC or GCGCGGCGGCGGCGGCG.
It is preferred that：Primer 1：GCCTCAGTCAGGCGCTCAGCTCCGT,
Primer 2：ATTGGAGCCCCGCACTTCCACCACCAGCT.
Replace normal base added with modification or with modified base on the primer 1,2,3, it is described to be modified to fluorescence group
Modification, phosphorylation modification, thiophosphorylation modification, lock nucleic acid modification or peptide nucleic acid modification.
The primer 1,2,3 is held after -15 in 3 ' -2 to -15 1 to 3 bases of change in end and/or in primer 3 '
Sequence is modified, and the change includes that end increases other sequences, deletes portion distal end sequence, changing section base sequence.
It is described amplification for expanded simultaneously in an amplification system or two systems in expand respectively.
The amplification is to expand respectively in two systems；It expands to obtain using primer 1 and primer 2 in first system
Full length product obtains CGG product using primer 3 and reversed primer 1 or primer 2 in second system.
A method of determining that FMR1 gene 5 ' non-translational region CGG repetitive unit quantity, this method use above-mentioned primer sets
It closes object to be expanded, detection obtains CGG product amounts and full length product size and number, and comprehensive two results repeat CGG
Element number is decision making；When the repeat number inferred according to two results is consistent, CGG repetition particular number is made and is clearly sentenced
It is disconnected；When two results are inconsistent, when especially CGG product amounts are greater than full length product size corresponding CGG quantity, illustrate sample
This has high repeat number CGG.
A kind of detection kit detecting FMR1 gene 5 ' non-translational region CGG repetitive unit quantity, including any of the above-described institute
The Primer composition stated.
The gene is FMR1 gene, and the primer is respectively：
Primer 1：GCCTCAGTCAGGCGCTCAGCTCCGT,
Primer 2：ATTGGAGCCCCGCACTTCCACCACCAGCT,
Primer 3：AGCCGCCGCCGCCGCC.
Of the invention includes using primer：Positioned at the primer 1 of CGG repeated fragment upstream, positioned at CGG repeated fragment downstream
Primer 2, the primer 3 (such as Fig. 1 C) positioned at CGG repeated fragment boundary.
One of most important innovation of institute's providing method is, it is complementary with CGG border sequence (such as Fig. 1 C) to repeat primer.
Such design, repeating primer can still rely on its 3 ' sequence in conjunction with position each on repeated fragment, originate
Amplification.Simultaneously as repeat primer it is complementary with CGG border sequence, and boundary combination than with inside repetitive sequence in conjunction with
Matching base it is more, binding ability is stronger, amplification efficiency is higher.So that one, maximum repeat number is corresponding to repeat product
Amplification efficiency in system is higher than other repetition products, and product amount is greater than other products, determines that maximum repeat number is corresponding heavy
It reproduces object to be easier, excludes various interference caused by amplification slippage etc.；Two, relative reduction compared with short weight answers fragment amplification product and exists
Ratio in whole products improves the ability of the repetition product for the repeat number that effectively amplification is bigger, even if that can not expand maximum
In the case where repeating product.
Institute's providing method detects CGG product amounts and full length product size and number simultaneously, and comprehensive two results are to CGG
Repetitive unit quantity is decision making.
As previously mentioned, individually also may be implemented according to CGG product amounts or full length product size and number to CGG weight
The detection of multiple element number, but as all defective for clinical detection.It is very high in repeat number only according to CGG product amounts, very
(it is greater than 40) when extremely slightly higher, it is difficult to clearly judgement repeat number；Only according to full length product size and number, cannot be distinguished normal pure and mild
Sample and full mutation/premutation heterozygosis sample, will cause detection false negative.Comprehensive two results to CGG repetitive unit quantity into
Row determines, except drawbacks described above is avoided, also adds detection reliability.In low number of iterations, two kinds of testing result phases
Mutually confirmation；In intermediate repeat quantity, complementary with CGG border sequence due to repeating primer, CGG product result can be more clear
Ground determines repeat number, confirms with overall length result；In high number of iterations, CGG product amounts are greater than full length product and are detected
When the corresponding CGG quantity of size, illustrate that sample with high repeat number CGG, can effectively avoid false negative.
The application also provides a kind of detection FMR1 gene 5 ' non-translational region CGG repetitive unit quantity based on preceding method
Detection kit.
There is provided kit uses aforementioned detection method and inspection policies.Kit include Primer composition, multienzyme complex,
The mixture of buffer system or the above component is expanded, additionally includes known repeat number control, the examination of capillary electrophoresis detection correlation
The components such as agent.
The use of provided kit, mainly includes the following steps that：Prepare amplification system；PCR amplification；Capillary Electrophoresis inspection
Survey detection；Data analysis.
There is provided kit can be determined efficiently and accurately less than 60 duplicate repeat numbers, and can clearly determine whether exist
Bigger repeat number genotype.Additionally have easy to operate, high specificity, high sensitivity, flux high, highly reliable and at low cost
Detection feature.
Although method of the invention is to be used in the detection of FMR1 gene 5 ' non-translational region CGG repetitive unit quantity, still
The detection of any gene 5 ' non-translational region CGG repetitive unit quantity can be applicable in.
Detailed description of the invention
Fig. 1：The various primer setting schematic diagrames for detecting the method for repetitive unit quantity.
Boxed area is the duplicate block CGG, and arrow indicates detection the primer and its corresponding position.
A repeats the setting of primer PCR (RP PCR) primer.Repeating primer can be in conjunction with each position on repeated fragment, institute
A series of different size of products can be generated.
B, the setting of Tri-primer PCR (TP PCR) primer.Repeat primer 5 ' end be added one section of heterologous sequence, Article 3 primer with
This section of sequence is consistent.
C, primer setting of the present invention.It repeats the end of primer 5 ' and one section of sequence (open squares complementary with CGG border sequence is added
Show), repeating primer still can matched sequence be longer in conjunction with each position on repeated fragment, but when it is in conjunction with the boundary CGG.
Fig. 2：It repeats primer and the corresponding PCR testing result that repeats of CGG border sequence complementary fragment different length compares.
In the case of repeating the addition of the end of primer 5 ' and CGG border sequence complementary fragment 0nt (A), 1nt (B), 3nt (C), to CGG
The women sample that repeat number is 30/55 carries out repeated fragment PCR testing result.Arrow shows that 30CGG and 55CGG is corresponding and repeats to produce
Object peak.
Fig. 3：Different repeat number pattern detection result figures.
With kit to different pattern detections as a result, including full length product and repetition product.
A, full mutation and 30CGG heterozygosis sample.B, 58 and 30CGG premutation heterozygosis sample.C, 29 and 30CGG normal sample
This.This repeat number of arrow sample is corresponding to repeat product peak.
Specific embodiment
Below only by taking the detection of FMR1 gene 5 ' non-translational region CGG repetitive unit quantity as an example, which is only explanation
Method it is effective, restriction effect is not generated to it.
Embodiment 1：It is examined with the repetition primer progress CGG repetition with CGG border sequence complementary fragment with different length
It surveys
Following three primers are respectively adopted as primer is repeated, the CGG of sample to be tested is repeated to detect：
Primer A：GCCGCCGCCGCCGCC
Primer B：AGCCGCCGCCGCCGCC
Primer C：CCAGCCGCCGCCGCCGCC
3 ' ends of three sequences are identical, are all complementary with 5 (CGG).They the difference is that, primer A only includes
Repeated fragment sequence, without the sequence complementary with CGG border sequence, being equivalent to conventional repeat primer PCR (RP PCR) is made
Primer；Primer B is added to 1 base complementary with CGG border sequence in 5 ' upstream of repeated fragment；Primer C is repeating piece
5 ' upstreams of section are added to 3 bases complementary with CGG border sequence.
Used upstream primer, sequence are：FAM-GCCTCAGTCAGGCGCTCAGCTCCGT.
It further include following components in amplification system in addition to primer：Archaeal dna polymerase (AptaTaq, Roche)；Amplification buffer
(Suzhou Microread Genetic Technology Co., Ltd.) includes dNTPs, 7-deaza-dGTP, glycine betaine etc..
Sample detected is the women sample that CGG repeat number is 30/55.
Specific detecting step is as follows：
1) pcr amplification reaction system is prepared.Each amplification reaction system includes 5 μ L of primer mixture, amplification buffer 10
μ L, 1 μ L of archaeal dna polymerase, sample to be examined DNA1 μ L supply 20 μ L with sterile water.
2) PCR amplification.Reaction condition is：95 DEG C, 5 minutes；94 DEG C of 30 circulations, 30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 2
Minute；60 DEG C, 30 minutes.
3) amplified production carries out capillary electrophoresis detection.Prepare the loading mixed liquor for being mixed with molecular weight internal standard and formamide
(+8.5 μ L formamide of 0.5 μ L molecular weight internal standard)；The loading mixed liquor of 9 μ L is dispensed, 1 μ L amplified production is added, 95 DEG C after mixing
Denaturation 3 minutes, ice bath 3 minutes.It is detected according to genetic analyzer user's service manual step.When setting sample introduction is suggested in detection
Between for 10 seconds, sample introduction voltage be 3kV, runing time is 1800 seconds.
4) data are analyzed.Import associated documents into GeneMapper software, including Panel, Bin, corresponding
Analysis Method, ROX500 internal standard.Input sample source data (.fsa file), selectes it in related parameter choosing column
The file of preceding importing analyzes data.
Final electrophoresis result figure is shown in Fig. 2.Wherein A figure is using the result figure for repeating primer A, and B figure is using repetition primer B
Result figure, C figure be using repeat primer C result figure.
As shown, the use of the different testing results for repeating primer being generally similar.Amplified production is by a series of phases
Product composition away from 3nt, corresponds to repetition primer and is formed by product in conjunction with the duplicate block CGG different location.Wherein segment is most
Corresponding small repetition product is that 5 CGG are repeated, and it is a more duplicate expansion of CGG that next peak per big 3nt is corresponding later
Increase production object.Since longer product can be used as the template of shorter product in amplification, so as the peak height for embodying product amount, meeting
It is presented that small fragment is higher, the lower decline trend of large fragment.In addition, due to having AGG insertion in the duplicate block CGG, so having
Portion of product peak missing or peak height are substantially reduced, usually 5 continuous product peaks.It can determine that two, the sample according to its peak type
FMR1 copies the duplicate block CGG repetitive unit.(CGG)9AGG(CGG)9AGG(CGG)10(CGG)44AGG(CGG)10.Have
The advocated claim of detection non-present invention of AGG is closed, therefore does not do further discussion herein.
Peak height due to repeating product increases with fragment length and reduction and AGG that may be present are interfered, and causes to be difficult to
Maximum product peak is determined to the biggish sample of repeat number, i.e., accurately determines CGG repeat number.Such as Fig. 2A, right side arrow show 55
Repeat number is corresponding to repeat product peak, its peak height and neighbouring several adjoining product peak peak heights have no significant difference, it is difficult to quasi-
Really determine.In fact, showing for left arrow, 30 repeat numbers are corresponding to repeat product peak, due to there is another difference copy
Amplified production interference, determine to get up for the corresponding insufficient personnel of experience also difficult.It is difficult to accurately determine maximum product
Peak just can not accurately determine CGG repeat number, this will cause very big influence to clinical diagnostic applications, and especially CGG repeats to be in
When 40-60 repeats section, this, which will result directly in, can not determine mutation, premutation and normal sample entirely.
It is difficult to the problem of accurately determining maximum product peak above, is improved well when using primer B is repeated.Such as figure
2B, corresponding 30 and 55 repeat two product peaks shown in arrow, and peak height is significantly higher than adjoining product peak.It repeats to produce for 55
Object peak, peak height reach 5 times or more of adjoining product peak；Product peak is repeated for 30, although there is the interference of another copy,
Peak height also can reach 2 times of adjoining product peak.Such difference allows to very simple clearly determining maximum product peak,
So that it is determined that sample to be tested CGG repeat number.Above-mentioned performance why is had, is since the used primer B that repeats is repeating piece
3 ' end of section increases a bases G, enables repetition primer B completely complementary with CGG border sequence (such as Fig. 1 C).In this way, repeating
The combination on the boundary primer B and CGG is more than the matching base in conjunction with internal repetitive sequence, binding ability is stronger, amplification is imitated
Rate is higher.With PCR cycle, this amplification advantage is further magnified.Finally, maximum repeat number is corresponding repeats product product
Amount is greater than other products, determines that the corresponding product that repeats of maximum repeat number is easier.
When using the repetition primer C for increasing 3nt complementation, such as Fig. 2 C, corresponding 30 and 55 repeat two and produce shown in arrow
Object peak is also significantly improved.But since its matched base is more, and the boundary CGG combination when amplification efficiency it is higher,
So that also improving the product peak peak height of adjacent less repeat number product indirectly while improving maximum product peak peak height.This
Although sample as a result, also can significantly judge maximum product peak, it is significant not as good as gap in Figure 1B.
To sum up, simple to use repetition primer (repeating primer A), it is difficult to determine maximum product peak；It is had and CGG using 3 ' ends
Maximum product peak peak height can be improved in the repetition primer of border sequence complementary fragment, allows to clean the maximum production of accurately judgement
Object peak；As a preference, holding the differentiation effect for the repetition primer B for increasing a matching base most to manage in repeated fragment 3 '
Think.Embodiment 2：Different type sample is detected using presently disclosed detection kit
Reagent constituents include：Enzyme mixation, repeats primer mixed liquor, amplification buffer, the positive at overall length primer mixed liquor
The components such as control, sterile water, internal standard.
Three sample to be examined are detected using kit.
Specific detecting step is as follows：
1) pcr amplification reaction system is prepared.Each amplification reaction system includes 2.5 μ L of overall length primer mixed liquor, and repetition is drawn
2.5 μ L of object mixed liquor, 10 μ L of amplification buffer, 1 μ L of archaeal dna polymerase, sample to be examined DNA1 μ L supply 20 μ L with sterile water.
2) PCR amplification.Reaction condition is：95 DEG C, 5 minutes；94 DEG C of 30 circulations, 30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 4
Minute；60 DEG C, 30 minutes.
Following detection step is the same as embodiment 1.
Kit detection is with the maximum difference of embodiment 1, kit system used upstream primer, repeatedly primer and under
Primer totally 3 primers are swum, also full length fragment is expanded while expanding repeated fragment, synthesis is according to full length product and again
Object result is reproduced to determine repeat number.
Used upstream primer, sequence are：FAM-GCCTCAGTCAGGCGCTCAGCTCCGT；
It uses and repeats primer, sequence is：AGCCGCCGCCGCCGCC；
Used downstream primer, sequence are：ATTGGAGCCCCGCACTTCCACCACCAGCT.
As shown in figure 3, peak type, peak height and trend and repetition product peak are significant within the scope of about 300nt and larger lengths
Different is full length product peak.Using the full length product peak primer size of known heavy complex sample, available repeat number with
The fit equation of primer size can calculate the corresponding CGG repeat number of full length product whereby.This method is in the lesser feelings of repeat number
It is relatively accurate under condition, it is possible to generate certain deviation when repeat number is too big.
Illustrate synthesis according to full length product with three actually detected results below and repeats product result to repeat number progress
The specific method of judgement.
The testing result of sample 1, such as Fig. 3 A.A visible very high full length product peak, big according to its segment at about 330nt
The corresponding repeat number of small reckoning is about 30.Repeating product peak is a series of continuous peaks that overall trend successively decreases, and has one at 230nt
The product peak that peak height is obviously improved (shown in arrow).It is the 26th product peak, that is, corresponding to repeat number is 30, this and full length product
Corresponding result is consistent.Still there is the product peak that largely continuously successively decreases in the product peak more large fragment section, at least extends to 500nt, nothing
Method determines maximum product peak.These product peaks illustrate that, there are one the FMR1 gene copied, repeat number can not be examined effectively greatly very much
It surveys.With the reckoning of 500nt product peak, repeat number is more than 120.It is comprehensive to repeat product and full length product as a result, the sample is 30 weights
Multiple and a high repeat number heterozygosis sample.If only overall length as a result, this sample can be determined as 30 repeat homozygous women or
30 repeat male, will cause detection false negative.This necessity for also exactly needing that overall length and reproducible results is combined to be determined.
The testing result of sample 2, such as Fig. 3 B.Visible two full length product peaks at about 330nt and 420nt, according to its segment
Size calculates that corresponding repeat number is about 30 and about 60.Repeating product peak is a series of continuous peaks that overall trend successively decreases, wherein bright
Show visible two maximum product peaks (shown in arrow).They are the 26th and 54 product peak respectively, and corresponding repeat number is 30 and 58,
This result corresponding with full length product is consistent.A large amount of product peaks that continuously successively decrease not similar with Fig. 3 A, say in more large fragment section
It is bright that there is no the FMR1 of other high repeat numbers.It is comprehensive to repeat product and full length product as a result, the sample is that 30 repetitions and 58 repeat
Heterozygosis sample, clinical classification be premutation heterozygosis.If only according to full length product as a result, specific repeat number duplicate for 58
Judgement has certain difficulty.Although fit equation precision can be increased by being fitted by the data for increasing different sample sizes,
Since electrophoretic mobility has certain difference between different instruments, need all to be corrected the even each detection of every instrument,
This will greatly increase workload and testing cost.And the full length product peak of larger repeat number is usually cluster, accurately determines it
Also it has any problem at real product peak.On the basis of overall length result, repeat number then simply can be clearly determined in conjunction with product result is repeated
Amount because repeat product amounts be it is quantized, without fitting etc. calculate, accurate number of iterations can be directly obtained.Institute of the present invention
Innovative " it is complementary with CGG border sequence to repeat primer " of use, can significantly improve maximum product peak discrimination, to accurately sentencing
Determine repeat number to play a key effect.
The testing result of sample 3, such as Fig. 3 C.Visible two full length product peaks at about 320-330nt, according to its clip size
It calculates corresponding repeat number about 30, differs a repetition each other.Repeating product peak is a series of continuous peaks that overall trend successively decreases,
In clearly visible two maximum product peaks (shown in arrow).They are the 25th and 26 product peak respectively, and corresponding repeat number is 29
With 30, this result corresponding with full length product is consistent.A large amount of products that continuously successively decrease not similar with Fig. 3 A in more large fragment section
Peak illustrates the FMR1 there is no other high repeat numbers.It is comprehensive to repeat product and full length product as a result, the sample is 29 repetitions and 30
Duplicate heterozygosis sample, clinical classification are normal.
SEQUENCE LISTING
<110>Beijing Microread Gene Technology Co., Ltd.
<120>The detection architecture and detection kit of a kind of pair of FMR1 gene 5' non-translational region CGG unit number of iterations
<130> PP17075-YWJ
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 25
<212> DNA
<213>The sequence of primer 1
<400> 1
gcctcagtca ggcgctcagc tccgt 25
<210> 2
<211> 29
<212> DNA
<213>The sequence of primer 2
<400> 2
attggagccc cgcacttcca ccaccagct 29
<210> 3
<211> 16
<212> DNA
<213>The sequence of primer 3A
<400> 3
agccgccgcc gccgcc 16
<210> 4
<211> 17
<212> DNA
<213>The sequence of primer 3B
<400> 4
gcgcggcggc ggcggcg 17
Claims (10)
1. the Primer composition for expanding the duplicate block CGG on FMR1 gene 5 ' non-translational region, including 3 primers：Positioned at CGG weight
Primer 1, the primer 2 positioned at CGG repeated fragment downstream, the primer 3 positioned at CGG repeated fragment boundary of multiple segment upstream.
2. Primer composition according to claim 1, the primer 3 are：
(a), 3 ' end of primer is, with the sequence of the duplicate 9-18bp of GCG or GCC rule；
(b), in the 5 ' regions adjacent with 3 ' repetitive sequences, there is 1-6bp sequence consistent with GGCAGC or GGCCCA.
3. Primer composition as stated in claim 2,
The sequence of the primer 3 is：AGCCGCCGCCGCCGCC or GCGCGGCGGCGGCGGCG.
4. Primer composition described in claim 1,
The sequence of the primer 1 is：GCCTCAGTCAGGCGCTCAGCTCCGT,
The sequence of primer 2 is：ATTGGAGCCCCGCACTTCCACCACCAGCT.
5. any Primer composition of claim 1-4, added with modification or with modified base on the primer 1,2,3
Replace normal base, it is described to be modified to the modification of fluorescence group, phosphorylation modification, thiophosphorylation modification, lock nucleic acid modification or peptide
Nucleic acid modification.
6. any Primer composition of claim 1-4, the primer 1,2,3 change 1 to 3 for -2 to -15 at 3 ' end
Base and/or the sequence after primer 3 ' holds -15 are modified, and the change includes that end increases other sequences, deletes
Portion distal end sequence, changing section base sequence.
7. Primer composition described in claim 1, the amplification is expands or two is individual simultaneously in an amplification system
It is expanded respectively in system.
8. Primer composition described in claim 1, the amplification is to expand respectively in two systems；In first system
It is middle to expand to obtain full length product using primer 1 and primer 2, primer 3 and reversed primer 1 or primer are used in second system
2 obtain CGG product.
9. a kind of method for determining FMR1 gene 5 ' non-translational region CGG repetitive unit quantity, this method use claim 1-8
Any Primer composition is expanded, and detection obtains CGG product amounts and full length product size and number, synthesis two
Item result decisions making to CGG repetitive unit quantity；When the repeat number inferred according to two results is consistent, CGG is repeated to have
Body quantity, which is made, clearly to be judged；When two results are inconsistent, especially it is corresponding to be greater than full length product size for CGG product amounts
When CGG quantity, illustrate sample with high repeat number CGG.
10. a kind of detection kit for detecting FMR1 gene 5 ' non-translational region CGG repetitive unit quantity, including claim 1-8
Any Primer composition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710559655.6A CN108866176B (en) | 2017-07-11 | 2017-07-11 | Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710559655.6A CN108866176B (en) | 2017-07-11 | 2017-07-11 | Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108866176A true CN108866176A (en) | 2018-11-23 |
| CN108866176B CN108866176B (en) | 2021-09-14 |
Family
ID=64325402
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710559655.6A Active CN108866176B (en) | 2017-07-11 | 2017-07-11 | Detection system and detection kit for repeated number of CGG units in 5' untranslated region of FMR1 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108866176B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110157782A (en) * | 2019-03-08 | 2019-08-23 | 北京华瑞康源生物科技发展有限公司 | A kind of primer group and PCR kit for quickly detecting FMR1 gene C GG repetitive sequence |
| CN110564839A (en) * | 2019-08-23 | 2019-12-13 | 浙江大学 | amplification and detection method for full exons of premature ovarian failure related genes |
| CN110577987A (en) * | 2019-06-24 | 2019-12-17 | 胜亚生物科技(厦门)有限公司 | Detection method of CGG (glutamic acid G) repetitive sequence of FMR1 gene and application thereof |
| CN112176046A (en) * | 2020-10-14 | 2021-01-05 | 广州市花都区人民医院 | Amplification method for analyzing CGG repeat number of upstream untranslated region of FMR1 gene |
| CN113943794A (en) * | 2021-11-04 | 2022-01-18 | 北京阅微基因技术股份有限公司 | TCF4 gene CTG repetition number detection system and detection kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102449171A (en) * | 2009-03-24 | 2012-05-09 | 奥斯瑞根公司 | PCR method for characterizing 5' untranslated region of FMR1 and FMR2 genes |
| US20120115140A1 (en) * | 2009-04-29 | 2012-05-10 | Js Genetics Inc. | Molecular Diagnosis of Fragile X Syndrome Associated with FMR1 Gene |
| CN106834437A (en) * | 2016-12-26 | 2017-06-13 | 广州和实生物技术有限公司 | A kind of fragile X mental retardation quick detection kit |
-
2017
- 2017-07-11 CN CN201710559655.6A patent/CN108866176B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102449171A (en) * | 2009-03-24 | 2012-05-09 | 奥斯瑞根公司 | PCR method for characterizing 5' untranslated region of FMR1 and FMR2 genes |
| US20120115140A1 (en) * | 2009-04-29 | 2012-05-10 | Js Genetics Inc. | Molecular Diagnosis of Fragile X Syndrome Associated with FMR1 Gene |
| CN106834437A (en) * | 2016-12-26 | 2017-06-13 | 广州和实生物技术有限公司 | A kind of fragile X mental retardation quick detection kit |
Non-Patent Citations (1)
| Title |
|---|
| 张晔等: "动态突变与人类遗传性疾病", 《癌变.畸变.突变》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110157782A (en) * | 2019-03-08 | 2019-08-23 | 北京华瑞康源生物科技发展有限公司 | A kind of primer group and PCR kit for quickly detecting FMR1 gene C GG repetitive sequence |
| CN110577987A (en) * | 2019-06-24 | 2019-12-17 | 胜亚生物科技(厦门)有限公司 | Detection method of CGG (glutamic acid G) repetitive sequence of FMR1 gene and application thereof |
| CN110577987B (en) * | 2019-06-24 | 2023-08-25 | 厦门百欧迅生物科技有限公司 | Detection method of FMR1 gene CGG repetitive sequence and application thereof |
| CN110564839A (en) * | 2019-08-23 | 2019-12-13 | 浙江大学 | amplification and detection method for full exons of premature ovarian failure related genes |
| CN112176046A (en) * | 2020-10-14 | 2021-01-05 | 广州市花都区人民医院 | Amplification method for analyzing CGG repeat number of upstream untranslated region of FMR1 gene |
| CN113943794A (en) * | 2021-11-04 | 2022-01-18 | 北京阅微基因技术股份有限公司 | TCF4 gene CTG repetition number detection system and detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108866176B (en) | 2021-09-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108866176A (en) | The detection architecture and detection kit of a kind of pair of FMR1 gene 5 ' non-translational region CGG unit number of iterations | |
| Sethna et al. | Population variability in the generation and selection of T-cell repertoires | |
| CN104769132B (en) | The genetic marker of the relevant inflammatory disease of liver | |
| CN107475375A (en) | A kind of DNA probe storehouse, detection method and kit hybridized for microsatellite locus related to microsatellite instability | |
| AU2021290268A1 (en) | Immunorepertoire normality assessment method and its use | |
| Kang et al. | Proteobacteria acts as a pathogenic risk-factor for chronic abdominal pain and diarrhea in post-cholecystectomy syndrome patients: a gut microbiome metabolomics study | |
| CA2824854A1 (en) | Immunodiversity assessment method and its use | |
| van den Brand et al. | Next-Generation Sequencing–Based Clonality Assessment of Ig Gene Rearrangements: A Multicenter Validation Study by EuroClonality-NGS | |
| US20150292033A1 (en) | Method of determining cancer prognosis | |
| CN111164700B (en) | Immune-oncology applications using next generation sequencing | |
| Mehtonen et al. | Single cell characterization of B-lymphoid differentiation and leukemic cell states during chemotherapy in ETV6-RUNX1-positive pediatric leukemia identifies drug-targetable transcription factor activities | |
| US20160122819A1 (en) | Method for quantifying the level of minimal residual disease in a subject | |
| CN110904213A (en) | Intestinal flora-based ulcerative colitis biomarker and application thereof | |
| Chen et al. | Optimization of zygosity determination by questionnaire and DNA genotyping in Chinese adolescent twins | |
| CN109234385A (en) | Detect the primer sets and kit of Alzheimer's disease gene mutation | |
| Liu et al. | Single‐cell transcriptomic analysis of PB and BM NK cells from severe aplastic anaemia patients | |
| Chitgopeker et al. | T-cell receptor gene rearrangement detection in suspected cases of cutaneous T-cell lymphoma | |
| CA2889276A1 (en) | Method for identifying a target molecular profile associated with a target cell population | |
| Milnik et al. | Common epigenetic variation in a European population of mentally healthy young adults | |
| CN110029170B (en) | mRNA (messenger ribonucleic acid) detection primer group, kit and method for tumor sample immune checkpoint related genes | |
| CN111304226A (en) | Nucleic acid for coding CYP1B1 gene mutant and application thereof | |
| US20210155981A1 (en) | System and kit for detecting the number of cgg repeats in the 5' untranslated region of fmr1 gene | |
| US20220148690A1 (en) | Immunorepertoire wellness assessment systems and methods | |
| Sibille et al. | Large-scale estimates of cellular origins of mRNAs: enhancing the yield of transcriptome analyses | |
| CN108018285B (en) | Super-sensitive primer and design method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 100044 Room 601, 6 / F, building 10, 39 Sanlihe Road, Haidian District, Beijing Applicant after: Beijing Yuewei Gene Technology Co.,Ltd. Address before: 100089 1102, North building, Jiuling building, 21 Xisanhuan North Road, Haidian District, Beijing Applicant before: BEIJING MICROREAD GENE TECHNOLOGY Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: A detection system and detection kit for the number of CGG unit repeats in the 5 'untranslated region of FMR1 gene Granted publication date: 20210914 Pledgee: Zhongguancun Branch of Bank of Beijing Co.,Ltd. Pledgor: Beijing Yuewei Gene Technology Co.,Ltd. Registration number: Y2024110000027 |