CN108841883A - A kind of method of biological enzyme conversion production Beta-alanine and D-Asp - Google Patents
A kind of method of biological enzyme conversion production Beta-alanine and D-Asp Download PDFInfo
- Publication number
- CN108841883A CN108841883A CN201810629645.XA CN201810629645A CN108841883A CN 108841883 A CN108841883 A CN 108841883A CN 201810629645 A CN201810629645 A CN 201810629645A CN 108841883 A CN108841883 A CN 108841883A
- Authority
- CN
- China
- Prior art keywords
- aspartic acid
- alanine
- obtains
- beta
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/20—Aspartic acid; Asparagine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01011—Aspartate 1-decarboxylase (4.1.1.11)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to enzyme technology field, in particular to a kind of method of biological enzyme conversion production Beta-alanine and D-Asp.The method or yield that Beta-alanine and D-Asp are synthesized for existing biological enzyme are too low or must manually add solid substrate incessantly in biotransformation, are all unsuitable for industrialized problem, the technical scheme is that：Include the following steps：[1] it carries out high density fermentation and obtains the colibacillus engineering for being overexpressed L-Aspartic acid decarboxylase；[2] bioconversion is carried out by substrate of DL- aspartic acid using colibacillus engineering, stream plus DL- aspartic acid sodium solution carry out adding substrate in the conversion process, transformation system pH is controlled by stream plus DL- aspartic acid HCI solution simultaneously, obtains Beta-alanine and D-Asp.Substrate, which is replaced with L-Aspartic acid, separately synthesized to obtain Beta-alanine.The present invention is suitable for the synthesis of Beta-alanine and D-Asp.
Description
Technical field
The invention belongs to enzyme technology field, in particular to a kind of biological enzyme conversion production Beta-alanine and D- asparagus fern
The method of propylhomoserin.
Background technique
Beta-alanine also known as β-type alanine are a kind of unique existing β type amino acid of nature, are mainly used in
The fields such as food, medicine and chemical industry.Food additives are mainly used in terms of food；Synthesis is mainly used in terms of medicine
Inhibit the pamidronate disodium and anti-colonic drug Balsalazide of bone metastaes；It is mainly used for synthetic pantothenic acid calcium and flesh in terms of chemical industry
Peptide etc..D-Asp is a kind of important chipal compounds, mainly with the synthesis of prodrug and intermediate, such as N- first
Base-D-Asp sodium, aspoxicillin and D-Asp-β-azanol etc.；It may also participate in some antibiotic (the interior acyls of such as β-of synthesis
Amine antibiotic) side chain improve the activity of antibiotic.In the food industry, new food additive and preservative be can be used as
Synthesis material.
The synthetic method of Beta-alanine and D-Asp mainly has chemical synthesis and biological enzyme synthesis at present.(1)
The method of chemical synthesis Beta-alanine is that acrylonitrile and ammonium hydroxide are passed through aminating reaction is raw at home mainly based on acrylonitrile method
At β-aminopropionitrile, Beta-alanine then is obtained in alkalinity or hydrolyzed under acidic conditions.This method raw material is cheap, at low cost, but
With side reaction, and a large amount of inorganic salts can be generated in hydrolytic process, post processing cost is high.And D-Asp is main
Based on chemical asymmetric fractionation, industry is complicated, and product optical purity is low.(2) biological enzyme is synthesized since reaction condition is mild,
The features such as Substratspezifitaet is strong and environmental-friendly is by higher concern.Patent NO.CN 101210230A is disclosed with overexpression enzyme
L-Aspartic acid-α-decarboxylase engineering bacteria derived from Escherichia coli itself carries out biosynthesis Beta-alanine, and yield is
2.94g/L, low output can not carry out industrialized production.Patent CN1.3898035B discloses a kind of method for producing Beta-alanine,
By constructing the recombinant escherichia coli strain containing the aspartic acid -1- decarboxylase from corynebacterium glutamicum and lacking
Aspartic acid amino lyase gene so that substrate be completely used for synthesis Beta-alanine, the substrate transformation rate up to 90% or more, but
During bioconversion, substrate is to add in solid form to control the pH of transformation system, it is meant that in mass production mistake
It constantly carries out adding substrate in journey, increase the labor intensity of worker and cannot accurately control pH.Production by Enzymes D- asparagus fern ammonia
Acid has asymmetric degradation method (clear 56-20753), using DL- aspartic acid is substrate by decomposing L- days using Candida
Aspartic acid obtains D-Asp；102443612 A of patent CN is with DL- aspartic acid with L-Aspartic acid-β-decarboxylase
Substrate carries out production D-Asp and alanine.PH is equally controlled with DL- aspartic acid in the conversion process, is operated heavy
(uninterrupted) and it cannot accurately control pH.In conclusion the side of existing biological enzyme synthesis Beta-alanine and D-Asp
Method or yield are too low or must manually add solid substrate incessantly in biotransformation, are all unsuitable for work
Industry.
Summary of the invention
The method or yield that Beta-alanine and D-Asp are synthesized for existing biological enzyme are too low or in life
Solid substrate must be manually added in object conversion process incessantly, is all unsuitable for industrialized problem, the present invention provides one
The method of kind biological enzyme conversion production Beta-alanine and D-Asp, its object is to：Substrate is realized in the conversion process
Automatically it adds and pH can be controlled with automatic and accurate, ensure that the optimal pH condition of enzyme, saved a large amount of manpowers, be advantageously implemented life
The industrialized production of object method synthesis Beta-alanine and D-Asp.
The technical solution adopted by the present invention is as follows：
A kind of method of biological enzyme conversion production Beta-alanine, which is characterized in that include the following steps：
[1] building is overexpressed L-Aspartic acid-α-decarboxylase recombination bacillus coli, and carries out high density fermentation and obtained
Express the colibacillus engineering of L-Aspartic acid decarboxylase；
[2] bioconversion is carried out by substrate of L-Aspartic acid using the colibacillus engineering that step [1] obtains, turned
Stream plus L-Aspartic acid sodium solution carry out adding substrate during changing, and control transformation system with L-Aspartic acid HCI solution
PH is 6.0-7.0, obtains Beta-alanine.
After the technical solution, substrate is mended with liquid solution by certain flow rate in the conversion process
Add, easy to operate, pH may be implemented accurately to control, and maintains reaction system in optimal pH, ensure that L-Aspartic acid-pyruvate decarboxylase
Human cost is greatly saved compared with having reported add substrate in technique with substrate solid form at present in activity, is conducive to
Realize the industrialized production of bioanalysis synthesis Beta-alanine.
Preferably, the method for building overexpression L-Aspartic acid-α-decarboxylase recombination bacillus coli includes in step [1]
Following steps：
[1-1] carries out gene codon optimization, Quan Ji to bacillus subtilis L-Aspartic acid-α-decarboxylase gene sequence
Because synthesis both ends carry L-Aspartic acid-α-decarboxylase gene sequence of NdeI and XhoI restriction endonuclease sites, will synthesize
L-Aspartic acid-α-decarboxylase gene sequence be cloned on pUC57 carrier, obtain pUC57-PanD plasmid；
The pUC57-panD plasmid and expression vector pET32a that [1-2] is obtained with NdeI and XhoI double digestion step [1-1]
Digestion products pET32a (+) and panD segment are then attached with T4 ligase by (+) plasmid, and connection product is transformed into gram
Grand bacterial strain DH5 α, screening obtain positive recombinant, and extracting bacterium solution obtains recombinant plasmid pET32a-panD；
The recombinant plasmid pET32a-panD that step [1-2] obtains is transferred to Escherichia coli by heat shock method by [1-3]
In Rosetta, screening positive recombinant is the recombination bacillus coli obtained for producing Beta-alanine and D-Asp.
Known existing Beta-alanine biosynthesis conversion process requires to add coenzyme PLP (pyridoxime 5-phosphate) that enzyme process is urged afterwards
Changing reaction just can be carried out, i.e., L-Aspartic acid-α-decarboxylase is PLP dependent form.The exploitation of this preferred embodiment is used to produce β-the third
The β-that the recombination bacillus coli of propylhomoserin and D-Asp is obtained with high yield without adding coenzyme PLP in bioconversion
Alanine greatly reduces fermentation costs.
Preferably, high density fermentation is carried out in step [1] obtain the Escherichia coli work for being overexpressed L-Aspartic acid decarboxylase
The method of journey bacterium includes the following steps：
[1-4] aseptically, by 0.1%~1% inoculum concentration will be overexpressed L-Aspartic acid-α-decarboxylase weight
Group Escherichia coli culture transferring is into primary-seed medium, and culture is to OD600 under conditions of 37 DEG C of temperature, revolving speed 220rpm
3.0~4.0, stop culture and obtains first order seed bacterium solution；
The first order seed bacterium solution that [1-5] obtains step [1-4] is by 4%~10% inoculum concentration switching secondary seed medium
In, 3~5h is cultivated under conditions of 37 DEG C of temperature, revolving speed 220rpm, obtains secondary seed bacterium solution；
[1-6] is transferred by the secondary seed bacterium solution that 1%~8% inoculum concentration obtains step [1-5] by flame inoculation
Enter in fermentor, setting Preliminary fermentation parameter is：37 DEG C of temperature, revolving speed 200rpm, pH=7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；Dissolved oxygen is controlled 20%~40% by adjusting revolving speed and ventilatory capacity as bacteria concentration is gradually increased；Until dissolved oxygen
When quickly increasing simultaneously with pH value, start flow feeding；When OD600 reaches 20~25,28 DEG C are first cooled the temperature to, addition
Inducer puts tank after continuing fermentation 12h~15h；Low-temperature centrifugation is collected thallus and is refrigerated stand-by.
Preferably, the detailed process of step [2] is：
Setting starting reaction system is 0.4 volume, and reaction system is made to contain 0.2mol/L L-Aspartic acid and 0.1mol/L
Natrium carbonicum calcinatum, 5% thallus, pH 6.5；Conversion condition is 37 DEG C of temperature, revolving speed 200rpm, with 0.3 volume in conversion process
L-Aspartic acid HCI solution adjusts pH=6.0-7.0；After converting 2h, 0.3 volume is added with the flow velocity stream of 60mL~200mL/h
L-Aspartic acid sodium solution convert 14h~36h when stop reaction.
After the technical solution, thallus used in the biotransformation of step [2] is recyclable to carry out secondary use,
Be conducive to save the cost.
The present invention also provides a kind of methods that biological enzyme converts production Beta-alanine and D-Asp, including walk as follows
Suddenly：
[1] it carries out high density fermentation and obtains the colibacillus engineering for being overexpressed L-Aspartic acid decarboxylase；
[2] bioconversion is carried out by substrate of DL- aspartic acid using the colibacillus engineering that step [1] obtains,
Stream plus DL- aspartic acid sodium solution carry out adding substrate in conversion process, while passing through stream plus DL- aspartic acid HCI solution
Control transformation system pH is 6.0-7.0, obtains the mixture of Beta-alanine and D-Asp, β-the third ammonia is respectively obtained after separation
Acid and D-Asp product.
After the technical solution, substrate is mended with liquid solution by certain flow rate in the conversion process
Add, easy to operate, pH may be implemented accurately to control, and maintains reaction system in optimal pH, ensure that L-Aspartic acid-pyruvate decarboxylase
Human cost is greatly saved compared with having reported add substrate in technique with substrate solid form at present in activity, is conducive to
Realize the industrialized production of bioanalysis synthesis Beta-alanine and D-Asp.
Preferably, the method for building overexpression L-Aspartic acid-α-decarboxylase recombination bacillus coli includes in step [1]
Following steps：
[1-1] optimizes bacillus subtilis L-Aspartic acid-α-decarboxylase gene sequence, and full genome synthesizes both ends
L-Aspartic acid-α-decarboxylase gene the sequence for carrying NdeI and XhoI restriction endonuclease sites, by the L- asparagus fern ammonia of synthesis
Acid-α-decarboxylase gene sequence is cloned on pUC57 carrier, obtains pUC57-PanD plasmid；
The pUC57-panD plasmid and expression vector pET32a that [1-2] is obtained with NdeI and XhoI double digestion step [1-1]
Digestion products pET32a (+) and panD segment are then attached with T4 ligase by (+) plasmid, and connection product is transformed into gram
Grand bacterial strain DH5 α, screening obtain positive recombinant, and extracting bacterium solution obtains recombinant plasmid pET32a-panD；
The recombinant plasmid pET32a-panD that step [1-2] obtains is transferred to Escherichia coli by heat shock method by [1-3]
In Rosetta (DE3), screening positive recombinant is the recombination large intestine bar obtained for producing Beta-alanine and D-Asp
Bacterium.
Preferably, high density fermentation is carried out in step [1] obtain the Escherichia coli work for being overexpressed L-Aspartic acid decarboxylase
The method of journey bacterium includes the following steps：
[1-4] aseptically, by 0.1%~1% inoculum concentration will be overexpressed L-Aspartic acid-α-decarboxylase weight
Group Escherichia coli culture transferring is into primary-seed medium, and culture is to OD600 under conditions of 37 DEG C of temperature, revolving speed 220rpm
3.0~4.0, stop culture and obtains first order seed bacterium solution；
The first order seed bacterium solution that [1-5] obtains step [1-4] is by 4%~10% inoculum concentration switching secondary seed medium
In, 3~5h is cultivated under conditions of 37 DEG C of temperature, revolving speed 220rpm, obtains secondary seed bacterium solution；
[1-6] is transferred by the secondary seed bacterium solution that 1%~8% inoculum concentration obtains step [1-5] by flame inoculation
Enter in fermentor, setting Preliminary fermentation parameter is：37 DEG C of temperature, revolving speed 200rpm, pH=7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；Dissolved oxygen is controlled 20%~40% by adjusting revolving speed and ventilatory capacity as bacteria concentration is gradually increased；Until dissolved oxygen
When quickly increasing simultaneously with pH value, start flow feeding；When OD600 reaches 20~25,28 DEG C are first cooled the temperature to, addition
Inducer puts tank after continuing fermentation 12h~15h；Low-temperature centrifugation is collected thallus and is refrigerated stand-by.
Preferably, the detailed process of step [2] is：
Setting starting 0.4 volume of reaction system, makes reaction system contain 0.2mol/L DL- aspartic acid and 0.1mol/L
Natrium carbonicum calcinatum, 5% thallus, pH to 6.5；Conversion condition is 37 DEG C of temperature, revolving speed 200rpm, with 0.3 volume in conversion process
DL- aspartic acid HCI solution adjust maintain pH=6.5；After converting 2h, add 0.3 with the flow velocity stream of 60mL~200mL/h
The DL- aspartic acid sodium solution of volume stops reaction when converting 20h~28h.
In conclusion by adopting the above-described technical solution, the beneficial effects of the invention are as follows：
1. substrate is added with liquid solution by certain flow rate in the conversion process, easy to operate, pH
It may be implemented accurately to control, maintain reaction system in optimal pH, ensure that L-Aspartic acid-pyruvate decarboxylase activity, and at present
Comparing for substrate is added with substrate solid form in report technique, human cost is greatly saved, is advantageously implemented bioanalysis conjunction
At the industrialized production of Beta-alanine and D-Asp.
2. in preferred embodiment for produce the recombination bacillus coli of Beta-alanine and D-Asp in bioconversion without
The Beta-alanine that coenzyme PLP is obtained with high yield need to be added, fermentation costs are greatly reduced.
3. thallus used in biotransformation is recyclable to carry out secondary use, be conducive to save the cost.
Detailed description of the invention
Examples of the present invention will be described by way of reference to the accompanying drawings, wherein：
Fig. 1 is the Vector map of recombinant plasmid pET32a-PanD in the present invention；
Fig. 2 is that recombinant protein L-Aspartic acid-α-decarboxylase SDS-PAGE protein electrophoresis detects in the present invention
Figure；
Fig. 3 is the high-efficient liquid phase chromatogram of Beta-alanine standard sample；
Fig. 4 is the high-efficient liquid phase chromatogram of the Beta-alanine sample prepared by the method for the invention.
Specific embodiment
All features disclosed in this specification or disclosed all methods or in the process the step of, in addition to mutually exclusive
Feature and/or step other than, can combine in any way.
It elaborates below with reference to Fig. 1 to Fig. 4 to the present invention.
Kit material source used in embodiment is illustrated first：Related restriction enzyme is purchased from
Takara company, plasmid extraction kit and Ago-Gel kit are purchased from Omega company, and operation is fully according to accordingly saying
Bright progress.Full genome synthesis is completed by the raw work in Shanghai.
Amp resistance LB solid plate：The tryptone of mass fraction 1%, the yeast extract of mass fraction 0.5%, matter
Measure the sodium chloride of score 1%, the agar powder of mass fraction 2%, 100 μ g/mL of ampicillin concentration.
Primary-seed medium (LB) (mass percent)：1% tryptone, 0.5% yeast extract, 1% sodium chloride,
PH=7.0.
Secondary seed medium：Tryptone 12g/L, yeast extract 24g/L, KH2PO42.31g/L K2HPO4·
3H2O16.43g/L, glycerol 5.04g/L, pH=7.0.
Fermentation medium：Yeast extract 24g/L, tryptone 12g/L, KH2PO42.31g/L K2HPO4·3H2O
16.43g/L, glycerol 10g/L, epsom salt 0.5g/L, ferric citrate 0.4g/L, glucose 5g/L, pH=7.0.
Supplemented medium：Tryptone 20g/L, yeast extract 80g/L, glycerol 420g/L.
Each step in the present invention is further detailed by specific embodiment below：
Embodiment 1：The building of recombinant expression carrier
Bacillus subtilis (Bacillus subtilis) L-Aspartic acid-α-decarboxylation obtained from ncbi database
The gene order of enzyme (PanD), in order to delete the amalgamation and expression mark on expression vector between multiple cloning sites and T7 promoter
Albumen is signed to avoid the influence to recombination Bacillus subtilis A ALPHA D-O enzyme activity, therefore adds restriction enzyme site at PanD gene order both ends
NdeI (CATATG) and XhoI (CTCGAG), wherein PanD gene 5 are held as NdeI, 3, are held as XhoI.It is as follows：
GCCATATGTACCGTACCATGATGTCTGGTAAACTGCACCGTGCTACCGTTACCGAAGCTAACCTGAACT
ACGTTGGTTCTATCACCATCGACGAAGACCTGATCGACGCTGTTGGTATGCTGCCGAACGAAAAAGTTCAGATCGTT
AACAACAACAACGGTGCTCGTCTGGAAACCTACATCATCCCGGGTAAACGTGGTTCTGGTGTTATCTGCCTGAACGG
TGCTGCTGCTCGTCTGGTTCAGGAAGGTGACAAAGTTATCATCATCTCTTACAAAATGATGTCTGACCAGGAAGCTG
CTTCTCACGAACCGAAAGTTGCTGTTCTGAACGACCAGAACAAAATCGAACAGATGCTGGGTAACGAACCGGCTCGT
ACCATCCTGTAACTCGAGCGG
Designed PanD gene order is submitted to the raw work in Shanghai to synthesize, the PanD gene cloning of synthesis in
On pUC57 carrier, pUC57-PanD plasmid is obtained, it is completely correct through sequencing PanD gene order.By pUC57-panD plasmid and
Expression vector plasmid pET32a (+) uses restriction enzyme NdeI and XhoI double digestion respectively, and 37 DEG C of constant temperature digestion 2-3h are utilized
Ago-Gel QIAquick Gel Extraction Kit recycles panD segment and pET32a (+) carrier framework, then uses T4 ligase by panD segment
It is connected with pET32a (+) carrier framework, 10 μ L of linked system, 16 DEG C of connection reactions are overnight.Linked system is as follows：
Connection product is totally converted bacillus coli DH 5 alpha competent cell, conversion process is as follows：It is taken from -80 DEG C of refrigerators
1 pipe, 50 μ L bacillus coli DH 5 ɑ competent cell is placed on ice, after it melts, the connection product of 10 μ L is added thereto, puts
After setting 30min on ice, after being immediately placed in 2min on ice, in an aseptic environment, non-resistant LB culture medium is added in 42 DEG C of heat shock 90s
Recovery bacterium solution is coated on Amp resistance LB solid with spreading rod and put down by 500 μ L under the conditions of 37 DEG C, revolving speed 220rpm after recovery 1h
On plate, 37 DEG C of constant temperature incubation carton upside down culture 12h-16h, picking monoclonal colonies are in 5LB fluid nutrient medium (the 100 μ g/ containing Amp
ML), after cultivating 12h under the conditions of 37 DEG C, revolving speed 220rpm, extract plasmid progress polymerase chain reaction (PCR) and digestion is tested
Card will verify correct monoclonal bacterium solution further progress sequence verification, obtain the right-on monoclonal of panD gene order
Transformant, to obtain pET32a-panD recombinant plasmid.
Embodiment 2：The acquisition of engineering bacteria
Operating procedure is as follows：
(1) pipe 50 μ L E.coli Rosetta (DE3) competent cell is taken, is placed on ice, it is complete to competent cell
After complete solution freezes, gently being blown and beaten with liquid-transfering gun makes competent cell even suspension.
(2) 1 μ L pET32a-panD recombinant plasmid is pipetted, is added in E.coli Rosetta (DE3) competent cell, gently
Mixing is played in featheriness, stands 30min on ice.
(3) 42 DEG C of metal bath heat shock 90s are put into, is immediately placed on and stands 2min on ice.
(4) the LB culture medium of 500 μ L antibiotic-frees of addition, 37 DEG C, 220rpm recovery 1h.
(5) 4000rpm is centrifuged 5min, pipettes 300 μ supernatants with liquid-transfering gun, discards, then gently piping and druming makes cell suspend.
(6) in an aseptic environment, cell is spread evenly across in LB solid medium tablets (Amp resistance) with spreading rod,
Temperature is controlled at 37 DEG C, after just setting 10-20min, is inverted overnight incubation (14-16h).
Picking single colonie is inoculated in the test tube of the culture medium of LB containing 5mL, and 37 DEG C, after 220rpm cultivates 7h, switching is in containing
In the triangular flask of 50mL TB culture medium, 37 DEG C, the inducer IPTG of 0.1mM, drop are added when 220rpm is cultivated to OD600 0.8
To 28 DEG C, 200rpm continues to cultivate 15h temperature.Thalline were collected by centrifugation by 4 DEG C of 6000rpm, by carrying out SDS- after ultrasonic disruption
PAGE detect Bacillus subtilis A ALPHA D-O expression (such as Fig. 2), screening the highest recombinant bacterium of soluble-expression amount carry out protect bacterium it is spare, that is, obtain
L-Aspartic acid-α-decarboxylase engineering bacteria pET32a-panD/E.coli Rosetta (DE3), abbreviation engineering bacteria must be expressed
DPD。
Embodiment 3：The fermentation of engineering bacteria DPD and bioconversion synthesize Beta-alanine
(1) aseptically, it is trained by 0.1%~1% inoculum concentration from engineering bacteria DPD glycerol tube culture transferring to first order seed
It supports in base, 37 DEG C, 220rpm is cultivated to OD600 to 3.0~4.0, stops culture.
(2) first order seed bacterium solution, at 37 DEG C of temperature, is turned as in 4%~10% inoculum concentration switching secondary seed medium
3~5h is cultivated under the conditions of fast 220rpm.
(3) cultured secondary seed bacterium solution is transferred by flame inoculation into 5L fermentor by 1%~8% inoculum concentration
In (fermentation medium containing 3L), Preliminary fermentation parameter：37 DEG C of temperature, revolving speed 200rpm, pH=7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；With the extension of fermentation time, bacteria concentration, which gradually increases, to be controlled dissolved oxygen (DO) by adjusting revolving speed and ventilatory capacity
20%~40%；When DO and pH value quickly increase simultaneously, start flow feeding；When OD600 reaches 20~25, first by temperature
28 DEG C are down to, in addition 0.4mM inducer (IPTG), puts tank after continuing fermentation 12h~15h.Thallus is collected by low-temperature centrifugation,
Thallus yield reaches 120g/L.It is spare that thallus is placed in -20 DEG C of refrigerator for cold.
(4) bioconversion.The conversion of 7L system is carried out in 10L conversion tank：Initial volume 2.8L, system preparation method are：
0.56mol L-Aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaOH solution adjust pH to
6.5；DPD wet thallus 140g is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed
It is converted under the conditions of 200rpm, controls pH 6.5 with L-Aspartic acid HCI solution in conversion process；L-Aspartic acid hydrochloric acid
Salting liquid preparation method is：2.1mol L-Aspartic acid, 37% concentrated hydrochloric acid of 175mL, with water complement product to 2.1L.Convert 2h
Afterwards, start to add L-Aspartic acid sodium solution with the flow velocity of 60mL~200mL/h；L-Aspartic acid sodium solution preparation method is：
2.1mol L-Aspartic acid, 1.05mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L.When converting 14h
Stop reaction, it is 60.5g/L, conversion ratio 99.87% that HPLC, which detects Beta-alanine production quantity,.Wherein HPLC detection method is with reference to text
Spread out before offering the 2,4-dinitrofluorobenzene column established in (GAO Lijuan, the research of L-Aspartic acid-α-decarboxylase production Beta-alanine)
It thinks of a way and is detected.The HPLC of this Beta-alanine standard sample and the Beta-alanine sample of the present embodiment production respectively such as Fig. 3 and
Shown in Fig. 4.
Embodiment 4：The fermentation of engineering bacteria DPD and bioconversion synthesize Beta-alanine
(1) aseptically, it is trained by 0.1%~1% inoculum concentration from engineering bacteria DPD glycerol tube culture transferring to first order seed
It supports in base, 37 DEG C, 220rpm is cultivated to OD600 to 3.0~4.0, stops culture.
(2) first order seed bacterium solution, at 37 DEG C of temperature, is turned as in 4%~10% inoculum concentration switching secondary seed medium
3~5h is cultivated under the conditions of fast 220rpm.
(3) cultured secondary seed bacterium solution is transferred by flame inoculation into 5L fermentor by 1%~8% inoculum concentration
In (fermentation medium containing 3L), Preliminary fermentation parameter：37 DEG C of temperature, revolving speed 200rpm, pH7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；With the extension of fermentation time, bacteria concentration, which gradually increases, to be controlled dissolved oxygen (DO) by adjusting revolving speed and ventilatory capacity
20%~40%；When DO and pH value quickly increase simultaneously, start flow feeding；When OD600 reaches 20~25, first by temperature
28 DEG C are down to, in addition 0.4mM inducer (IPTG), puts tank after continuing fermentation 12h~15h.Thallus is collected by low-temperature centrifugation,
Thallus yield reaches 120g/L.It is spare that thallus is placed in -20 DEG C of refrigerator for cold.
(4) bioconversion.The conversion of 7L system is carried out in 10L conversion tank：Initial volume 2.8L, system preparation method are：
0.56mol L-Aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaOH solution adjust pH to
6.5；DPD wet thallus 140g is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed
It is converted under the conditions of 200rpm, with L-Aspartic acid HCI solution control pH 6.5 in conversion process；L-Aspartic acid hydrochloride
Solution preparation method is：3.15mol L-Aspartic acid, 37% concentrated hydrochloric acid of 263mL, with water complement product to 2.1L.After converting 2h,
Start to add L-Aspartic acid sodium solution with the flow velocity of 60mL~200mL/h；L-Aspartic acid sodium solution is prepared：3.15mol L-
Aspartic acid, 1.58mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L.Stop reaction when converting 16h,
It is 86.71g/L, conversion ratio 99.3% that HPLC, which detects Beta-alanine production quantity,.
Embodiment 5：The fermentation of engineering bacteria DPD and bioconversion synthesize Beta-alanine
(1) aseptically, it is trained by 0.1%~1% inoculum concentration from engineering bacteria DPD glycerol tube culture transferring to first order seed
It supports in base, 37 DEG C, 220rpm is cultivated to OD600 to 3.0~4.0, stops culture.
(2) first order seed bacterium solution, at 37 DEG C of temperature, is turned as in 4%~10% inoculum concentration switching secondary seed medium
3~5h is cultivated under the conditions of fast 220rpm.
(3) cultured secondary seed bacterium solution is transferred by flame inoculation into 5L fermentor by 1%~8% inoculum concentration
In (fermentation medium containing 3L), Preliminary fermentation parameter：37 DEG C of temperature, revolving speed 200rpm, pH7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；With the extension of fermentation time, bacteria concentration, which gradually increases, to be controlled dissolved oxygen (DO) by adjusting revolving speed and ventilatory capacity
20%~40%；When DO and pH value quickly increase simultaneously, start flow feeding；When OD600 reaches 20~25, first by temperature
28 DEG C are down to, in addition 0.4mM inducer (IPTG), puts tank after continuing fermentation 12h~15h.Thallus is collected by low-temperature centrifugation,
Thallus yield reaches 120g/L.It is spare that thallus is placed in -20 DEG C of refrigerator for cold.
(4) bioconversion.The conversion of 7L system is carried out in 10L conversion tank：Initial volume 2.8L, system preparation method are：
0.56mol L-Aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaOH solution adjust pH to
6.5；DPD wet thallus 140g is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed
It is converted under the conditions of 200rpm, controls pH 6.5 with L-Aspartic acid HCI solution in conversion process；L-Aspartic acid hydrochloric acid
Salting liquid preparation method is：4.2mol L-Aspartic acid, 37% concentrated hydrochloric acid of 350mL, with water complement product to 2.1L.Convert 2h
Afterwards, start to add L-Aspartic acid sodium solution with the flow velocity of 60mL~200mL/h；L-Aspartic acid sodium solution is prepared：4.2mol
L-Aspartic acid, 2.1mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L.Stop reaction when converting 20h,
It is 112.92g/L, conversion ratio 99% that HPLC, which detects Beta-alanine production quantity,.
Embodiment 6：The fermentation of engineering bacteria DPD and bioconversion synthesize Beta-alanine
(1) aseptically, it is trained by 0.1%~1% inoculum concentration from engineering bacteria DPD glycerol tube culture transferring to first order seed
It supports in base, 37 DEG C, 220rpm is cultivated to OD600 to 3.0~4.0, stops culture.
(2) first order seed bacterium solution, at 37 DEG C of temperature, is turned as in 4%~10% inoculum concentration switching secondary seed medium
3~5h is cultivated under the conditions of fast 220rpm.
(3) cultured secondary seed bacterium solution is transferred by flame inoculation into 5L fermentor by 1%~8% inoculum concentration
In (fermentation medium containing 3L), Preliminary fermentation parameter：37 DEG C of temperature, revolving speed 200rpm, pH7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；With the extension of fermentation time, bacteria concentration, which gradually increases, to be controlled dissolved oxygen (DO) by adjusting revolving speed and ventilatory capacity
20%~40%；When DO and pH value quickly increase simultaneously, start flow feeding；When OD600 reaches 20~25, first by temperature
28 DEG C are down to, in addition 0.4mM inducer (IPTG), puts tank after continuing fermentation 12h~15h.Thallus is collected by low-temperature centrifugation,
Thallus yield reaches 120g/L.It is spare that thallus is placed in -20 DEG C of refrigerator for cold.
(4) bioconversion.The conversion of 7L system is carried out in 10L conversion tank：Initial volume 2.8L, system preparation method are：
0.56mol L-Aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaOH solution adjust pH to
6.5；DPD wet thallus 140g is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed
It is converted under the conditions of 200rpm, controls pH 6.5 with L-Aspartic acid HCI solution in conversion process；L-Aspartic acid hydrochloric acid
Salting liquid preparation method is：5.25mol L-Aspartic acid, 37% concentrated hydrochloric acid of 438mL, with water complement product to 2.1L.Convert 2h
Afterwards, start to add L-Aspartic acid sodium solution with the flow velocity of 60mL~200mL/h；L-Aspartic acid sodium solution is prepared：4.2mol
L-Aspartic acid, 2.625mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L.Stop when converting 25h anti-
It answers, it is 137.95g/L, conversion ratio 98% that HPLC, which detects Beta-alanine production quantity,.
Embodiment 7：The fermentation of engineering bacteria DPD and bioconversion synthesize Beta-alanine
(1) aseptically, it is trained by 0.1%~1% inoculum concentration from engineering bacteria DPD glycerol tube culture transferring to first order seed
It supports in base, 37 DEG C, 220rpm is cultivated to OD600 to 3.0~4.0, stops culture.
(2) first order seed bacterium solution, at 37 DEG C of temperature, is turned as in 4%~10% inoculum concentration switching secondary seed medium
3~5h is cultivated under the conditions of fast 220rpm.
(3) cultured secondary seed bacterium solution is transferred by flame inoculation into 5L fermentor by 1%~8% inoculum concentration
In (fermentation medium containing 3L), Preliminary fermentation parameter：37 DEG C of temperature, revolving speed 200rpm, pH=7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；With the extension of fermentation time, bacteria concentration, which gradually increases, to be controlled dissolved oxygen (DO) by adjusting revolving speed and ventilatory capacity
20%~40%；When DO and pH value quickly increase simultaneously, start flow feeding；When OD600 reaches 20~25, first by temperature
28 DEG C are down to, in addition 0.4mM inducer (IPTG), puts tank after continuing fermentation 12h~15h.Thallus is collected by low-temperature centrifugation,
Thallus yield reaches 120g/L.It is spare that thallus is placed in -20 DEG C of refrigerator for cold.
(4) bioconversion.The conversion of 7L system is carried out in 10L conversion tank：Initial volume 2.8L, system preparation method are：
0.56mol L-Aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaOH solution adjust pH to
6.5；DPD wet thallus 140g is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed
It is converted under the conditions of 200rpm, controls pH 6.5 with L-Aspartic acid HCI solution in conversion process；L-Aspartic acid hydrochloric acid
Salting liquid preparation method is：6.3mol L-Aspartic acid, 37% concentrated hydrochloric acid of 525mL, with water complement product to 2.1L.Convert 2h
Afterwards, start to add L-Aspartic acid sodium solution with the flow velocity of 60mL~200mL/h；L-Aspartic acid sodium solution is prepared：6.3mol
L-Aspartic acid, 3.15mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L；Stop when converting 36h anti-
It answers, it is 125.63g/L, conversion ratio 75% that HPLC, which detects Beta-alanine production quantity,.
Embodiment 8：The fermentation of engineering bacteria DPD and bioconversion synthesize Beta-alanine
(1) thallus for recycling 6 bioconversion of example, carries out second of bioconversion.
(2) bioconversion.The conversion of 7L system is carried out in 10L conversion tank：Initial volume 2.8L, system preparation method are：
0.56mol L-Aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaOH solution adjust pH to
6.5；Recycling thallus is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed 200rpm item
It is converted under part, controls pH 6.5 with L-Aspartic acid HCI solution in conversion process；L-Aspartic acid HCI solution is matched
Method processed is：5.25mol L-Aspartic acid, 37% concentrated hydrochloric acid of 438mL, with water complement product to 2.1L.Convert 2h after, start with
The flow velocity of 60mL~200mL/h adds L-Aspartic acid sodium solution；L-Aspartic acid sodium solution is prepared：4.2mol L- asparagus fern ammonia
Acid, 2.625mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L；Stop reaction, HPLC inspection when converting 28h
Survey Beta-alanine production quantity is 134.5g/L, conversion ratio 97.5%.
Embodiment 9：The fermentation of engineering bacteria DPD and bioconversion synthesize Beta-alanine
(1) thallus for recycling 8 bioconversion of example, carries out third time bioconversion.
(2) bioconversion.The conversion of 7L system is carried out in 10L conversion tank：Initial volume 2.8L, system preparation method are：
0.56mol L-Aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaoH solution adjust pH to
6.5；Recycling thallus is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed 200rpm item
It is converted under part, controls pH 6.5 with L-Aspartic acid HCI solution in conversion process；L-Aspartic acid HCI solution is matched
Method processed is：5.25mol L-Aspartic acid, 37% concentrated hydrochloric acid of 438mL, with water complement product to 2.1L.Convert 2h after, start with
The flow velocity of 60mL~200mL/h adds L-Aspartic acid sodium solution；L-Aspartic acid sodium solution is prepared：4.2mol L- asparagus fern ammonia
Acid, 2.625mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L；Stop reaction, HPLC inspection when converting 28h
Survey Beta-alanine production quantity is 117.3g/L, conversion ratio 85%.
Embodiment 10：The fermentation of engineering bacteria DPD and Enzymatic Resolution DL- aspartic acid biosynthesis D-Asp and β-the third
Propylhomoserin
(1) aseptically, it is trained by 0.1%~1% inoculum concentration from engineering bacteria DPD glycerol tube culture transferring to first order seed
It supports in base, 37 DEG C, 220rpm is cultivated to OD600 to 3.0~4.0, stops culture.
(2) first order seed bacterium solution, at 37 DEG C of temperature, is turned as in 4%~10% inoculum concentration switching secondary seed medium
3~5h is cultivated under the conditions of fast 220rpm.
(3) cultured secondary seed bacterium solution is transferred by flame inoculation into 5L fermentor by 1%~8% inoculum concentration
In (fermentation medium containing 3L), Preliminary fermentation parameter：37 DEG C of temperature, revolving speed 200rpm, pH=7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；With the extension of fermentation time, bacteria concentration, which gradually increases, to be controlled dissolved oxygen (DO) by adjusting revolving speed and ventilatory capacity
20%~40%；When DO and pH value quickly increase simultaneously, start flow feeding；When OD600 reaches 20~25, first by temperature
28 DEG C are down to, in addition 0.4mM inducer (IPTG), puts tank after continuing fermentation 12h~15h.Thallus is collected by low-temperature centrifugation,
Thallus yield reaches 120g/L.It is spare that thallus is placed in -20 DEG C of refrigerator for cold.
(4) bioconversion.The conversion of 7L system is carried out in 10L conversion tank：Initial volume 2.8L, system preparation method are：
0.56mol DL- aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaOH solution adjust pH to
6.5；DPD wet thallus 140g is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed
It is converted under the conditions of 200rpm, controls pH 6.5 with DL- aspartic acid HCI solution in conversion process；DL- aspartate
Acid salt solution preparation method is：5.25mol DL- aspartic acid, 37% concentrated hydrochloric acid of 438mL, with water complement product to 2.1L.Conversion
After 2h, start to mend DL- aspartic acid sodium solution with the flow velocity of 60mL~200mL/h；DL- aspartic acid sodium solution is prepared：
5.25mol DL- aspartic acid, 2.625mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L.Convert 20h
When stop reaction, HPLC detect Beta-alanine production quantity be 70.24g/L, conversion ratio 99.8%, D-Asp content 103g/
L.The method that HPLC detection method is reported according to document " high performance liquid chromatography separation measures DL- aspartic acid enantiomer ", with neighbour
Phthalaldehyde (OPA), N-acetyl-L-cysteine are that derivative reagent carries out column front derivation to NaAsp enantiomer, are carried out
Detect the content of D-Asp.
Embodiment 11：The fermentation of engineering bacteria DPD and Enzymatic Resolution DL- aspartic acid biosynthesis D-Asp and β-the third
Propylhomoserin
(1) aseptically, it is trained by 0.1%~1% inoculum concentration from engineering bacteria DPD glycerol tube culture transferring to first order seed
It supports in base, culture stops culture to OD600 to 3.0~4.0 under the conditions of 37 DEG C of temperature, revolving speed 220rpm.
(2) by first order seed bacterium solution by 4%~10% inoculum concentration switching secondary seed medium, 37 DEG C, 220rpm is trained
Support 3~5h.
(3) cultured secondary seed bacterium solution is transferred by flame inoculation into 5L fermentor by 1%~8% inoculum concentration
In (fermentation medium containing 3L), Preliminary fermentation parameter：37 DEG C of temperature, revolving speed 200rpm, pH7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；With the extension of fermentation time, bacteria concentration, which gradually increases, to be controlled dissolved oxygen (DO) by adjusting revolving speed and ventilatory capacity
20%~40%；When DO and pH value quickly increase simultaneously, start flow feeding；When OD600 reaches 20~25, first by temperature
28 DEG C are down to, in addition 0.4mM inducer (IPTG), puts tank after continuing fermentation 12h~15h.Thallus is collected by low-temperature centrifugation,
Thallus yield reaches 120g/L.It is spare that thallus is placed in -20 DEG C of refrigerator for cold.
(4) bioconversion.The conversion of 7L system is carried out in 10L conversion tank.Initial volume 2.8L, system preparation method are：
0.56mol DL- aspartic acid, 0.28mol natrium carbonicum calcinatum, after adding suitable quantity of water stirring and dissolving, with NaOH solution adjust pH to
6.5；DPD wet thallus 140g is added, stirring makes thallus be uniformly dispersed, with water complement product to 2.8L, at 37 DEG C of temperature, revolving speed
It is converted under the conditions of 200rpm, controls pH 6.5 with DL- aspartic acid HCI solution in conversion process；DL- aspartate
Acid salt solution preparation method is：6.3mol DL- aspartic acid, 37% concentrated hydrochloric acid of 525mL, with water complement product to 2.1L.Conversion
After 2h, start to add DL- aspartic acid sodium solution with the flow velocity of 60mL~200mL/h；DL- aspartic acid sodium solution is prepared：
6.3mol DL- aspartic acid, 3.15mol natrium carbonicum calcinatum add complement after suitable quantity of water stirring and dissolving long-pending to 2.1L.When converting 28h
Stop reaction, it is 83.58g/L, conversion ratio 99.8%, D-Asp content 124.7g/ that HPLC, which detects Beta-alanine production quantity,
L。
The specific embodiment of the application above described embodiment only expresses, the description thereof is more specific and detailed, but simultaneously
The limitation to the application protection scope therefore cannot be interpreted as.It should be pointed out that for those of ordinary skill in the art
For, under the premise of not departing from technical scheme design, various modifications and improvements can be made, these belong to this
The protection scope of application.
Claims (8)
1. a kind of method of biological enzyme conversion production Beta-alanine, which is characterized in that include the following steps：
[1] building is overexpressed L-Aspartic acid-α-decarboxylase recombination bacillus coli, and carries out high density fermentation and be overexpressed
The colibacillus engineering of L-Aspartic acid decarboxylase；
[2] bioconversion is carried out by substrate of L-Aspartic acid using the colibacillus engineering that step [1] obtains, transformed
Cheng Zhongliu adds L-Aspartic acid sodium solution to carry out adding substrate, and is with L-Aspartic acid HCI solution control transformation system pH
6.0-7.0 obtaining Beta-alanine.
2. a kind of method of biological enzyme conversion production Beta-alanine described in accordance with the claim 1, which is characterized in that step
[1] building is overexpressed L-Aspartic acid-α-decarboxylase recombination bacillus coli and specifically comprises the following steps in：
[1-1] carries out gene codon optimization to bacillus subtilis L-Aspartic acid-α-decarboxylase gene sequence, and full genome closes
L-Aspartic acid-α-decarboxylase gene sequence that NdeI and XhoI restriction endonuclease sites are carried at both ends, by the L- of synthesis
Aspartic acid-α-decarboxylase gene sequence is cloned on pUC57 carrier, obtains pUC57-PanD plasmid；
The pUC57-panD plasmid and expression vector pET32a (+) matter that [1-2] is obtained with NdeI and XhoI double digestion step [1-1]
Digestion products pET32a (+) and panD segment, are then attached with T4 ligase, connection product is transformed into clone strain by grain
DH5 α, screening obtain positive recombinant, and extracting bacterium solution obtains recombinant plasmid pET32a-panD；
The recombinant plasmid pET32a-panD that step [1-2] obtains is transferred to Escherichia coli Rosetta by heat shock method by [1-3]
(DE3) in, screening positive recombinant is the recombination bacillus coli obtained for producing Beta-alanine and D-Asp.
3. a kind of method of biological enzyme conversion production Beta-alanine according to claim 1 or 2, which is characterized in that step
Suddenly the colibacillus engineering that high density fermentation acquisition overexpression L-Aspartic acid decarboxylase is carried out in [1] specifically includes following step
Suddenly：
It is big that [1-4] will aseptically, by 0.1%~1% inoculum concentration be overexpressed the recombination of L-Aspartic acid-α-decarboxylase
Enterobacteria culture transferring into primary-seed medium, under conditions of 37 DEG C of temperature, revolving speed 220rpm culture to OD600 be 3.0~
4.0, stop culture and obtains first order seed bacterium solution；
The first order seed bacterium solution that [1-5] obtains step [1-4] is transferred by 4%~10% inoculum concentration in secondary seed medium,
3~5h is cultivated under conditions of 37 DEG C of temperature, revolving speed 220rpm, obtains secondary seed bacterium solution；
[1-6] is transferred the secondary seed bacterium solution that step [1-5] obtains into hair by flame inoculation by 1%~8% inoculum concentration
In fermentation tank, setting Preliminary fermentation parameter is：37 DEG C of temperature, revolving speed 200rpm, pH=7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；Dissolved oxygen is controlled 20%~40% by adjusting revolving speed and ventilatory capacity as bacteria concentration is gradually increased；Until dissolved oxygen
When quickly increasing simultaneously with pH value, start flow feeding；When OD600 reaches 20~25,28 DEG C are first cooled the temperature to, addition
Inducer puts tank after continuing fermentation 12h~15h；Low-temperature centrifugation is collected thallus and is refrigerated stand-by.
4. a kind of method of biological enzyme conversion production Beta-alanine described in accordance with the claim 1, which is characterized in that step
[2] detailed process is：
Setting starting reaction system is 0.4 volume, makes that reaction system contains 0.2mol/L L-Aspartic acid and 0.1mol/L is anhydrous
Sodium carbonate, 5% thallus, pH=6.5；Conversion condition is 37 DEG C of temperature, revolving speed 200rpm, with the L- of 0.3 volume in conversion process
Aspartic acid HCI solution adjusts pH=6.5；After converting 2h, 0.3 volume is added with the flow velocity stream of 60mL~200mL/h L- days
Aspartic acid sodium solution stops reaction when converting 14h~36h.
5. a kind of method of biological enzyme conversion production Beta-alanine and D-Asp, which is characterized in that include the following steps：
[1] it carries out high density fermentation and obtains the colibacillus engineering for being overexpressed L-Aspartic acid decarboxylase；
[2] bioconversion is carried out by substrate of DL- aspartic acid using the colibacillus engineering that step [1] obtains, converted
Stream plus DL- aspartic acid sodium solution carry out adding substrate in the process, while passing through stream plus the control of DL- aspartic acid HCI solution
Transformation system pH be 6.0-7.0, obtain Beta-alanine and D-Asp mixture, respectively obtained after separation Beta-alanine and
D-Asp product.
6. a kind of method of biological enzyme conversion production Beta-alanine and D-Asp according to claim 5, special
Sign is that the method that building is overexpressed L-Aspartic acid-α-decarboxylase recombination bacillus coli in step [1] includes following step
Suddenly：
[1-1] optimizes bacillus subtilis L-Aspartic acid-α-decarboxylase gene sequence, and full genome synthesizes both ends and carries
L-Aspartic acid-the α of NdeI and XhoI restriction endonuclease sites-decarboxylase gene sequence, by the L-Aspartic acid-α-of synthesis
Decarboxylase gene sequence is cloned on pUC57 carrier, obtains pUC57-PanD plasmid；
The pUC57-panD plasmid and expression vector pET32a (+) matter that [1-2] is obtained with NdeI and XhoI double digestion step [1-1]
Digestion products pET32a (+) and panD segment, are then attached with T4 ligase, connection product is transformed into clone strain by grain
DH5 α, screening obtain positive recombinant, and extracting bacterium solution obtains recombinant plasmid pET32a-panD；
The recombinant plasmid pET32a-panD that step [1-2] obtains is transferred to Escherichia coli Rosetta by heat shock method by [1-3]
(DE3) in, screening positive recombinant is the recombination bacillus coli obtained for producing Beta-alanine and D-Asp.
7. according to a kind of method of biological enzyme conversion production Beta-alanine and D-Asp described in claim 5 or 6,
It is characterized in that, high density fermentation is carried out in step [1] and obtains the colibacillus engineering for being overexpressed L-Aspartic acid decarboxylase
Method includes the following steps：
It is big that [1-4] will aseptically, by 0.1%~1% inoculum concentration be overexpressed the recombination of L-Aspartic acid-α-decarboxylase
Enterobacteria culture transferring into primary-seed medium, under conditions of 37 DEG C of temperature, revolving speed 220rpm culture to OD600 be 3.0~
4.0, stop culture and obtains first order seed bacterium solution；
The first order seed bacterium solution that [1-5] obtains step [1-4] is transferred by 4%~10% inoculum concentration in secondary seed medium,
3~5h is cultivated under conditions of 37 DEG C of temperature, revolving speed 220rpm, obtains secondary seed bacterium solution；
[1-6] is transferred the secondary seed bacterium solution that step [1-5] obtains into hair by flame inoculation by 1%~8% inoculum concentration
In fermentation tank, setting Preliminary fermentation parameter is：37 DEG C of temperature, revolving speed 200rpm, pH=7.0, ventilatory capacity 50L/h, tank pressure
0.05MPa；Dissolved oxygen is controlled 20%~40% by adjusting revolving speed and ventilatory capacity as bacteria concentration is gradually increased；Until dissolved oxygen
When quickly increasing simultaneously with pH value, start flow feeding；When OD600 reaches 20~25,28 DEG C are first cooled the temperature to, addition
Inducer puts tank after continuing fermentation 12h~15h；Low-temperature centrifugation is collected thallus and is refrigerated stand-by.
8. a kind of method of biological enzyme conversion production Beta-alanine and D-Asp according to claim 5, special
Sign is that the detailed process of step [2] is：
Setting starting 0.4 volume of reaction system, makes that reaction system contains 0.2mol/L DL- aspartic acid and 0.1mol/L is anhydrous
Sodium carbonate, 5% thallus, pH to 6.5；Conversion condition is 37 DEG C of temperature, revolving speed 200rpm, with the DL- of 0.3 volume in conversion process
Aspartic acid HCI solution, which is adjusted, maintains pH=6.5；After converting 2h, 0.3 volume is added with the flow velocity stream of 60mL~200mL/h
DL- aspartic acid sodium solution stops reaction when converting 20h~28h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810629645.XA CN108841883A (en) | 2018-06-19 | 2018-06-19 | A kind of method of biological enzyme conversion production Beta-alanine and D-Asp |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810629645.XA CN108841883A (en) | 2018-06-19 | 2018-06-19 | A kind of method of biological enzyme conversion production Beta-alanine and D-Asp |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108841883A true CN108841883A (en) | 2018-11-20 |
Family
ID=64202573
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810629645.XA Pending CN108841883A (en) | 2018-06-19 | 2018-06-19 | A kind of method of biological enzyme conversion production Beta-alanine and D-Asp |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108841883A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402184A (en) * | 2018-12-20 | 2019-03-01 | 四川同晟生物医药有限公司 | A kind of method of biological enzyme synthesis D-malic acid |
| CN112813130A (en) * | 2021-02-03 | 2021-05-18 | 安徽丰原生物技术股份有限公司 | Production method of D-aspartic acid |
| CN115261297A (en) * | 2022-09-15 | 2022-11-01 | 杭州唯铂莱生物科技有限公司 | Escherichia coli recombinant strain and method for producing 3, 4-dihydroxy phenylethanol by using same |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5834259A (en) * | 1996-10-28 | 1998-11-10 | Monsanto Company | Process and composition for preparing D-aspartic acid |
| CN102443612A (en) * | 2011-11-24 | 2012-05-09 | 蒋光玉 | Production technology of D-aspartic acid and L-alanine |
| CN104593398A (en) * | 2013-11-01 | 2015-05-06 | 中国科学院微生物研究所 | Engineering bacterium with high L-aspartic acid alpha carboxylase activity, and its application in production of beta-alanine |
| CN106754845A (en) * | 2016-11-30 | 2017-05-31 | 浙江工业大学 | A kind of panD mutators, encoding proteins, carrier, engineering bacteria and its application |
| CN107338258A (en) * | 2017-01-09 | 2017-11-10 | 鲁东大学 | The method for producing the engineering bacteria structure and its production beta Alanine of beta Alanine |
-
2018
- 2018-06-19 CN CN201810629645.XA patent/CN108841883A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5834259A (en) * | 1996-10-28 | 1998-11-10 | Monsanto Company | Process and composition for preparing D-aspartic acid |
| CN102443612A (en) * | 2011-11-24 | 2012-05-09 | 蒋光玉 | Production technology of D-aspartic acid and L-alanine |
| CN104593398A (en) * | 2013-11-01 | 2015-05-06 | 中国科学院微生物研究所 | Engineering bacterium with high L-aspartic acid alpha carboxylase activity, and its application in production of beta-alanine |
| CN106754845A (en) * | 2016-11-30 | 2017-05-31 | 浙江工业大学 | A kind of panD mutators, encoding proteins, carrier, engineering bacteria and its application |
| CN107338258A (en) * | 2017-01-09 | 2017-11-10 | 鲁东大学 | The method for producing the engineering bacteria structure and its production beta Alanine of beta Alanine |
Non-Patent Citations (4)
| Title |
|---|
| NCBI: "Aspartate 1-decarboxylase [Bacillus subtilis QB928]", 《GENBANK DATABAS》 * |
| 张惠展编著: "《基因工程》", 31 January 2017, 华东理工大学出版社 * |
| 沈艳: "谷氨酸棒杆菌L-天冬氨酸α-脱羧酶催化性能的定点突变分子改造", 《中国优秀硕士学位论文全文数据库工程科技Ⅰ辑》 * |
| 高丽娟等: "L一天冬氨酸脱羧酶研究进展", 《工业微生物》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402184A (en) * | 2018-12-20 | 2019-03-01 | 四川同晟生物医药有限公司 | A kind of method of biological enzyme synthesis D-malic acid |
| CN109402184B (en) * | 2018-12-20 | 2022-04-22 | 四川同晟生物医药有限公司 | Method for synthesizing D-malic acid by biological enzyme method |
| CN112813130A (en) * | 2021-02-03 | 2021-05-18 | 安徽丰原生物技术股份有限公司 | Production method of D-aspartic acid |
| CN112813130B (en) * | 2021-02-03 | 2023-05-16 | 安徽丰原生物技术股份有限公司 | Production method of D-aspartic acid |
| CN115261297A (en) * | 2022-09-15 | 2022-11-01 | 杭州唯铂莱生物科技有限公司 | Escherichia coli recombinant strain and method for producing 3, 4-dihydroxy phenylethanol by using same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR100866479B1 (en) | Method for producing L-glutamic acid by fermentation accompanied by precipitation | |
| KR100626568B1 (en) | L-Glutamic acid-producing bacterium and method for producing L-glutamic acid | |
| EP1233068A2 (en) | Method for producing L-glutamic acid | |
| BRPI0903495B1 (en) | mutant microorganisms capable of producing putrescine and method for producing putrescine using the same | |
| EP1233069B1 (en) | Method for producing L-glutamic acid | |
| CN104498519A (en) | Expression recombinant vector and application thereof | |
| CN108841883A (en) | A kind of method of biological enzyme conversion production Beta-alanine and D-Asp | |
| CN109055289A (en) | A kind of recombination bacillus coli of high yield l-methionine and its application | |
| WO2022174597A1 (en) | Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof | |
| EP3023493B1 (en) | A modified ornithine decarboxylase protein and a use thereof | |
| WO2023169176A1 (en) | Engineering bacterium for expressing aspartate dehydrogenase and method for producing vitamin b5 by fermentation | |
| Jiang et al. | Enhanced low molecular weight poly-γ-glutamic acid production in recombinant Bacillus subtilis 1A751 with zinc ion | |
| CN105950529B (en) | Produce recombination Corynebacterium glutamicum, its construction method and the application of 3- hydracrylic acid | |
| WO2023169168A1 (en) | Use of aspartate decarboxylase in fermentation production of vitamin b5 | |
| JP4292724B2 (en) | Organic nitrogen-containing composition and fertilizer containing the same | |
| JP4144098B2 (en) | L-glutamic acid-producing bacterium and method for producing L-glutamic acid | |
| CN110331153A (en) | A kind of gram Lyu Wall Salmonella tyrosine phenol lyase mutant and its application | |
| JP2000106869A (en) | L-glutamic acid-producing bacterium and production of l-glutamic acid | |
| CN108504617A (en) | A kind of Escherichia coli recombinant strain and its construction method of high-yield L-lysine | |
| CN108441525A (en) | The Corynebacterium glutamicum and its construction method that a kind of lysine production improves | |
| KR20020068294A (en) | Method for producing l-glutamic acid | |
| Liu et al. | Engineering synthetic microbial consortium for cadaverine biosynthesis from glycerol | |
| CN113789307B (en) | Pantothenate synthetase mutant, encoding gene, vector and application | |
| CN109207534A (en) | A method of improving L-Methionine yield | |
| US20220259625A1 (en) | Genetically engineered bacterium for sarcosine production as well as construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181120 |