CN108852978A - Improve composition, its preparation process and the application of skin - Google Patents
Improve composition, its preparation process and the application of skin Download PDFInfo
- Publication number
- CN108852978A CN108852978A CN201811000629.0A CN201811000629A CN108852978A CN 108852978 A CN108852978 A CN 108852978A CN 201811000629 A CN201811000629 A CN 201811000629A CN 108852978 A CN108852978 A CN 108852978A
- Authority
- CN
- China
- Prior art keywords
- composition
- skin
- improving
- prepare
- extract
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9794—Liliopsida [monocotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9728—Fungi, e.g. yeasts
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9789—Magnoliopsida [dicotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
- A61K2800/59—Mixtures
- A61K2800/592—Mixtures of compounds complementing their respective functions
- A61K2800/5922—At least two compounds being classified in the same subclass of A61K8/18
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Birds (AREA)
- Epidemiology (AREA)
- Botany (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Dermatology (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Cosmetics (AREA)
Abstract
The present invention relates to a kind of increasing liquid energy member, its preparation process and applications.Present invention discloses one kind for improving the effective composition of skin, the composition is mainly by dendrobium nobile, aloe, kuh-seng, smilax, purple coneflower, oat, Radix Ophiopogonis, tremella, it is prepared through suitable preparation method, it is also known as " increasing liquid energy member " by the present inventor.The composition is ideal for the improvement result of skin, and the cost of raw material is cheap, is easily obtained, and preparation method is simple.
Description
Technical field
The invention belongs to cosmetic fields, more particularly it relates to which a kind of composition for improving skin (increases liquid energy
Amount member), preparation process and application.
Background technique
Skin is distributed in body surface, is generally divided into epidermis, corium and subcutaneous tissue three parts from outside to inside, and epidermis
It is divided into cuticula, hyaline layer, stratum granulosum, spinous layer and basal layer again.The outermost cuticula of skin, in the complete of skin barrier function
It is whole to play critically important effect.Have one layer of sebum film above cuticula, be by sebum, sweat and epidermal cell secretion emulsification and
The translucent milky film of formation, free fatty acid, lactate, urea and uric acid in sebum film are natural moisturizing factor,
Moisture-keeping function is risen to skin.Cuticula and sebum film can prevent the loss of moisture of skin.Under normal circumstances, cuticula is aqueous
Amount should be horizontal lower than this 10% or so, is exactly water shortage skin.
Skin condition is not good enough, skin quality is dry, is modern, especially modern female frequently problem.Lead to skin
The reason of going wrong is various：Including age factor, climate change, sleep insufficiency, fatigue, excessively weight-reducing and partial eclipse,
Use excitant product etc..With advancing age, the reduction of internal estrogen level, sebum secretion are reduced, vitrification
The ability of moisture can decline, so that skin be made to become more and more dry.The variation of outside climatic, air quality are deteriorated, and will lead to skin
Adipose gland and sweat gland secretion are abnormal, and the surface of skin just becomes rougher, and resistance can also weaken, and the time is long, it is possible to be accustomed to
Property it is dry.In addition, sleep insufficiency, fatigue, excessively weight-reducing and partial eclipse, can make body by sizable injury, blood circulation
It can be deteriorated, when healthy disequilibrium, skin will not have vigor, be easy to produce dry and coarse phenomenon.
Therefore, how skin is taken good care of, restores the moist elasticity of skin, be the hot spot of this field.
Summary of the invention
The purpose of the present invention is to provide a kind of preparation process of mixture (increasing liquid energy member) for improving skin and its answer
With.
In the first aspect of the present invention, a kind of mixture is provided, the mixture includes following components：
In a preferred embodiment, the mixture includes following components：
In another preferred example, the dendrobium nobile is HERBA DENDROBII.
In another aspect of this invention, provide a kind of for improving the composition of skin, the composition contains water extract,
The water extract is extracted via water by mentioned-above mixture and is obtained.
In a preferred embodiment, the preparation method of the water extract is：The component of the mixture is processed, powder
The broken component through processing mixes, and extracts 2~6 hours at 70~90 DEG C；Cooling, filtrate is collected in filtering；More preferably, it also carries out true
Empty refined filtration, condition are：Filter board average pore size is 1.0 ± 0.2 μm (preferably 1.0 ± 0.1 μm), and vacuum degree is -0.095
± 0.02MPa (preferably -0.095 ± 0.01 MPa).
In another preferred example, the composition further includes：On cosmeceutical, it is chemically or biologically acceptable
Carrier；Preferably, in the composition water extract account for composition total weight 1~99% (such as 2%, 3%, 5%, 10%,
15%, 20%, 30%, 50%, 60%, 80%, 85%, 90%, 95%, 98%).
In another preferred example, the dosage form of the composition includes but is not limited to：Gelling agent, emulsion, solution, aerosol
Agent, powder agent, granule, capsule or suspension.
In another aspect of this invention, the purposes of the mixture is provided, the composition for improving skin is used to prepare, compared with
Goodly, the improvement skin includes：Moist skin reduces the skin scales of skin that peel off；Or it is used to prepare raising keratinocyte water and leads to
The composition of the expression of road albumin A QP3；Or it is used to prepare the composition for improving the expression of keratinocyte silk polyprotein FLG；
Or it is used to prepare the composition for improving the expression of tight junction protein CLDN-1；Or be used to prepare and effectively remove ABTS free radical,
Composition with antioxidant activity.
In another aspect of this invention, the preparation method of the composition for improving skin, the method are provided
Including：
(1) following components is provided：
(2) component for processing, crushing (1), mixes, and carries out water extraction；Preferably, being extracted 2~6 hours at 70~90 DEG C；
Cooling, filtrate is collected in filtering.
In a preferred embodiment, the method also includes：Vacuum refined filtration is carried out, condition is：Filter board average pore size is
1.0 ± 0.2 μm, preferably 1.0 ± 0.1 μm；Vacuum degree is -0.095 ± 0.02MPa, preferably -0.095 ± 0.01MPa.
In another preferred example, the dendrobium nobile is HERBA DENDROBII.
In another aspect of this invention, the purposes of the mixture is provided, a kind of kit (including：Packing box, packaging
Bag, minaudiere), it include following components, extract, or the composition containing its extract in the kit：
It in a preferred embodiment, include following components or its extract in the kit：
In another preferred example, the dendrobium nobile is HERBA DENDROBII.
In another preferred example, the composition containing its extract is any composition in front.
In another preferred example, in the kit, each component is packed individually respectively, or is crushed and is mixed in container
In, or be present in container in the form of extract.
Other aspects of the invention are apparent to those skilled in the art due to this disclosure
's.
Detailed description of the invention
The expression of aquaporin AQP3 in keratinocyte can be improved in Fig. 1, increasing liquid energy member.
Fig. 2, increasing liquid energy member can effectively improve the expression of keratinocyte silk polyprotein FLG mRNA.* it indicates to use
Dunnett-t check analysis, sample sets have significant difference, i.e. p < 0.05 compared with blank control group.
Fig. 3, increasing liquid energy member can effectively improve the expression of keratinocyte tight junction protein CLDN-1 mRNA.* table
Show that, using Dunnett-t check analysis, sample sets have significant difference, i.e. p < 0.05 compared with blank control group.
Fig. 4, increase liquid energy member and can smooth skin immediately because of the scales of skin that peel off caused by drying.
Fig. 5, increasing liquid energy member can effectively remove ABTS free radical, play antioxidant activity.
Specific embodiment
The present inventor passes through in-depth study, discloses one kind and combines for improving the effective mixture of skin or medicinal material,
It is mainly made of dendrobium nobile, aloe, kuh-seng, smilax, purple coneflower, oat, Radix Ophiopogonis, tremella, by it through suitable preparation side
Method preparation can get the composition for improving skin, it is also known as " increasing liquid energy member " by the present inventor.The composition for
The improvement result of skin is ideal, and the cost of raw material is cheap, is easily obtained, and preparation method is simple.
As used herein, described " increasing liquid energy member " alternatively uses with " composition of the invention ".
As used herein, " improving skin " includes：Alleviate dry skin symptom, moist skin, promote that skin is smooth, reduces
Scaling of skin, the vigor for improving keratinocyte etc..
As used herein, the " comprising " or " containing " include "comprising", " mainly by ... constitute ", " substantially
By ... constitute " and " by ... constitute "；" mainly by ... constitute ", " substantially by ... constitute " and " by ... constitute "
Belong to the subordinate concept of " containing ", " having " or " comprising ".
As used herein, term " effective quantity " refer to people and/or animal can be generated function or it is active and can by people and/
Or the amount that animal is received.
As used herein, the ingredient of term " on cosmeceutical, chemically or biologically acceptable " is to be suitable for people
And/or animal and without excessive bad side reaction (such as toxicity, stimulation and allergy), that is, have reasonable benefit/risk ratio
Substance.
As used herein, term " on cosmeceutical, chemically or biologically acceptable carrier " includes various figurations
Agent, thickener or diluent.The term refers to carriers some in this way：It themselves is not necessary active constituent, and after application
Inexcessive toxicity.Suitable carrier is well known to those of ordinary skill in the art.Liquid can be contained in the carrier, such as
Water, salt water, glycerol and ethyl alcohol.In addition, there is likely to be complementary substance in these carriers, such as filler, lubricant help stream
Agent, wetting agent or emulsifier, corrigent, pH buffer substance etc..
As used herein, " parts by weight " or " parts by weight " are used interchangeably, and the parts by weight can be any one
Fixed indicates weight (such as 1mg, 1g, 2g, 5g or 1kg) with milligram, grams or a kilogram number.For example, one by 1 parts by weight
The composition that component a and 9 parts by weight of component b is constituted, can be a+9 grams of component b of 1 gram of component, is also possible to 10 grams of component a+90
The composition of the compositions such as gram component b.In the composition, degree=(parts by weight/institute of the component of a certain component
Have the sum of the parts by weight of component) × 100%.Therefore, the composition being made of 1 parts by weight of component a and 9 parts by weight of component b
In, the content of component a is 10%, and component b is 90%.
In the present invention, term " mixture " contains dendrobium nobile, aloe, kuh-seng, smilax, purple coneflower, oat, Radix Ophiopogonis, silver
Ear.The dendrobium nobile is preferably HERBA DENDROBII.The aloe is preferably aloe barbadensis Miller.
In the present invention, term " composition " includes but is not limited to：Cosmetic composition, composite skin care product, pharmaceutical composition
Object, as long as they contain the extract of dendrobium nobile, aloe, kuh-seng, smilax, purple coneflower, oat, Radix Ophiopogonis, tremella, preferably
Water extract.
It is as shown in table 1 for preparing the dosage of each raw material of mixture of the invention as preferred embodiment of the invention.
The dosage of component in table 1, mixture
| Content | Preferable content | |
| Dendrobium nobile | 2~4 parts by weight | 2.5~3.5 parts by weight |
| Aloe | 1~3 parts by weight | 1.5~2.5 parts by weight |
| Kuh-seng | 1~3 parts by weight | 1.5~2.5 parts by weight |
| Smilax | 1~3 parts by weight | 1.5~2.5 parts by weight |
| Purple coneflower | 0.5~2.5 parts by weight | 1~2 parts by weight |
| Oat | 0.5~2.5 parts by weight | 1~2 parts by weight |
| Radix Ophiopogonis | 0.5~2.5 parts by weight | 1~2 parts by weight |
| Tremella | 0.5~2.5 parts by weight | 1~2 parts by weight |
, using method effective component extracting appropriate, this hair can be made after processing, crushing, mixing in each raw material
Bright extract；In addition, effective component can also be extracted respectively and (same or different extraction or processing method such as be respectively adopted)
Afterwards, combination system is at composition of the invention.
As preferred embodiment of the invention, the extract is water extract；Preferably, the preparation side of the water extract
Method is：Each component is crushed, is mixed, is extracted 2~6 hours at 70~90 DEG C；Cooling, filtrate is collected in filtering；More preferably, it also carries out
Vacuum refined filtration.It should be understood that having different some alternatives also from this method should be included in the present invention.
It is more to acquire dendrobium nobile, aloe, smilax, kuh-seng, oat, purple coneflower, Radix Ophiopogonis and tremella to composition of the invention
The natural component of kind plant, efficient combination have achieved the effect that improvement skin, including：Alleviate dry skin symptom, moist flesh
Skin promotes that skin is smooth, reduce scaling of skin, the vigor for improving keratinocyte etc..
Composition of the invention can also improve the expression of keratinocyte aquaporin AQP3.AQP3 is a kind of thin
Transmembrane transporter on after birth is most important a kind of aquaporin hypotype in human skin, it belongs to water-glycerol channel
Albumen subfamily.In the physiology course of skin, AQP3 can transport water, glycerol reaches epidermis, barrier action to epidermis and
Water retention is significant.In an embodiment of the present invention, using immunofluorescence technique, assessment increases liquid energy member and is formed to cutin
The influence of cell synthesis AQP3 ability.Immunofluorescence technique is the principle combined using antigen and antibody, Human Keratinocytes
AQP3 carries out fluorescent marker, and the fluorescence intensity of generation and the synthetic quantity of target protein are directly proportional, and combination of the invention is as a result presented
Object effectively increases the expression of AQP3.
Composition of the invention can also improve the expression of keratinocyte silk polyprotein FLG (Filaggrin).Cuticula
In there is natural moisturizing factor (Natural Moisturizing Factor, NMF), there is water absorption character, can effectively inhale
Moisture is received and locks, cooperation protection horn cell structure strengthens water lock barrier.Natural moisturizing factor NMF is gathered by silk in epidermis
Albumen (Filaggrin) is decomposed to form.Filaggrin is present in cuticula, and precursor silk polyprotein is former
(Profilaggrin) it is present in stratum granulosum, after cell reaches cuticula from stratum granulosum, Profilaggrin is by Caspase-
14 rapid dephosphorylations become Filaggrin, and then are hydrolyzed into various natural moisturizing factor.It can be seen that Filaggrin pairs
The formation of natural moisturizing factor has key effect in cuticula.
Composition of the invention can also improve the expression of tight junction protein CLDN-1.Tight junction protein in stratum granulosum
Have the function of maintaining barrier, wherein sluice albumen (Claudin-1) is its important composition, connects cell tight as rivet
It connects.Studies have shown that the expression of sluice albumen declines, the lost increase of skin moisture will lead to.By improving silk polyprotein and sluice
The effect of expression of albumen can be played and repair skin barrier function, reduce moisture loss.
For composition of the present invention, a variety of any dosage forms suitable for external application can be prepared to for example, described
Dosage form can be selected from：Gelling agent, emulsion, solution, aerosol, powder agent, granule, capsule or suspension.
Required various conventional carriers or auxiliary material when preparing different dosage forms can be added in composition of the invention, such as fill out
Fill agent, corrigent, antioxidant or coating material etc..
New discovery based on the present inventor additionally provides a kind of combination, which includes 2~4 parts by weight of dendrobium nobile；Aloe 1
~3 parts by weight；1~3 parts by weight of kuh-seng；1~3 parts by weight of smilax；0.5~2.5 parts by weight of purple coneflower；Oat 0.5~
2.5 parts by weight；0.5~2.5 parts by weight of Radix Ophiopogonis；With 0.5~2.5 parts by weight of tremella.
As preferred embodiment of the invention, in the combination, each component is independently packaged in bag, box or various other appearances
In device.The combination can be a kind of kit, packing box, packaging bag, minaudiere etc..Kit of the invention, packaging
In box, packaging bag or minaudiere, it can also be directly loadable into the extract of above-mentioned each raw material, in order to use.Reagent of the invention
In box, packing box, packaging bag or minaudiere, composition of the invention can also be directly loadable into.
In the kit, packing box, packaging bag or minaudiere, it may also include specification, which illustrate each groups
The application method divided, for example including extracting method, extraction time etc..
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or
According to the normal condition proposed by manufacturer.
Embodiment 1, the preparation for increasing liquid energy member
It is used to prepare the raw material composition ratio such as table 2 for increasing liquid energy member.
Table 2
The preparation method for increasing liquid energy member is as follows：
(1) bulk pharmaceutical chemicals are obtained according to the formula of table 2, each bulk pharmaceutical chemicals is crushed, crossed 6 meshes, claim by above-mentioned weight
It takes, mixes.
(2) extracting in water：The mass ratio of bulk pharmaceutical chemicals and water is 1:40,80 DEG C are extracted 4 hours to obtain extracting solution.
(3) extracting solution that step (2) obtains is cooled to 60 DEG C hereinafter, 20 mesh filter-cloth filterings, collect filtrate.
(4) filtrate obtained step (3) carries out vacuum refined filtration, collect filtrate to get.Vacuum filtration condition can be：
Filter board is spread in Buchner funnel, cardboard average pore size is 1.0 μm, and vacuum degree is -0.095MPa.
According to formula 1~3, filtrate obtained is to increase liquid energy member 1~3.
Embodiment 2 increases the influence that liquid energy member expresses keratinocyte aquaporin AQP3
In the present embodiment, the assessment for increasing liquid energy member 1 and carrying out effect prepared with the formula 1 in table 1 is used first.
(1) the MTT detection based on keratinocyte
8 concentration gradients are arranged in sample, and 8 multiple holes, experimental setup solvent control hole and zeroing is arranged in each concentration gradient
Hole (blank control), using MTT cytoactive detection method, maximum safe dose of the screening sample in keratinocyte.
Cell inoculation：96 orifice plates are seeded to after logarithmic growth phase cell dissociation.
Sample preparation：Prepare the sample of different dosing dosage：2000ppm,1000ppm,500ppm, 250ppm,
125ppm、62.5ppm、31.3ppm、15.6ppm。
Administration：When plating cells rate reaches 40%, start to be administered.
Culture：After the completion of administration, culture plate is placed on to the CO of 37 DEG C, 5%2It is cultivated in incubator.
Detection：After cell incubation culture for 24 hours, supernatant is discarded, the MTT prepared in advance is added, 37 DEG C are protected from light incubation.It is abandoned after 4h
Fall supernatant, every hole adds 150 μ L dimethyl sulfoxides, and microplate reader 490nm reads OD value.
Calculation formula is as follows：
Under different dosing dosage, test show that the dosage of 500ppm is ideal.
(2) based on the Immunofluorescence test of keratinocyte
Inoculation：With 3 × 104The cell-seeding-density in a/hole is seeded in 24 orifice plates containing coverslip, and 37 DEG C, 5%
CO2Incubator is incubated overnight.
With liquid：Prepare tested material concentration 500ppm (test gained is detected according to MTT).
Administration：When plating cells rate reaches 30% in 24 orifice plates, it is administered.
Receive sample：After being incubated for culture, discards culture solution PBS and clean 3 times, 4% paraformaldehyde room temperature fixed 30min, 4 DEG C
Refrigerator saves.
Immunofluorescence test：After carrying out the operations such as penetrating, closing to cell, anti-AQP3 antibody is according to 1:500 work is dense
Degree is incubated for, and immunofluorescence dyeing is carried out.
It takes pictures：It takes pictures under 40 times of mirrors of laser confocal microscope.
Experimental result：
Test is taken pictures using fluorescence microscope, and wherein AQP3 protein expression situation is shown in green fluorescence part, test
The result is shown in Figure 1, visible negative control does not observe green fluorescence part substantially in figure, and increases liquid energy member and then exist significantly
Green fluorescence distribution.
The result shows that the expression of keratinocyte aquaporin AQP3 can be effectively improved by increasing liquid energy member.
Using same method, it is different in increase 3 replacement of liquid energy member and increase liquid energy member 1, as a result, experimental group increases liquid
After energy element processing, the visible apparent green fluorescence distribution of fluorescence microscopy can effectively improve keratinocyte aquaporin
The expression of albumin A QP3.
Embodiment 3 increases the influence that liquid energy member expresses silk polyprotein FLG and tight junction protein CLDN-1 mRNA
In the present embodiment, the assessment for increasing liquid energy member 1 and carrying out effect prepared with the formula 1 in table 1 is used.
By constructing model of keratinocytes, is analyzed using qRT-PCR method and increase liquid energy member Human Keratinocytes
The influence of silk polyprotein FLG and tight junction protein CLDN-1mRNA expression.
(1) the MTT detection based on keratinocyte
8 concentration gradients are arranged in sample, and 8 multiple holes, experimental setup solvent control hole and zeroing is arranged in each concentration gradient
Hole, using MTT cytoactive detection method, maximum safe dose of the screening sample in keratinocyte.
Cell inoculation：96 orifice plates are seeded to after logarithmic growth phase cell dissociation.
Sample preparation：Prepare the sample of different dosing dosage：2000ppm,1000ppm,500ppm, 250ppm,
125ppm、62.5ppm、31.3ppm、15.6ppm。
Administration：When plating cells rate reaches 40%, start to be administered.
Culture：After the completion of administration, culture plate is placed on to the CO of 37 DEG C, 5%2It is cultivated in incubator.
Detection：After cell incubation culture for 24 hours, supernatant is discarded, the MTT prepared in advance is added, 37 DEG C are protected from light incubation.It is abandoned after 4h
Fall supernatant, every hole adds 150 μ L dimethyl sulfoxides, and microplate reader 490nm reads OD value.
Calculation formula：
Under different dosing dosage, test show that the dosage of 500ppm is ideal.
(2) based on the fluorescence quantitative PCR detection of keratinocyte
Inoculation：With 1.8 × 105In the cell-seeding-density inoculation 6 orifice plates in a/hole, 37 DEG C, 5%CO2Incubator was incubated for
Night.
With liquid：Prepare tested material concentration 500ppm (test gained is detected according to MTT).
Administration：When plating cells rate reaches 40% in 6 orifice plates, it is administered.
Culture：After the completion of administration, culture plate is placed on to the CO of 37 DEG C, 5%2It is cultivated in incubator.
Receive sample：After being incubated for culture, discards the every hole of culture solution and 1mL Trizol is added, after blowing and beating lytic cell, receive sample.
PCR detection：RNA is extracted, after reverse transcription is at cDNA, carries out fluorescence quantitative PCR detection.
PCR primer sequence is：
For keratinocyte silk polyprotein FLG mRNA：
The end F：GGAATTTCGGCAAATCCTGA(SEQ ID NO:1)；
The end R：TGCTTGAGCCAACTTGAATACCA(SEQ ID NO:2)；
For tight junction protein CLDN-1mRNA：
The end F：GCATGAAGTGTATGAAGTGCTTGGA(SEQ ID NO:3)；
The end R：CCATACCATGCTGTGGCAACTAA(SEQ ID NO:4).
Interpretation of result：Using 2-△△CTMethod carries out result calculating, and T-Test (examined by F by the variances such as double tails, homogeneity of variance
Test and have verified that) method is for statistical analysis.
Experimental result：
The above model of keratinocytes is constructed, is analyzed using qRT-PCR method and increases liquid energy member Human Keratinocytes
The influence of silk polyprotein FLG and tight junction protein CLDN-1mRNA expression.As a result such as Fig. 2~Fig. 3, show that increasing liquid energy member can
Effectively improve the expression of keratinocyte silk polyprotein FLG and tight junction protein CLDN-1mRNA.
Embodiment 4 increases influence of the liquid energy member for skin
VC98, full name are skin macroscopic surface activity analysis systems, German CK company production.It is set according to optical principle
Meter, with the texture image of test probe shooting skin surface under the irradiation of UVA light source, black-and-white video signal is input to test
It is handled, then is input in computer in the digitizer of system, with dedicated viable skin surface assessment software to image
It is analyzed, so that it may obtain related parameter values related with wrinkle of skin.Meanwhile it can also be used for skin keratin cast-off cells
And inspection and analysis.
Firstly, carrying out the assessment of effect to increasing liquid energy member.Experiment is divided into two groups, and experimental group is 5% (mass ratio) of addition
Increase the gel of liquid energy member 1；Control group is blank gel matrix.The gel matrix is conventional substrate.
Test ambient temperature and humidity：20~22 DEG C of temperature, relative humidity 40~60%.Gel is applied to outside subject's shank
Side.Using skin macroscopic surface activity analysis system (VC98, German CK company production) it is used as skin test
Instrument, test subject use the skin scales of skin that peel off (cutin falls off) situation after experimental group and control group gel.
Experimental result：
Using skinanalysis apparatus (VC98), assessment subject uses the increasing liquid energy member front and back skin scales of skin that peel off
Improvement situation, white represents the cutin peeled off in image, and test result is shown in Fig. 4.The result shows that experimental group test zone is smeared
After the gel 4h for increasing liquid energy member containing 5% (mass ratio), the scales of skin that peel off state of skin is relative to (the Fig. 4 that is significantly improved before smearing
On)；And blank group test zone, after smearing blank gel matrix 4h, skin has evaporated bits state because of the moisture in gel matrix
Before smearing more serious (under Fig. 4).Illustrate that skin can be smoothed because of the scales of skin that peel off caused by drying immediately by increasing liquid energy member, be moistened
Skin.
Using same method, it is different in increase 2 replacement of liquid energy member and increase liquid energy member 1, the results show that experimental group
After test zone smears the gel 4h for increasing liquid energy member containing 8% (mass ratio), the scales of skin that peel off state of skin is preceding relative to smearing to be also in
Now significantly improve.
Embodiment 5 increases liquid energy member removing ABTS free radical, oxidation resistant effect
Experimental principle：
ABTS method measurement total antioxidant capacity principle be：ABTS is oxidized to green under oxidant appropriate effect
ABTS+, the generation of ABTS+ can be suppressed in the presence of polyphenoils, in the absorbance of 732nm or 405nm measurement ABTS
It can measure and calculate the total antioxidant capacity of sample.
Experimental method：
1) prepare evaluation sample 0.01mL, be incubated at room temperature 10 minutes.Then, the ethanol solution of ABTS is added
(0.1mM) 1mL is incubated at room temperature after twenty minutes, utilizes the absorbance A under spectrophotometric determination 732nm；
2) prepare 50% ethyl alcohol (volume fraction, similarly hereinafter) 0.01mL, be incubated at room temperature 10 minutes.Then, ABTS is added
50% ethanol solution (0.1mM) 1mL, be incubated at room temperature after twenty minutes, utilize the extinction under spectrophotometric determination 732nm
Spend B；
3) prepare evaluation sample 0.01mL, be incubated at room temperature 10 minutes.Then, 50% ethyl alcohol 1mL is added, at room temperature
It is incubated for after twenty minutes, utilizes the absorbance C under spectrophotometric determination 732nm.ABTS free radical scavenging activity calculation formula is as follows：
In formula：
A is OD value after sample solution is mixed with ABTS solution；
B is OD value after 50% ethyl alcohol is mixed with ABTS solution；
C is OD value after 50% ethyl alcohol is mixed with sample solution.
Experimental result：
As a result such as Fig. 5, show that increasing liquid energy member has removing ABTS free radical activity, in certain concentration range, with
The increase of tested concentration, it is bigger to the clearance rate of ABTS free radical.Result explanation, increase liquid energy member has in biochemistry level
Significant antioxidant activity.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Claims (10)
1. a kind of mixture, which is characterized in that the mixture includes following components：
2. a kind of for improving the composition of skin, which is characterized in that the composition contains water extract, and the water extract is by weighing
Benefit require 1 described in mixture via water extract obtain；Or
In the mixture, the dendrobium nobile is HERBA DENDROBII.
3. composition as claimed in claim 2, which is characterized in that the preparation method of the water extract is：To claim 1
Component processed, crush the component through processing, mix, 70~90 DEG C extract 2~6 hours；Cooling, filter is collected in filtering
Liquid；More preferably, vacuum refined filtration is also carried out, condition is：Filter board average pore size be 1.0 ± 0.2 μm, vacuum degree be -0.095 ±
0.02MPa。
4. the composition as described in claim 2~3 is any, which is characterized in that the composition further includes：Cosmeceutical
Upper, chemically or biologically acceptable carrier；Preferably, the water extract accounts for the 1~99% of composition total weight.
5. composition as claimed in claim 4, which is characterized in that the dosage form of the composition includes：Gelling agent, emulsion,
Solution, aerosol, powder agent, granule, capsule or suspension.
6. the purposes of mixture described in claim 1 is used to prepare the composition for improving skin；Preferably, the improvement
Skin includes：Moist skin reduces the skin scales of skin that peel off；Or
It is used to prepare the composition for improving the expression of keratinocyte aquaporin AQP3；Or
It is used to prepare the composition for improving the expression of keratinocyte silk polyprotein FLG；Or
It is used to prepare the composition for improving the expression of tight junction protein CLDN-1；Or
It is used to prepare and effectively removes ABTS free radical, the composition with antioxidant activity.
7. as claimed in claim 2 for improving the preparation method of the composition of skin, which is characterized in that the method includes：
(1) following components is provided：
Preferably, the dendrobium nobile application HERBA DENDROBII；
(2) component for processing, crushing (1), mixes, and carries out water extraction；Preferably, being extracted 2~6 hours at 70~90 DEG C；It is cooling,
Filtrate is collected in filtering.
8. preparation method as claimed in claim 7, which is characterized in that the method also includes：Carry out vacuum refined filtration, condition
For：Filter board average pore size is 1.0 ± 0.2 μm, and vacuum degree is -0.095 ± 0.02MPa.
9. a kind of kit, which is characterized in that including following components, extract in the kit, or contain its extraction
The composition of object：
Preferably, the dendrobium nobile is HERBA DENDROBII.
10. kit as claimed in claim 8, which is characterized in that the composition containing its extract is wanted for right
Seek 2~3 any compositions.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811000629.0A CN108852978A (en) | 2018-08-30 | 2018-08-30 | Improve composition, its preparation process and the application of skin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811000629.0A CN108852978A (en) | 2018-08-30 | 2018-08-30 | Improve composition, its preparation process and the application of skin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108852978A true CN108852978A (en) | 2018-11-23 |
Family
ID=64322300
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811000629.0A Pending CN108852978A (en) | 2018-08-30 | 2018-08-30 | Improve composition, its preparation process and the application of skin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108852978A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111067851A (en) * | 2020-01-17 | 2020-04-28 | 云南白药集团股份有限公司 | Preparation method of tricholoma matsutake mask liquid |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103610615A (en) * | 2013-12-04 | 2014-03-05 | 上海相宜本草化妆品股份有限公司 | Preparation method for glabrous greenbrier rhizome extract and use of glabrous greenbrier rhizome extract for skin whitening |
| CN103767973A (en) * | 2014-01-26 | 2014-05-07 | 北京工商大学 | Externally applied skin caring composition with three-dimensional water replenishing and three-dimensional moisturizing effects and preparation method and application thereof |
| CN104414895A (en) * | 2013-08-23 | 2015-03-18 | 无限极（中国）有限公司 | Plant composition with moisturizing, anti-wrinkle and irritability-relieving effect and preparation method thereof |
| CN107137250A (en) * | 2017-05-12 | 2017-09-08 | 广州娇漾生物科技有限公司 | A kind of moisturizing anti-ageing face mask containing carboxymethylpachymaran |
| CN107789282A (en) * | 2017-11-22 | 2018-03-13 | 天津市蓝宝石化妆品有限公司 | A kind of skin care item containing dendrobium candidum extract and plant whitening element and its preparation method and application |
-
2018
- 2018-08-30 CN CN201811000629.0A patent/CN108852978A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104414895A (en) * | 2013-08-23 | 2015-03-18 | 无限极（中国）有限公司 | Plant composition with moisturizing, anti-wrinkle and irritability-relieving effect and preparation method thereof |
| CN103610615A (en) * | 2013-12-04 | 2014-03-05 | 上海相宜本草化妆品股份有限公司 | Preparation method for glabrous greenbrier rhizome extract and use of glabrous greenbrier rhizome extract for skin whitening |
| CN103767973A (en) * | 2014-01-26 | 2014-05-07 | 北京工商大学 | Externally applied skin caring composition with three-dimensional water replenishing and three-dimensional moisturizing effects and preparation method and application thereof |
| CN107137250A (en) * | 2017-05-12 | 2017-09-08 | 广州娇漾生物科技有限公司 | A kind of moisturizing anti-ageing face mask containing carboxymethylpachymaran |
| CN107789282A (en) * | 2017-11-22 | 2018-03-13 | 天津市蓝宝石化妆品有限公司 | A kind of skin care item containing dendrobium candidum extract and plant whitening element and its preparation method and application |
Non-Patent Citations (1)
| Title |
|---|
| 张卫明等: "《一带一路经济植物》", 30 November 2017, 东南大学出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111067851A (en) * | 2020-01-17 | 2020-04-28 | 云南白药集团股份有限公司 | Preparation method of tricholoma matsutake mask liquid |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106038351B (en) | It is a kind of for desalinating the peptide composition of wrinkle | |
| Thakur et al. | Practices in wound healing studies of plants | |
| CN102406576B (en) | Prinsepia utilis Royle oil-containing functional skin care product and preparation method thereof | |
| CN109316478A (en) | The application and drug, cosmetics of a kind of urolithin A in the drug, cosmetics of preparation anti-aging | |
| CN110538111B (en) | Composition and application thereof in preparation of skin product for caring skin of person staying up at night | |
| CN108852978A (en) | Improve composition, its preparation process and the application of skin | |
| CN110013558A (en) | A kind of transparent patch and preparation method thereof | |
| CN112438898B (en) | Cosmetic composition for moisturizing skin and improving skin barrier comprising electrolyte material | |
| Becker et al. | Cutaneous mast cell heterogeneity: response to antigen in atopic dogs | |
| Ugoeze et al. | Evaluation of the wound healing potentials of aqueous topical creams containing aqueous extract of Azadirachta indica leaves as bioactive ingredient | |
| CN113940909B (en) | Composition for regulating circadian rhythm and application thereof | |
| KR101480696B1 (en) | Cosmetic composition containing extracts of Adenophora triphylla var. japonica Hara, Angelica tenuissima and crude drugs | |
| JP2023062016A (en) | Agents for improving skin barrier function worsened due to stress | |
| Mehregan et al. | Generalized follicular hamartoma: complicated by multiple proliferating trichilemmal cysts and palmar pits | |
| CN109381375A (en) | A kind of scalp care essential oil composition and application | |
| CN108338950A (en) | With stablizing the anti-apolexis composition and application thereof for being adhered effect between epidermis and corium | |
| CN114788795A (en) | Acne-removing composition and preparation method and application thereof | |
| KR20120019769A (en) | Cosmetic composition for removal the dead skin cell | |
| TWI225410B (en) | Use of vitamin C or analogues to increase the level of differentiation and/or proliferation of skin cells | |
| CN111979289A (en) | Cytological evaluation method for resistance of plant extracts to skin chemical stimulation and application of cytological evaluation method | |
| CN110354209A (en) | Dendrobium candidum protocorm is to skin nti-freckle and the method for repairing drug action | |
| Dethier | Prothoracic glands of adult Lepidoptera | |
| CN115317561B (en) | Plant extract, skin external preparation, and preparation method and application thereof | |
| CN109330917A (en) | A kind of essential oil composition having both whitening anti-aging moisture-keeping efficacy and application | |
| Diadora et al. | Potential Effect of Avena sativa’s Cream on Skin Hydration |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181123 |
|
| RJ01 | Rejection of invention patent application after publication |