CN108866027B - Application of VPS10 gene in low-secretion protein A of saccharomyces cerevisiae strain - Google Patents

Abstract

The invention provides an application of a VPS10 gene in a saccharomyces cerevisiae strain low-secretion protein A, which is realized by overexpressing a receptor gene VPS10 for controlling the separation of protease A from Golgi to vacuoles. The bacterial strain of over-expression VPS10 has 1.47 times raised intracellular enzyme activity and 61% lowered extracellular enzyme activity, and the fermentation characteristic of the over-expression bacterial strain is not changed obviously. The invention provides a new thought and method for reducing the extracellular enzyme activity of the protease A without changing the fermentation characteristic, and has guiding significance for improving the foam stability of the industrial yeast.

Description

Application of VPS10 gene in low-secretion protein A of saccharomyces cerevisiae strain

The application is a divisional application of Chinese invention patent application 2014107202377, the application date of the original application is 2014, 12 and 2, and the invention name is as follows: a yeast strain with low protease A secretion under the stress condition.

The technical field is as follows:

the invention belongs to the technical field of bioengineering, relates to breeding of industrial microorganisms, and particularly relates to application of a VPS10 gene in a yeast strain suitable for low protease A secretion under a stress condition at the end of fermentation.

Background art:

in the process of the development of draft beer, the brewing engineer is always troubled by some quality problems related to draft beer, wherein the problem of foam stability of draft beer is particularly prominent. As the pure draft beer is not pasteurized before being packaged, in the final fermentation stage, the nitrogen source is insufficient, and the high alcohol and carbon dioxide concentration can cause a stress environment to the yeast, thereby causing the excretion of protease A, decomposing foam positive protein, reducing the beer foam sustainability and generating adverse effects on the foam quality of the pure draft beer. Therefore, the improvement of the foam stability of the draft beer becomes a major technical problem for improving the quality of the draft beer in the world.

Although the foam stability of beer can be improved to some extent by optimizing the fermentation process or adding a foam stabilizer, the problem of foam decay cannot be solved from the source by this method. The gene engineering reduces the secretion of the protease A by knocking out the gene PEP4 for producing the protease A, thereby increasing the stability of the beer. However, intracellular protease A plays an important role in the physiological and biochemical functions of Saccharomyces cerevisiae cells, such as the maturation and activation of various enzymes in the vacuole; affecting the normal expression of some sugar metabolism enzyme in cell, etc. The fermentation characteristics of the PEP 4-deleted strain are therefore affected by the deletion of intracellular protease A.

Under normal metabolic conditions, the secretion process of saccharomyces cerevisiae protease a is that a proprotein a (preprpra) is synthesized in a rough endoplasmic reticulum, modified and folded through the endoplasmic reticulum, then transported to a golgi apparatus, finally directionally transported to vacuoles by vacuole sorting receptors and formed into mature protease a (pra) in the vacuoles. However, the fermentation medium is erroneously transported to the extracellular space and activated in the extracellular space under stress conditions such as deficiency of various nutrients and deficiency of nitrogen source in the late stage of fermentation.

Under normal metabolic conditions, VPS10, a gene encoding a vacuolar sorting receptor, plays an important role in the process of targeted secretion of protease a from the golgi apparatus into the vacuole. When the recognition site on the pro-proteinase A propeptide binds specifically to the sorting receptor, pro-proteinase A is transported from the reverse Golgi network to the vacuole and is activated upon reaching the vacuole, and the propeptide, consisting of 54 amino acid residues, is cleaved off, resulting in the formation of active proteinase A with a molecular weight of about 42 kD.

However, at present, few research reports are reported on controlling the internal and external secretion of protease A by regulating the expression level of a vacuole sorting receptor under the stress condition, and particularly, the research aspect of breeding yeast strains with low protease A secretion is blank, so that the method simulates the fermentation condition at the later stage of beer fermentation by setting a stress environment with a nitrogen source deficiency and high alcohol and carbon dioxide concentrations, and knocks out and over-expresses VPS10 genes respectively to regulate the expression level of the vacuole receptor, so as to select and breed the low-yield protease A strain suitable for fermentation.

The invention content is as follows:

the new method for regulating and controlling the intracellular and extracellular secretion of the protease A is to obtain the saccharomyces cerevisiae strain with low protease A by over-expressing the VPS10 gene complete sequence of a coded vacuole sorting receptor in the saccharomyces cerevisiae starting strain.

The VPS10 Gene has Gene ID as follows: 852264, the nucleotide sequence is shown as SEQ ID NO. 1 in the sequence table.

Preferably, the saccharomyces cerevisiae starting strain is a model strain W303-1A;

the construction method of the saccharomyces cerevisiae strain secreted by the low protease A comprises the following steps:

(1) firstly, the strong promoter PGK1p-PGK1t fragment on the pPGK1 plasmid is inserted into a YEP352 expression vector, then the VPS10 gene is inserted between the promoter PGK1p and the terminator PGK1T, and finally the KanMX resistance marker is inserted into the expression plasmid.

(2) The recombinant expression plasmid is introduced into the original strain to obtain a recombinant strain WGV10 of over-expressing VPS 10.

The method comprises the following specific steps:

(1) construction of Yep-PVK plasmid

Taking pPGK1 plasmid as a template, and amplifying a strong promoter PGK1p-PGK1t gene fragment by PCR;

secondly, using the total DNA of the yeast starting strain W303-1A as a template to amplify the VPS10 gene by PCR;

thirdly, using pUC6 plasmid as a template, and carrying out PCR amplification to obtain a KanMX resistance gene;

connecting the PCR products to YEP352 expression vectors in sequence to obtain a recombinant plasmid Yep-PVK;

(2) construction of VPS10 overexpression Strain

The free overexpression plasmid Yep-PVK is introduced into the starting strain W303-1A by a lithium acetate transformation method to obtain a VPS10 free overexpression recombinant strain.

The recombinant strain can be constructed by the above-mentioned methods, which have been reported in many documents, such as Joseph Sambrook et al, second edition of the Experimental Manual of molecular cloning, science Press, 1995. Other methods known in the art can also be used to construct genetically mutated yeast strains.

The invention also provides a gene sequence specially used for identifying the low-secretion protease A saccharomyces cerevisiae strain, the gene sequence is a specific fragment amplified by taking the genome of the low-secretion protease A saccharomyces cerevisiae strain as a template, and the nucleotide sequence of the specific fragment is shown as SEQ ID NO. 2 in a sequence table.

The over-expression strain obtained by the invention is fermented in wort with nitrogen source deficiency, the enzyme activity of the protease A in fermentation liquor is obviously reduced compared with the original strain, and other fermentation performances are not influenced.

Has the advantages that:

1. the influence of VPS10 knockout and overexpression on the internal and external secretion and fermentation characteristics of the protease A is verified through a beer fermentation experiment, the important separation effect of VPS10 in the process of transporting the protease A from a reverse Golgi body to vacuole is determined, and a theoretical basis is laid for the research in the field.

2. The intracellular and extracellular enzyme activities are measured by over-expressing the VPS10 gene, and the intracellular enzyme activities are improved by 1.47 times when the fermentation is finished; the extracellular enzyme activity is reduced to 61% of the original strain, and the fermentation characteristic is basically not obviously influenced compared with the original strain, thereby providing a new thought and method for guiding the beer industry to reduce the extracellular protease A enzyme activity and improve the foam stability.

Drawings

FIG. 1 is a schematic diagram showing a construction scheme of a recombinant plasmid pUC-VABK;

FIG. 2 is a check electrophoretogram of recombinant plasmid pUC-VABK;

wherein Lane M is 5000bp DNA Ladder Marker; lane 1 shows the 966bp upper homology arm VA verified by PCR using pUC-VABK as a template and VA-U and VB-D as primers; lane 2 shows the homology arm VB under 1050bp verified by PCR using pUC-VABK as a template and VB-U and VB-D as primers; lane 3 shows PCR verification of 1613bp KanMX marker gene using pUC-VABK as template and KAN-U and KAN-D as primers; lane 4 is a 3629bp recombinant cassette VA-loxP-KanMX-loxP-VB amplified using pUC-VABK as template and VA-U and VB-D as primers.

FIG. 3 is a schematic diagram of homologous recombination of the VA-KanMX-VB fragment of the gene cassette with the yeast genome;

FIG. 4 validation of VPS10 deletion recombinant strains;

wherein Lane M is 5000bp DNA Ladder Marker; lanes 1,2 were verified with VA-S and KV-X as primers; lanes 3 and 4 were verified with KV-S and VB-X as primers; wherein, the templates in lanes 1 and 3 are starting strains W303-1A, and bands cannot be amplified; the template in lanes 2 and 4 is deletion mutant W.DELTA.VPS 10, which amplified bands of 1835bp and 2498bp, respectively.

FIG. 5 is a schematic diagram of the construction process of the recombinant plasmid Yep-PVK;

FIG. 6 is a check electrophoretogram of recombinant plasmid Yep-PVK;

wherein Lane M is 5000bp DNA Ladder Marker; lane 1 shows a 4740bp VPS10 gene fragment verified by PCR using Yep-PVK as a template and VPS10-U and VPS10-D as primers; lane 2 is a KanMX gene fragment of 1613bp verified by PCR using Yep-PVK as a template and KAN-U and KAN-D as primers; lane 3 is the ligation direction of VPS10 verified by PCR using Yep-PVK as template and PG-S and VP-X as primers, and the product size is 1681 bp;

FIG. 7 verification diagram of the plasmid of Saccharomyces cerevisiae of the free overexpression strain VPS10

Wherein Lane M is 5000bp DNA Ladder Marker; lanes 1,2 were verified with PG-S and VP-X as primers; wherein the template in lane 1 is the starting strain W303-1A, and a band cannot be amplified; lane 2, as a template for the over-expressed strain WGV10, amplified a specific band of 1681bp in size.

FIG. 8 shows the trend of intracellular and extracellular enzyme activities of the deletion mutant strain and the original strain;

FIG. 9 trends of intracellular and extracellular enzyme activities of the overexpression strain and the starting strain;

FIG. 10 shows the trend of the alpha-amino nitrogen and good sugar rate of the over-expression strain and the original strain in the fermentation process.

Detailed Description

The invention is described below by means of specific embodiments. Unless otherwise specified, the technical means used in the present invention are well known to those skilled in the art. In addition, the embodiments should be considered illustrative, and not restrictive, of the scope of the invention, which is defined solely by the claims. It will be apparent to those skilled in the art that various changes or modifications in the components and amounts of the materials used in these embodiments can be made without departing from the spirit and scope of the invention.

The laboratory yeast used in the invention is a haploid strain of saccharomyces cerevisiae from which any source can be adopted.

Example 1: construction of deletion mutant strains

(1) Construction of pUC-VABK plasmid

The construction scheme of the recombinant plasmid pUC-VABK is shown in FIG. 1.

PCR amplifying an upstream sequence VA of a VPS10 gene by taking total DNA of a yeast starting strain W303-1A as a template;

an upstream primer VA-U: CCGGAATTCGAGTTTATGAGAAGGTTGGAGG(SEQ ID NO:3)

A downstream primer VA-D: CGGGGTACCAAAGACCCGAGTAGTTGGAG(SEQ ID NO:4)

The scribing part is an enzyme cutting site;

and (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 63 ℃; 60s at 72 ℃ for 30 cycles; carrying out electrophoresis on 0.8% agarose gel at 72 ℃ for 10min to identify an amplification product;

PCR reaction System (20. mu.L)

The PCR product was ligated to a pUC19 plasmid vector containing Amp resistance to obtain a recombinant plasmid pUC-VA.

Secondly, PCR amplification is carried out to obtain a downstream sequence VB of the VPS10 gene by taking total DNA of the yeast starting strain W303-1A as a template;

upstream primer VB-U: CGCGGATCCAGAATAAGAAAAGGCAGATA(SEQ ID NO:5)

Downstream primer VB-D: CG (CG)CTGCAGACAAGTTCCCATACCAAAAT(SEQ ID NO:6)

The underlined part is an enzyme cleavage site

And (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 60 ℃; 60s at 72 ℃ for 30 cycles; carrying out electrophoresis on 0.8% agarose gel at 72 ℃ for 10min to identify an amplification product;

the PCR product was ligated with the recombinant plasmid pUC-VA to obtain a recombinant plasmid pUC-VAB.

Thirdly, using pUC6 plasmid as a template, and carrying out PCR amplification to obtain a KanMX resistance gene;

an upstream primer KAN-U: GG (GG)GGTACCCAGCTGAAGCTTCGTACGC(SEQ ID NO:7)

The downstream primer KAN-D: CG (CG)GGATCCGCATAGGCCA CTAGTGGATCTG(SEQ ID NO:8)

The underlined part is an enzyme cleavage site

And (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 61 ℃; 90s at 72 ℃ for 30 cycles; carrying out electrophoresis on 0.8% agarose gel at 72 ℃ for 10min to identify an amplification product;

the PCR product was ligated to the recombinant plasmid pUC-VAB to obtain a recombinant plasmid pUC-VABK, and FIG. 2 is a PCR-verified diagram of the recombinant plasmid.

(2) Construction of VPS 10-deleted Strain

The recombination process of the gene cassette VA-KanMX-VB fragment and the yeast genome is shown in figure 3.

And (3) carrying out PCR amplification by taking the recombinant plasmid pUC-VABK as a template to obtain a recombination box VA-KanMX-VB with the length of 3629bp, respectively transforming the recombination box VA-KanMX-VB into saccharomyces cerevisiae W303-1A by using a lithium acetate transformation method to obtain a saccharomyces cerevisiae VPS10 deletion strain W delta VPS10 subjected to homologous recombination, and storing the strain.

And performing PCR verification on the recombinant strain W delta VPS10, and performing PCR amplification by using the genome of the deletion recombinant strain W delta VPS10 as a template and VA-S/KV-X as a primer. And (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 52 ℃; 100s at 72 ℃ for 30 cycles; the amplified product was identified by 0.8% agarose gel electrophoresis at 72 ℃ for 10min to give a 1835bp specific band (SEQ ID NO:19), whereas the starting strain genome failed to amplify fragments. And (3) carrying out PCR amplification by taking the genome of the deletion recombinant strain W delta VPS10 as a template and KV-S/VB-X as a primer. And (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 50 ℃; 150s at 72 ℃ for 30 cycles; the amplified product was identified by 0.8% agarose gel electrophoresis at 72 ℃ for 10min to give a 2498bp specific band (SEQ ID NO:20), whereas NO fragment could be amplified using the original strain genome as a control. The results show that the replacement of the VPS10 gene was achieved in the yeast genome. FIG. 4 shows the validation of VPS10 deletion recombinant strains.

Two pairs of specificity verification primers for deletion strain W Δ VPS 10:

an upstream primer VA-S: CCTCCTTAGCAGTAATCCTC (SEQ ID NO:9)

A downstream primer KV-X: AGAACCTCAGTGGCAAATCC (SEQ ID NO:10)

An upstream primer KV-S: TCTCACATCACATCCGAACA (SEQ ID NO:11)

Downstream primer VB-X: GATTCACTTTTACCAGACGC (SEQ ID NO:12)

Example 2: construction of overexpression strains

(1) Construction of Yep-PVK plasmid

The construction scheme of the recombinant plasmid Yep-PVK is shown in FIG. 5.

Taking pPGK1 plasmid as a template, and amplifying a strong promoter PGK1p-PGK1t gene fragment by PCR;

an upstream primer PGK-U: CGCGGATCCTCTAACTGAT CTATCCAAAACTGA(SEQ ID NO:13)

The downstream primer PGK-D: CGCGTCGACTAACGAACGCAGAATTTTC(SEQ ID NO:14)

The underlined part is an enzyme cleavage site

And (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 61 ℃; 100s at 72 ℃ for 30 cycles; carrying out electrophoresis on 0.8% agarose gel at 72 ℃ for 10min to identify an amplification product;

the PCR product was ligated to expression vector YEP352 to obtain recombinant plasmid Yep-P.

Secondly, using the total DNA of the yeast starting strain W303-1A as a template to amplify the VPS10 gene by PCR;

the upstream primer VPS 10-U: TCCAGATCTCCTCGAGATGATATTACTTCATTTTGTCTATTC(SEQ ID NO:15)

The downstream primer VPS 10-D: TCGCAGATCCCTCGAGCTACTGGTTTTCGTTAGATGGCGC(SEQ ID NO:16)

The underlined part is an enzyme cleavage site

And (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 60 ℃; 5min at 72 ℃ and 30 cycles; carrying out electrophoresis on 0.8% agarose gel at 72 ℃ for 10min to identify an amplification product;

and connecting the PCR product to the recombinant plasmid Yep-P to obtain the recombinant plasmid Yep-PV.

Thirdly, using pUC6 plasmid as a template, and carrying out PCR amplification to obtain a KanMX resistance gene;

an upstream primer KAN-U: GG (GG)GGTACCCAGCTGAAGCTTCGTACGC(SEQ ID NO:7)

The downstream primer KAN-D: CG (CG)GGATCCGCATAGGCCA CTAGTGGATC TG(SEQ ID NO:8)

The underlined part is an enzyme cleavage site

And (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 61 ℃; 90s at 72 ℃ for 30 cycles; carrying out electrophoresis on 0.8% agarose gel at 72 ℃ for 10min to identify an amplification product;

and connecting the PCR product to the recombinant plasmid Yep-PV to obtain the recombinant plasmid Yep-PVK, wherein the PCR verification chart of the recombinant plasmid is shown in FIG. 6.

(2) Construction of VPS10 overexpression Strain

Introducing the free overexpression plasmid Yep-PVK into the starting strain W303-1A by a lithium acetate transformation method to obtain a VPS10 free overexpression recombinant strain WGV10, and preserving the strain.

Performing PCR verification on the recombinant strain WGV10, extracting a plasmid of the recombinant strain WGV10 as a template, and performing PCR amplification by taking PG-S/VP-X as a primer. And (3) PCR reaction conditions: 5min at 95 ℃; 45s at 94 ℃; 1min at 48 ℃; 100s at 72 ℃ for 30 cycles; the amplification product is identified by 0.8% agarose gel electrophoresis at 72 ℃ for 10min, a specific band of 1681bp can be obtained, and the starting strain can not amplify the fragment. FIG. 7 is a graph of the electrophoresis of the recombinant strain WGV10 for confirmation.

A pair of specific validation primers for the over-expressed strain WGV 10:

an upstream primer PG-S: TAACTGATCTATCCAAAACTGAA (SEQ ID NO:17)

The downstream primer VP-X: GCTTATAGTAACGGAGGTGTCTT (SEQ ID NO:18)

Example 3: beer fermentation experiment

The recombinant strains obtained in examples 1 and 2 and the starting strain W303-1A are taken as experimental objects,

(1) seed culture

1) Activating strains: the preserved strain is transferred to a YEPD slant test tube for activated culture at 30 ℃ for two days.

2) First-order seed culture: taking a loop of slant strains, inoculating the slant strains into a test tube containing 5mL of wort culture medium, and culturing at 30 ℃ and 180rpm for 14 h.

3) Secondary seed culture: inoculating the first-stage seed solution into a 150mL triangular flask containing 50mL of wort according to the inoculation amount of 10%, and standing and culturing at 16 ℃ for 36 h.

(2) Beer fermentation

Fermentation experiment: inoculating the second-stage seed solution into 250mL triangular flask containing 150mL 10Brix nitrogen-deficient wort according to the inoculation amount of 10%, covering with fermentation plug to keep the pressure in the flask, and standing at 16 deg.C for fermentation. PrA viability (both intracellular and extracellular) was measured from day 5 of the vigorous fermentation period and samples were taken every 2-3 days (samples were taken by setting multiple replicates to maintain constant pressure in the bottle). The beer fermentation experiments were performed on the deletion strain, the overexpression strain and the starting strain, respectively, according to the above fermentation conditions. After the fermentation is finished, the residual sugar concentration and the alcohol volume fraction of the fermentation liquor are measured to represent the comprehensive fermentation performance.

(3) Effect of the knockout of VPS10 on the secretion of protease A

For intracellular enzyme activity (FIG. 8), we found that the deletion strain W.DELTA.VPS 10 had reduced enzyme activity compared to the starting strain W303-1A throughout the fermentation period; at the end of 13 days fermentation, the intracellular enzyme activity of the deletion strain W delta VPS10 is 53% of that of the original strain; for extracellular enzyme activity, the enzyme activity of the deletion strain W delta VPS10 is 2.2 times higher than that of the original strain. The data result shows that under the stress condition, the VPS10 gene is knocked out while the expression quantity of the protease A is not changed, so that the efficiency of sorting the protease A into vacuoles is reduced, and the content of the protease A secreted into a fermentation liquid is increased. The VPS10 gene plays an important sorting role in the directional transportation process of the protease A from Golgi to vacuole under the stress condition.

(4) Effect of overexpression of VPS10 on the secretion of protease A

For intracellular enzyme activity (fig. 9), the over-expression strain WGV10 has improved enzyme activity compared with the starting strain W303-1A during the whole fermentation period, and is improved by 1.47 times when the fermentation is finished; and the extracellular enzyme activity was reduced to 61% of the original strain. The data result further shows that under the stress condition, the VPS10 gene is over-expressed while the expression quantity of the protease A is not changed, so that the transport efficiency of the protease A from a reverse Golgi body to vacuole is improved, and the activity of the protease A secreted into a fermentation liquor is reduced. We continue to compare the trend of the alpha-amino nitrogen and apparent sugar degree in the fermentation liquor of the over-expression strain and the original strain to observe the change of the fermentation characteristic of the over-expression strain.

As shown in fig. 10, during the fermentation process, the α -amino nitrogen concentration and sugar degree of the over-expressed strain are not significantly changed from the original strain, but at the end of the fermentation, the α -amino nitrogen concentration of the over-expressed strain is lower than that of the original strain, because the end of the fermentation is a period of relative lack of nitrogen source, and is a period of yeast secreting a large amount of protease a under the stress condition, the content of protease a in the fermentation broth of the over-expressed strain is low, and the ability of protease a to decompose the protein in the fermentation broth into amino acid is weakened, so the content of α -amino nitrogen in the fermentation broth is also low. In order to avoid that the terminal large amount of secreted protease A influences the foam stability, the yeast can be separated in time when the sugar consumption is finished, so that the fermentation cannot be influenced by the lower alpha-amino nitrogen content in the fermentation liquor of the over-expression strain.

After the end of the fermentation, we compared the residual sugar and the alcoholic strength of the two strains (see table 1 for the results), and found that there was substantially no significant difference. By combining the above indexes, the fermentation characteristics of the over-expression strain are not substantially changed.

TABLE 1 comparison of alcoholic strength and residual sugar of over-expressed and original strains

Note: the data shown are the average of the results of three replicates.

Sequence listing

<110> Tianjin science and technology university

Application of <120> VPS10 gene in low-secretion protein A of saccharomyces cerevisiae strain

<130> 1

<141> 2018-08-30

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4740

<212> DNA

<213> Saccharomyces cerevisiae W303-1A ()

<400> 1

atgatattac ttcattttgt ctattctctt tgggccttac ttctcattcc tttaactaat 60

gccgaagaat tcacccccaa agtgacaaag actatcgcgc aagattcatt tgatatatta 120

agctttgatg attccaacac tttaattaga aaacaagaca cctccgttac tataagcttt 180

gacgatggtg aaacatggga aaaagttgaa ggcattgaag gcgaaatcac ttggatatac 240

atcgacccct tcaatagaca tgacagagcc gttgcaacgg caatgaatgg gtcgtacctt 300

tatataacca atgatcaagg taagtcatgg gagcgtataa cgctacctga ctccggagaa 360

agtatttcac ctcgtgaatg ctatatagaa acccatccct tgaataagaa ctattttctt 420

gcaaagtgca actattgtga gaaaacagaa gtaaacaatg acaatgaaga gaattcgggg 480

gacgaagagg gacaatttga aatatttaat attacacgtt gcacagacaa ggtttttgca 540

agtaatgatg gtggaaaatc cttttctgag atcaagtctt ctctagaaag gaacgaaaat 600

agtcctatca gcatttctga ttgtggcttt gccaagacca gcaaagattc tgaccttgaa 660

agtagtgata cctcaataat ctgtcttttt caaaatatgc agcttattat ggatgagttt 720

agttctcctt acaccgaaag taaattggtc ctaactacgg actggggcaa atcactaaaa 780

gaatttgacc aatttaaaga taaggtcgtc aatggttaca ggatattgaa atctcacatg 840

gttgtcttaa cccagggcga cagatataat gatatgtctt ccatggatgt gtgggtatca 900

aatgatctgt caaactttaa aatggcttac atgcctactc agttaaggca ttctatgcaa 960

ggagaaatat atgaggacgc tatgggaaga attatcttgc ccatgagtag ggaaagaagt 1020

gatcaagagg aggataaggg catcgtgtct gaaattttaa tttccgactc acaagggtta 1080

aaattttccc ccatcccatg gaccgcaaat gaggtgtttg gttatattaa tttttatcaa 1140

cctacttact tgaaaggaac gatgattgcc tcactttacc ctctatctag gcgtcgtaac 1200

cgtaaaggaa aagccaaagg agtaaagagt aagggggtaa ccaaaatatc tgttgataat 1260

ggcctcacat ggacaatgtt aaaagttgtt gatccagata acgcagactc attcgactgt 1320

gatattactg attttgagaa ttgttcgctt caaaatatgt tttacacacg ggagggttcc 1380

actccaaccg ccggaattct aatgacaaca ggtattgttg gcgatggtag tgtcttcgac 1440

tggggagatc aaagaacctt tatttctagg gatggtggct taacatggaa actcgccttt 1500

gattttcctt gtttatacgc tgttggtgat tacggaaatg ttattgtggc tataccgtat 1560

aatgcggatg aagacgacga tcctcaatcc gaattttatt actctttaga ccaaggtaaa 1620

acttggaccg aatatcagct agaaactact atctacccaa atgaagtaat gaatacaacg 1680

cccgacggat ctggagctaa atttattcta aatgggttta ctttggcgca tatggatggt 1740

acaacgaatt tcatctatgc aattgatttt tcaacagcct ttaatgataa gacatgcgaa 1800

gaaaatgatt tcgaggattg gaatttagct gaggggaagt gtgtcaatgg agtcaagtac 1860

aagatcagaa gaagaaaaca ggacgctcag tgcttggtga agaaagtttt tgaagactta 1920

caattatttg agactgcttg tgacaagtgt accgaggctg attacgaatg cgcgtttgaa 1980

tttgttaggg acgcgaccgg gaaatgcgta ccagactaca acctaatcgt tctctctgac 2040

gtatgtgata agacaaagaa aaaaactgtg cctgtaaaac cattgcaact agttaaaggt 2100

gataaatgta aaaaaccaat gacagtcaaa tcagtggata tttcgtgtga gggagttcca 2160

aagaagggaa cgaatgataa agaaatagtg gttacagaaa acaaatttga tttcaagatt 2220

caattctatc aatactttga cacagtcacc gacgaatccc tcctcatgat caattcaaga 2280

ggagaagctt atatatctca tgatggtgga caaacaataa aaaggttcga cagtaatggt 2340

gaaacaatta ttgaagttgt gtttaatcca tactacaatt cttcagctta tctgtttggt 2400

tccaaaggta gcattttctc tacccatgat aggggatact cttttatgac tgctaaattg 2460

cccgaggcta ggcagttagg tatgccatta gactttaacg ctaaggcaca ggatacattt 2520

atctattatg gtggtaagaa ttgtgagtca atcttaagtc cggaatgtca tgcggtagca 2580

tacctgacca atgatggggg cgaaacgttt acggaaatgc ttgataatgc aattcattgt 2640

gagtttgcgg gctcactttt caaatatccg tcaaatgagg atatggttat gtgtcaagtg 2700

aaggaaaagt cttcgcagac aagaagctta gtttcttcta ctgatttttt ccaggatgat 2760

aaaaataccg tctttgaaaa tattatcggc tacttatcca ctggtggcta tatcatcgtt 2820

gctgttcctc atgagaacaa cgaattgaga gcatacgtaa ctatcgatgg tactgagttt 2880

gccgaggcaa aattcccata tgatgaagat gttgggaagc aagaggcatt cactatatta 2940

gagtctgaga aaggatcgat attcttacat ttagcaacaa acttagtacc aggacgcgat 3000

tttggcaatc ttttgaaatc caactcaaat ggtacttctt ttgtcacgtt ggagcatgcc 3060

gttaatagaa acacattcgg ctatgttgac tttgaaaaaa ttcaaggtct cgaaggcatt 3120

attctcacca acatcgtttc aaatagtgac aaggtcgccg agaataaaga agacaaacaa 3180

ttgaagacga agatcacctt taatgaaggt tcagattgga actttttgaa acctccgaag 3240

agggattcag aaggaaaaaa gttttcttgc agctccaaat cactggatga gtgttcattg 3300

cacttacatg gctatactga acgtaaggat attagagata catattcttc cggttctgca 3360

ttaggaatga tgttcggcgt tggcaacgtt ggtcctaacc ttttaccata taaagaatgt 3420

tccaccttct tcaccaccga tggtggcgaa acgtgggctg aagttaagaa gactcctcac 3480

caatgggaat acggtgacca cggtgggatt ttagttttag ttcctgaaaa ctcagaaact 3540

gattctattt cctattctac cgattttggt aaaacatgga aagattataa attctgcgct 3600

gataaggttt tagtaaagga tataaccact gttcccaggg attctgcttt gagatttttg 3660

ctgtttggag aggcagcaga tattggaggc agctcattta gaacgtacac aattgatttt 3720

agaaacatct tcgaaagaca atgtgatttc gacatcactg gtaaggaaag cgcagattat 3780

aaatactctc ctctgggttc caaaagcaat tgcctatttg gtcaccaaac cgagttttta 3840

cgtaaaaccg atgaaaattg ttttattggg aatattccac tttctgaatt ttcaagaaat 3900

atcaaaaact gttcttgtac aagacaagat ttcgagtgtg attacaactt ttacaaagct 3960

aacgatggta cttgtaaatt agtcaaagga ctaagcccag caaatgctgc agacgtttgt 4020

aaaaaagagc cagatttaat cgaatatttt gaatcgtcag gctacagaaa gatccctcta 4080

tcaacctgtg agggtggcct gaaattggat gctccctcat caccacatgc ttgcccagga 4140

aaagaaaaag aattcaagga aaagtactca gtaagtgccg gtccctttgc atttattttc 4200

atttcaattc ttttaataat tttctttgcc gcatggtttg tatatgacag aggtatcaga 4260

agaaatgggg gatttgcaag gtttggagaa attaggctag gtgacgatgg tttaatagaa 4320

aacaataata ctgacagagt tgtcaataac attgtgaaat caggatttta cgttttctca 4380

aatatcgggt ctcttttaca gcacacaaaa actaatatag cgcatgctat ctccaaaatt 4440

agaggaaggt ttggaaacag aacaggtcca agctactcat ccctgatcca tgatcaattt 4500

ttggatgaag cagatgacct gcttgctggc cacgatgaag acgccaatga cttatccagt 4560

ttcatggatc agggtagtaa ttttgaaatc gaagaagatg atgttccaac acttgaagaa 4620

gagcatacat catatacaga tcaacctacg accaccgatg ttccagatac attaccagaa 4680

ggaaatgagg aaaacatcga caggcctgat tctacagcgc catctaacga aaaccagtag 4740

<210> 2

<211> 1681

<212> DNA

<213> Artificial sequence ()

<400> 2

taactgatct atccaaaact gaaaattaca ttcttgatta ggtttatcac aggcaaatgt 60

aatttgtggt attttgccgt tcaaaatctg tagaattttc tcattggtca cattacaacc 120

tgaaaatact ttatctacaa tcataccatt cttataacat gtccccttaa tactaggatc 180

aggcatgaac gcatcacaga caaaatcttc ttgacaaacg tcacaattga tccctcccca 240

tccgttatca caatgacagg tgtcattttg tgctcttatg ggacgatcct tattaccgct 300

ttcatccggt gatagaccgc cacagagggg cagagagcaa tcatcacctg caaacccttc 360

tatacactca catctaccag tgtacgaatt gcattcagaa aactgtttgc attcaaaaat 420

aggtagcata caattaaaac atggcgggca cgtatcattg cccttatctt gtgcagttag 480

acgcgaattt ttcgaagaag taccttcaaa gaatggggtc tcatcttgtt ttgcaagtac 540

cactgagcag gataataata gaaatgataa tatactatag tagagataac gtcgatgact 600

tcccatactg taattgcttt tagttgtgta tttttagtgt gcaagtttct gtaaatcgat 660

taattttttt ttctttcctc tttttattaa ccttaatttt tattttagat tcctgacttc 720

aactcaagac gcacagatat tataacatct gcacaatagg catttgcaag aattactcgt 780

gagtaaggaa agagtgagga actatcgcat acctgcattt aaagatgccg atttgggcgc 840

gaatccttta ttttggcttc accctcatac tattatcagg gccagaaaaa ggaagtgttt 900

ccctccttct tgaattgatg ttaccctcat aaagcacgtg gcctcttatc gagaaagaaa 960

ttaccgtcgc tcgtgatttg tttgcaaaaa gaacaaaact gaaaaaaccc agacacgctc 1020

gacttcctgt cttcctattg attgcagctt ccaatttcgt cacacaacaa ggtcctagcg 1080

acggctcaca ggttttgtaa caagcaatcg aaggttctgg aatggcggga aagggtttag 1140

taccacatgc tatgatgccc actgtgatct ccagagcaaa gttcgttcga tcgtactgtt 1200

actctctctc tttcaaacag aattgtccga atcgtgtgac aacaacagcc tgttctcaca 1260

cactcttttc ttctaaccaa gggggtggtt tagtttagta gaacctcgtg aaacttacat 1320

ttacatatat ataaacttgc ataaattggt caatgcaaga aatacatatt tggtcttttc 1380

taattcgtag tttttcaagt tcttagatgc tttctttttc tcttttttac agatcatcaa 1440

ggaagtaatt atctactttt tacaacaaat ataaaacaag atcggaattc cagatctcct 1500

cgagatgata ttacttcatt ttgtctattc tctttgggcc ttacttctca ttcctttaac 1560

taatgccgaa gaattcaccc ccaaagtgac aaagactatc gcgcaagatt catttgatat 1620

attaagcttt gatgattcca acactttaat tagaaaacaa gacacctccg ttactataag 1680

c 1681

<210> 3

<211> 31

<212> DNA

<213> Artificial sequence ()

<400> 3

ccggaattcg agtttatgag aaggttggag g 31

<210> 4

<211> 29

<212> DNA

<213> Artificial sequence ()

<400> 4

cggggtacca aagacccgag tagttggag 29

<210> 5

<211> 29

<212> DNA

<213> Artificial sequence ()

<400> 5

cgcggatcca gaataagaaa aggcagata 29

<210> 6

<211> 28

<212> DNA

<213> Artificial sequence ()

<400> 6

cgctgcagac aagttcccat accaaaat 28

<210> 7

<211> 27

<212> DNA

<213> Artificial sequence ()

<400> 7

ggggtaccca gctgaagctt cgtacgc 27

<210> 8

<211> 30

<212> DNA

<213> Artificial sequence ()

<400> 8

cgggatccgc ataggccact agtggatctg 30

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 9

cctccttagc agtaatcctc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 10

agaacctcag tggcaaatcc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 11

tctcacatca catccgaaca 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 12

gattcacttt taccagacgc 20

<210> 13

<211> 33

<212> DNA

<213> Artificial sequence ()

<400> 13

cgcggatcct ctaactgatc tatccaaaac tga 33

<210> 14

<211> 28

<212> DNA

<213> Artificial sequence ()

<400> 14

cgcgtcgact aacgaacgca gaattttc 28

<210> 15

<211> 42

<212> DNA

<213> Artificial sequence ()

<400> 15

tccagatctc ctcgagatga tattacttca ttttgtctat tc 42

<210> 16

<211> 40

<212> DNA

<213> Artificial sequence ()

<400> 16

tcgcagatcc ctcgagctac tggttttcgt tagatggcgc 40

<210> 17

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 17

taactgatct atccaaaact gaa 23

<210> 18

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 18

gcttatagta acggaggtgt ctt 23

<210> 19

<211> 1835

<212> DNA

<213> Artificial sequence ()

<400> 19

cctccttagc agtaatcctc ttcgcagggt caaaaacaag catacgctgt aaaagatcta 60

tgcctttcgg gttgactcga gggaacatct tctccagtgg cgcggcaggg tacatgggaa 120

gcgactttat gtactctcta gccctgggtg actctataca ccgcaaatca ttatctgagt 180

gaggtgtacc gatgataccg aatatcagta gtagttgatg gcgataatct ctgccaggga 240

agattggccg tcttaagaaa agttcagcga gaatacatcc gcaggaccac acgtccatgg 300

cccttgagta tttggcagag gttaacatca cctctggcgc cctgtaccaa cgtgtggcca 360

catactcggt catgccgctt tgctgacctg tgggctctga attgtccgcg gctgactcgt 420

caatgattct tgctaaaccg aaatcacata ctttcaagtc acagttggag tttatgagaa 480

ggttggaggg ctttaaatca cgatggatga cgttcgaacc atgcagcact ttcactgctc 540

tcaaggtttg gtatataaaa tattgtatat gatcgtcact cagcatctgg gtggagatta 600

cacggtgtaa atctgtctgc attagctctt gaattatgta gacctcattg aagttttcga 660

acgagtcagg gcgttgaatg ttgaagattg ttatgatatt ttcgtgcttg aagtgcttca 720

ggatctttat ttcacgcagc gtacgtaatg cgaacaaagg cttatcgaat ggttcgatct 780

tttttattgc cacgatttct cccgtgggct tatgcgttgc agaacatacc acaccgtatg 840

caccctctcc cagtaacgac ttcaactgga agtcactgga tatattgtat acaattctct 900

ttggcatatt attttccttt ctttttctct gccttatttc cttgtagttc aaacgaacta 960

gctattagaa gaaagaaaat gattacaacg tatatatagt ttctgagagg caagagtaaa 1020

aagttatgat atattagtat gttgcttttc tgcaattgtt tcaatgccct gtaaaaaacc 1080

gcatcatcta aaatctgaga gaatgcagaa acaaaaaaaa aaaaagtaaa aatttcgagt 1140

aaaagaattt tgagttccag ggtgaaacag atctaaaact caagagctta tgcattgctt 1200

gtaggtacat cacattttac ttcagaaaga taaaagagta tgtgaaagta aactgccctc 1260

tccagttaac tcttcccaaa ctaaaaagta tccgcctgtg cggactacaa gcactaccgc 1320

cccttgaatg aacaccaaaa gatgtgtgta agttaaaaag tccgaacgaa tttatcctta 1380

tgtatgttct tttgaacgtc aagtagtcaa tctctccaac tactcgggtc tttcagctga 1440

agcttcgtac gctgcaggtc gacaaccctt aatataactt cgtataatgt atgctatacg 1500

aagttattag gtctagagat ctgtttagct tgcctcgtcc ccgccgggtc acccggccag 1560

cgacatggag gcccagaata ccctccttga cagtcttgac gtgcgcagct caggggcatg 1620

atgtgactgt cgcccgtaca tttagcccat acatccccat gtataatcat ttgcatccat 1680

acattttgat ggccgcacgg cgcgaagcaa aaattacggc tcctcgctgc agacctgcga 1740

gcagggaaac gctcccctca cagacgcgtt gaattgtccc cacgccgcgc ccctgtagag 1800

aaatataaaa ggttaggatt tgccactgag gttct 1835

<210> 20

<211> 2498

<212> DNA

<213> Artificial sequence ()

<400> 20

tctcacatca catccgaaca taaacaacca tgggtaagga aaagactcac gtttcgaggc 60

cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct cgcgataatg 120

tcgggcaatc aggtgcgaca atctatcgat tgtatgggaa gcccgatgcg ccagagttgt 180

ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg gtcagactaa 240

actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt actcctgatg 300

atgcatggtt actcaccact gcgatccccg gcaaaacagc attccaggta ttagaagaat 360

atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc cggttgcatt 420

cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc gctcaggcgc 480

aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag cgtaatggct 540

ggcctgttga acaagtctgg aaagaaatgc ataagctttt gccattctca ccggattcag 600

tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg aaattaatag 660

gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt gccatcctat 720

ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa aaatatggta 780

ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag tttttctaat 840

cagtactgac aataaaaaga ttcttgtttt caagaacttg tcatttgtat agttttttta 900

tattgtagtt gttctatttt aatcaaatgt tagcgtgatt tatatttttt ttcgcctcga 960

catcatctgc ccagatgcga agttaagtgc gcagaaagta atatcatgcg tcaatcgtat 1020

gtgaatgctg gtcgctatac tgctgtcgat tcgatactaa cgccgccatc cagtgtcgaa 1080

aacgagctct cgagaaccct taatataact tcgtataatg tatgctatac gaagttatta 1140

ggtgatatca gatccactag tggcctatgc agaataagaa aaggcagata aatagtttga 1200

taaatggcca gttgtgatgg ggaaaaagac ttttagagaa tggcaatatt tcaagttatc 1260

aatgtatgta tatttttgac tttttgagtc tcaactaccg aagagaaata aactactaac 1320

gtactttaat atttatagta cttcattcga tcaagatgtg gacgatgcac atgctattga 1380

tcaaatgaca tggaggcaat ggttaaataa cgcattgaaa cgtagttatg gtatttttgg 1440

tgaaggtgta gaatattcat tcctgcatgt tgacgataag ctggcttaca tcagagtaaa 1500

tcatgcggat aaagatacat tttcttcgtc catcagtaca tacatatcta ctgatgaact 1560

cgtcggttca ccattaacag tgtcaattct acaagaatct tccagtttga gacttctgga 1620

ggttactgac gatgaccgcc tatggctgaa aaaagtaatg gaagaagaag aacaagactg 1680

taaatgtata tagaatatca gtttattatt taaaaaaact tgggcataga agaaagtgtt 1740

ttattctccc aaaatatcag ctgacgtttt catatttaaa cccactgaaa aaacccacaa 1800

gatgattctg tattatttga atcaccccga gatctcttgc aaatccagaa ctttctacct 1860

ggattggccg aagttttcga tgttttcagc atggattcct ccccatgcct gcacagggga 1920

ggctttccaa agacatcctt gaaattcaac tttggcgtgg agattctttt tttagcttgc 1980

tgtggaattt cagaggattc tttaatcctg tcatcttttt ctccatttac cttctggaaa 2040

aatgagtcga gcgatttgtt tttgatgttg ctgttttttt tggtattcat gacttttgat 2100

acacaatatt tttgtttatt agattcttta ttcgtatcct ttttggcaaa catctctaaa 2160

acattatggt ttcttaaatt atatttgtac cttgcttcga attttggtat gggaacttgt 2220

gtcgtaccag gttcaattct gtcgtccagt atatctaaat cagaatacac aggacaatgg 2280

tcagagccca atatatccgg aagaatgtca gctgctttta tgcatcgttc aagctttaag 2340

gacactagga taaaatctat ccgtgagcca taattcgaag gtcttaaatt ttttaacata 2400

ttccagactg tatacatttt aagtcgattt cttgtttgaa ttagcctcgt agtgtctatc 2460

agtatccccc ttttactcgc gtctggtaaa agtgaatc 2498

Claims (3)

1. The application of the VPS10 gene in the low-secretion protease A of a saccharomyces cerevisiae strain under the stress condition is characterized in that the application is realized by constructing saccharomyces cerevisiae genetic engineering bacteria only by over-expressing the VPS10 gene; the VPS10 Gene has Gene ID as follows: 852264, respectively;

the stress condition is beer fermentation in nitrogen deficient wort; the host cell of the saccharomyces cerevisiae gene engineering bacteria is W303-1A.

2. The application of the saccharomyces cerevisiae gene engineering bacteria as claimed in claim 1, wherein the construction method of the saccharomyces cerevisiae gene engineering bacteria comprises the following steps: (1) constructing Yep-PVK plasmid, namely, PCR amplifying a strong promoter PGK1 p-terminator PGK1t gene fragment by taking pPGK1 plasmid as a template; secondly, using the total DNA of the yeast starting strain W303-1A as a template to amplify the VPS10 gene by PCR; thirdly, using pUC6 plasmid as a template, and carrying out PCR amplification to obtain a KanMX resistance gene; connecting the PCR products to YEP352 expression vectors in sequence to obtain a recombinant plasmid Yep-PVK; (2) construction of VPS10 overexpression Strain the free overexpression plasmid Yep-PVK was introduced into the starting strain W303-1A by lithium acetate transformation to obtain a VPS10 free overexpression recombinant strain.

3. The use according to claim 1, wherein the method for detecting the low-secretion protease A Saccharomyces cerevisiae strain is to use the total DNA of the recombinant strain as a template and to perform the following steps by using a primer pair: an upstream primer: TAACTGATCTATCCAAAACTGAA downstream primer: GCTTATAGTAACGGAGGTGTCTT, PCR amplification is carried out, a specificity strip with the length of 1681bp can be obtained, and the nucleotide sequence of the specificity strip is shown in a sequence table SEQ ID NO. 2; and if the specific band appears, the detected strain is proved to be the saccharomyces cerevisiae strain with low-secretion protease A.

Images