CN108841832A - The application of the transhipment helper factor GmPHF1b of phosphate cotransporter - Google Patents

Abstract

The present invention provides the transhipment helper factors of phosphate cotransporterGmPHF1bApplication, specificallyGmPHF1bGene promotes acquisition of the leguminous plant to phosphorus, and then promotes nodulation and nitrogen fixation, the application in terms of nitrogen, phosphorus collaboration efficiently.By homologous comparison, the gene that a leaf, stem, root, root nodule and Hua Zhongjun have expression has been clonedGmPHF1b,And it demonstratesGmPHF1bThe phosphorus transporter Protein G mPT5/GmPT7 interaction that the albumen and control root nodule phosphorus of gene coding obtain, overexpressionGmPHF1bThe root nodule numbers and nodule weight of soybean are significantly increased, improve nodule nitrogenase activities, and then increase the content of nitrogen and phosphorous and biomass, ultimately increase the yield of soybean.

Description

The application of the transhipment helper factor GmPHF1b of phosphate cotransporter

Technical field

The present invention relates to the applications of gene, and in particular to the transhipment helper factor of phosphate cotransporterGmPHF1bApplication, Belong to field of biotechnology.

Background technique

Soybean（Glycine max）It is grain and oil crop important in world wide originating from China（Palander et al., 2005）.China increasingly increases the demand of soybean, it has also become maximum Soybean import state in the world, soybean externally according to Lai Du reaches 87%.Therefore, extremely urgent come the imbalance between supply and demand for solving soybean in China by improving soybean yields.It is tropical sub- Due to long-term high temperature and rainy, soil is not only acidified seriously for torrid areas, but also most of Soil Nitrogen/phosphorus nutrient is lower, has become For the principal element for limiting this area's agricultural production.Nitrogen is the primary factor of limiting plant growth and yield.Studies have shown that soybean A large amount of nitrogen is needed between podding duration, which significantly affects the yield of soybean, and appropriate applied nitrogen can Significantly improve soybean plant strain dry-matter accumulation amount and yield（Dong Shoukun etc., 2010；Xia Xuan, 2014）.Phosphorus is also that limitation plant is raw Long main mineral nutrient element, phosphorus nutrient significantly affect the growth and development of soybean.Studies have shown that application phosphate fertilizer can in right amount To increase soybean plant strain drought resisting, lodging resistance, increase the absorption of plant pair mineral element, promotes dry-matter accumulation and yield composition （Zhang little Ming etc., 2016）.But continue applied nitrogen or phosphate fertilizer after soybean reaches maximum production, cannot not only it increase production, instead And it will lead to the underproduction（Dong Shoukun etc., 2010；Wang Jianguo etc., 2006）.And excessively application chemical fertilizer not only causes resource consumption, also It pollutes the environment, causes soil acidification, water eutrophication etc.（Guo et al., 2010；Zhang et al., 2013）. Further, since the effects of leaching loss, volatilization and denitrification, this season utilization rate of nitrogen fertilizer of application is less than 50%（Xu et al., 2011）, and the most of phosphate fertilizer being manured into soil is easily by soil fixing, form the compound of slightly solubility, this season utilization rate less than 30%（Qin et al., 2012a）.It is asked as it can be seen that can not cost-effectively solve nitrogen starved plot, scarce phosphorus etc. by fertilising merely Topic.Therefore, by the means of genetic improvement, plant itself potentiality are sufficiently excavated, cultivate nitrogen, the efficient crop varieties of phosphorus collaboration, Be conducive to the growth requirement for meeting environmentally friendly sustainable agriculture.

Leguminous plant can form root nodule with nitrogen-fixing microorganism rhizobium symbiosis, carry out symbiotic nitrogen fixation（Garg et al., 2009）.Phosphorus nutrient significantly affects the growth and development of legume nodule.It is heavy and solid that appropriate phosphorus supply can increase root nodule number, root nodule Nitrogen enzymatic activity, and then increase the biomass and phosphorus content of plant（Chen et al., 2011c；Qin et al., 2012a）. Some researches show that variation of the solvable phosphorus concentration of soybean leaves and root between height is low-phosphorous is very big, and the solvable phosphorus concentration of root nodule Variation between height is low-phosphorous is relatively steady, illustrates the ability that root nodule has regulation phosphorus balance under low-phosphorus stress, to meet it The wilderness demand of growth and fixed nitrogen to phosphorus（Qin et al., 2012a）.Pht1 phosphorus transporter albumen plant to the absorption of phosphorus and It plays an important role in operation process.2012, Qin et al. reported the phosphorus transporter albumen of soybean Pht1 family high-affinity GmPT5 participates in transhipment of the phosphorus from soybean root system to root nodule（Qin et al., 2012a）.Phosphorus transporter Protein G mPT7 then participates in root Direct absorption of the tumor to phosphorus, and participate in phosphorus and operate from host cell to rhizobium（Chen et al., 2018）.

Pht1 is on protein level mainly by PHO2 and NLA（Liu et al., 2014）Ubiquitination regulation and casein Kinase c K2（Chen et al., 2015；Liang et al., 2014）The negative regulation of phosphorylation.In arabidopsis and rice It is reported that PHF1 as carrier protein, can assist phosphorus transporter albumen to leave endoplasmic reticulum, navigate on plasma membrane（Chen et al., 2011b；Gonzalez et al., 2005）.OsPHF1 translation terminates in advance or functional areas point mutation causes base later Because function is lost, phosphorus transporter albumen will lead in endoplasmic reticulum retention, to influence absorption and transhipment of the plant to phosphorus（Chen et al., 2011b）.PHF1 assists it to leave endoplasmic reticulum by the phosphorus transporter protein binding with non-phosphorylating.By AtPT1 albumen carboxylic The mutant serine that base end is the 514th is aspartic acid, simulates phosphorylation state, then cannot be with PHF1 interaction and in being trapped in Matter net（Bayle et al., 2011）, also have similar result on rice（Chen et al., 2015）.It is proved in rice Regulation of the Pht1 phosphate transporter gene by casein kinase CK2.CK2 mainly carries out phosphorylation to phosphate transporter gene, 517th mutant serine of the 512nd of OsPT2 protein carboxyl groups end and OsPT8 protein carboxyl groups end is alanine, then , to enhance its interaction with PHF1 and enhance the positioning of its film, plant cannot be promoted to phosphorus by casein kinase CK2 phosphorylation It absorbs（Chen et al., 2015）.Whether there is also similar regulatory mechanisms to have not yet to see report in pulse family.

Summary of the invention

The object of the present invention is to provide a kind of transhipment helper factors of phosphate cotransporterGmPHF1bApplication.

To achieve the above object, the present invention uses following technical scheme：

By the comparison of homologous column and quantifying PCR method, the phosphate cotransporter for having expression at each position of soybean is identified The transhipment helper factor of sonGmPHF1b, sequence is as shown in SEQ ID NO.1.The albumen of gene coding is positioned at ER, with GmPT5/GmPT7 can interaction.

Using transgenic plant research shows that.OverexpressionGmPHF1aSoybean nodulation number and fresh weight are significantly increased, is mentioned High total nitrogen, content of tatal phosphorus, ultimately increase the Biomass and yield of soybean.

The research of inventor will efficiently be provided with high yield molecular breeding for the legume nitrogen including soybean, phosphorus collaboration Genetic resources.

The invention has the beneficial effects that：The present invention is to the legume nodule number increased including soybean and again Amount improves total nitrogen, content of tatal phosphorus, increases biomass and yield is of great significance, can to development environment friendly Sustainable agriculture has great importance, while efficiently for nitrogen, phosphorus collaboration, high yield molecular breeding provides genetic resources.

Detailed description of the invention

Fig. 1 is the Phylogenetic analysis of PHF1.

Fig. 2 isGmPHF1bGene expression pattern.

Fig. 3 is the subcellular localization of GmPHF1b.

Fig. 4 is GmPHF1b and interaction of the GmPT5/7 albumen in yeast.

Fig. 5 is GmPHF1b and interaction of the GmPT5/7 albumen in tobacco leaf.

Fig. 6-A is that blade applies herbicide positive plant.

Fig. 6-B is that PCR detects positive plant.

Fig. 6-C is quantitative PCR detectionGmPHF1bExpression quantity.

Fig. 6-D is root nodule picture.

Fig. 6-E is nodule number.

Fig. 6-F is root nodule fresh weight.

Fig. 7-A is overexpressionGmPHF1b Influence to soybean plant strain fresh weight.

Fig. 7-B is overexpressionGmPHF1b Influence to soybean plant strain total nitrogen content.

Fig. 7-C is overexpressionGmPHF1b Influence to soybean plant strain content of tatal phosphorus.

Fig. 8-A is overexpressionGmPHF1b Influence to the kernal number of soybean water culture experiment.

Fig. 8-B is overexpressionGmPHF1b Influence to the seed dry weight of soybean water culture experiment.

Fig. 8-C is overexpressionGmPHF1b Influence to the kernal number of soybean field experiment.

Fig. 8-D is overexpressionGmPHF1b Influence to the seed dry weight of soybean field experiment.

Specific embodiment

Specific introduce is made to the present invention below in conjunction with the drawings and specific embodiments.

The Phylogenetic analysis of embodiment 1, PHF1

The Multiple Sequence Alignment of PHF1 albumen

According to the sequence information of arabidopsis and the PHF1 gene of rice, in soybean genome database Phytozome（http:// www.phytozome.net/soybean）It carries out Blast and screens candidate gene, obtained gene order is in arabidopsis database （TAIR）Blast is carried out to determine their possible functions, its chromosome is determined with the relevant information that Phytozome provides gene Positioning, and be named referring to arabidopsis nomenclature（Bucher, 2007）.With the amino acid sequence of soybean PHF albumen and quasi- Southern mustard, rice PHF1 protein amino acid sequence carry out Multiple Sequence Alignment using GENEDOC software.

In the soybean genome database announced, by homologous comparison, soybean PHF1 phosphorus transporter albumen man is predicted Race shares 2 members, is named as GmPHF1a and GmPHF1b, with the amino acid sequence and arabidopsis, rice of soybean PHF1 albumen Deng PHF1 protein amino acid sequence, carry out Multiple Sequence Alignment, then with 5.0 software of Mega obtain soybean, rice, arabidopsis The PHF1 Phylogenetic analysis of equal species.

The result shows that（See Fig. 1）：The SEC12like albumen of arabidopsis, rice and soybean and corn etc. is constructed and is evolved Tree analysis, these albumen are divided into single dicotyledonous two groups, and first group of the inside pulse family is gathered in a subgroup, implies pulse family PHF1 and quasi- south Mustard, rice PHF1 may functionally have conservative place, i.e. transporting P ht1 P i transportors, also have the special place of pulse family, may Rice and arabidopsis can be different to the transhipment of the Pht1 of root nodule.

Embodiment 2,GmPHF1bGene expression pattern

It is planted using nutrient fluid cultivation mode, nursery latter week, chooses the uniform seedling of growth and impregnated in fresh rhizobium bacterium solution It transplants seedlings, is moved into the bread bin equipped with different disposal nutrient solution after 30 minutes.Test is single factor test, including low-phosphorous（LP: 5 μ mol/L）, normal phosphorus（HP: 250 μmol/L）Two phosphorus levels；All low nitrogen（100 μmol/L）And Rhizobium Inoculation Processing, test set 4 repetitions.55 days harvests leaf, stem, the tip of a root, root, root nodule and flowers after transplanting seedlings；- 80 DEG C of preservation samples are used for RNA is extracted.SoybeanPHF1a Gene quantification PCR primer sequence is：

GmPHF1b-F: TGGGTCGTGGATTCGGAGGC；

GmPHF1b-R: CCCCACTTGGGTGGACTGCAA；

Quantitative PCR program is：The resulting cDNA of RNA sample reverse transcription is diluted into 50 times of templates as quantitative PCR.It is adopted in test With 20 μ l reaction systems, including：2 × SYBR Green PCR master mix of 10 μ l, 10 μM of each 0.6 μ l are forward and reverse to be drawn Object, the 2 diluted cDNA of μ l are mended with Mini-Q water to 20 μ l.

Quantitative PCR reaction condition is：95 DEG C are denaturalized 1 minute, and 95 DEG C crack 15 seconds, and 60 DEG C combine 15 seconds, 72 DEG C of extensions 30 seconds and 40 circulations of progress.

The expression of each sample is calculated with the Real-Time Analysis Software 6.0 of Rotor-Gene Amount.With soybean house-keeping geneTefS1 For reference gene.Relative expression quantity is that the expression quantity of purpose gene and house-keeping gene are expressed The ratio of amount.

The result shows that：GmPHF1bFor constitutive expression gene, there is expression in leaf, stem, root, root nodule and Huadu；Low-phosphorous enhancing It is expressed, referring to fig. 2.

Embodiment 3, the subcellular localization of GmPHF1b

1 vector construction

According to GmPHF1b Full-length cDNA primers add respectively in the upstream primer and downstream primer of carrierBamI restriction enzyme site of H, primer are as follows：

PHF1b- F: GTggatccATGGGGAATGATGCAGGGTC；

PHF1b- R: GTggatccTCagTCACATATCTACTGGCCCCCAA；

Using the cDNA of Wild-type soy root as template, with Ex Taq（TAKALA, Japan）It amplifiesGmPHF1b Gene Segment is connected in the pBI121-GFP carrier with corresponding digestion after the recycling of PCR product with digestion, chooses clone's digestion detection simultaneously Sequencing is merged correctly clone and is saved backup.After obtaining required recombinant vector, plasmid is transformed into Agrobacterium GV3101 sense By in state cell, it is spare to shake bacterium.

2 Transformation of tobacco

The resulting GV3101 positive colony containing recombinant vector of above-mentioned conversion is vibrated to training in 5 mL YEP culture mediums respectively It supports, 28 DEG C, until OD 600 reaches 1-1.5 or so, 4000 g 15 minutes are collected by centrifugation, and remove supernatant.Training is converted with the AS of 1 mL It supports the outstanding thallus obtained of base weight and is diluted to OD 600 between 0.7-0.8 with AS culture medium, dark place is quiet as mother liquor It sets 2 hours.Use syringe（Remove syringe needle）Draw the bacterium containing target protein gene plasmid bacterium solution and containing ER marker plasmid Liquid, volume ratio 1:1 mixing, in blade lower epidermis, presses lightly on, is repeated several times, until forming apparent infiltration spot, repeats to grasp according to this Make, every tobacco can convert the bacterium solution of 3 same histones.Treated, and plant grows 2 days, i.e. sampling under normal operation Observation.The negative control of blank control and empty carrier conversion is set.

3 microexaminations

Transformed blade underlying epidermis layer is taken, it is lower under laser confocal microscope or other fluorescence microscopes to observe fluorescence The case where, and photograph to record.The fluorescence exciting wavelength section of GFP albumen is 490-515 nm, and maximum emission wavelength section is 520-560 nm。

The result shows that：The subcellular localization of GmPHF1b and ER marker common location are on ER, referring to Fig. 3.

The interaction of embodiment 4, GmPHF1a and GmPT5/7 albumen in yeast

This experiment uses DUAL membrane pairwise interaction kit（Dualsystems Biotech is public Department）The Yeast expression carrier pBT3-C, pPR3-N and yeast strain NMY51 of offer carry out film double miscellaneous analysis.

The double miscellaneous vector constructions of 1 yeast

Respectively by GmPT5, GmPT7 protein fusion in pBT3-C bait（bait）In carrier, GmPHF1b is as prey （prey）Fusion is in pPR3-N carrier.According to their full-length cDNA primers.Primer is as follows：

PT5-XbaI- pBT3CF: AAtctagaCGATGGGGAAGGAGCAAGTTCA；

PT5- HindIII-pBT3CR: ACaagcttGACACCTTGGTCTCCTCTTCTTG；

PT7-XbaI- pBT3CF: AAtctagaCGATGGCGGGAGGACAACTA；

PT7-HindIII-pBT3CR: ACaagcttGAAACTGGAACCGTCCTAGCAG；

PHF1b-BamHI-pPR3NF: GTggatccATGGGGAATGATGCAGGGTC；

PHF1b-EcoR I-pPR3NR: GTaggaatTCagTCACATATCTACTGGCCCCCAA；

Using the cDNA of Wild-type soy root as template, with Ex Taq（TAKALA, Japan）It amplifies GmPTs（From starting Codon ATG is to the previous base of terminator codon）,GmPHF1b（From initiation codon ATG to terminator codon）Base Because of segment, digestion is carried out after the recycling of PCR product, is connected to the pBT3-C carrier of corresponding digestion（bait）With pPR3-N carrier （prey）In, it chooses clone's digestion and detects and be sequenced, merge correctly clone and save backup.

The preparation and conversion of 2 competent yeast cells

1. the NMY51 in 3 mL YPAD inoculation of medium, one 2-3 mm size is cloned, and 30 DEG C, 250 rpm oscillation Overnight incubation, is inoculated in 10mL YPDA culture medium for second day, and 30 DEG C, 250 rpm shaken cultivations to OD600=0.6-0.8；

2. 2500 g room temperatures are centrifuged 5 minutes, supernatant is abandoned, is resuspended with 0.5 mL aqua sterilisa；

3. preparing PEG/LioAc master Mix when centrifugation.It is added in 1.5 mL centrifuge tubes（5 reactions）：1.2 mL 50% PEG, 180 μ l 1M LioAc, 125 μ l single-stranded carried DNA；

4. dispensing 300 μ l PEG/LioAc master Mix into 1.5 mL centrifuge tubes, 1.5 μ g carriers are added（Interaction Each 1.5 μ g of two plasmids）, be vortexed concussion mixing,

5. dispensing the bacterium solution after 100 μ l are resuspended into above-mentioned 1.5 mL centrifuge tube, mix gently, 42 DEG C of water-baths are incubated for 45 points Clock；

6. 700 g room temperatures are centrifuged 5 minutes, supernatant is abandoned, 100 μ l, 0.9% NaCl is added, resuspension is coated on auxotroph plate On（SD-leu-trp）, 30 DEG C are cultivated 2 to 3 days；

7. in 3 one above-mentioned monoclonal of mL YPAD inoculation of medium, 30 DEG C, 250 rpm shaken cultivations are stayed overnight, the OD600=0.2 is diluted to 0.9% NaCl within two days, put 10 μ l on auxotroph plate（SD-leu-trp-his）, 30 DEG C culture 2 to 3 days；

8. an aseptic filter paper is covered on the above-mentioned plate for growing yeast 10 minutes, then filter paper is put into liquid nitrogen and freezes 5 Minute, there is the one side of yeast to be put in sterile culture dish upward, then by the agar containing 40 mg/L X-Gal（With The PBS configuration of pH7.4 contains 0.5% agarose solution, is cooled to 50 DEG C of addition X-Gal）It is poured on filter paper, avoid light place mistake Night, it is seen that yeast is dyed to blue.

The result shows that：Pass through the interaction of GmPHF1b and GmPT5/ GmPT7 albumen, activation lacZReporter gene turns Record（Nbu I is positive control, and NbuG is negative control）, should be the result shows that GmPHFlb and GmPT5/ GmPT 7 exists mutually Make, referring to fig. 4.

The interaction of embodiment 5, GmPHF1b and GmPT5/7 albumen in tobacco leaf

Bimolecular fluorescence interaction technology（Bimolecular Fluorescence Complementation, BiFC）It is a kind of The method for being widely used in research protein-protein interaction.

1 BiFC vector construction and conversion

GmPT5, GmPT7 albumen are merged respectively in pSAT6- nEYFP-C1 respectively（E2884）In carrier, by GmPHF1b Fusion is in pSAT6- cEYFP-N1（E2914）In carrier.According toGmPHF1b,GmPTsFull-length cDNA sequence design is drawn Object.Primer is as follows：

PT5- HindIII-E2884-F： ATCGaagcttATGGGGAAGGAGCAAGTTCA；

PT5-BamHI-E2884-R： ATCGggatccTTACACCTTGGTCTCCTCTTCTTG；

PT7- HindIII-E2884-F： ATCGaagcttATGGCGGGAGGACAACTA；

PT7-BamHI-E2884-R： ATCGggatccTTAAACTGGAACCGTCCTAGCAG；

PHF1b- HindIII-E2914-F： ATCGaagcttGATGGGGAATGATGCAGGGT；

PHF1b-BamHI-E2914-R： ATCGggatccCCATATCTACTGGCCCCCAAA；

Using the cDNA of Wild-type soy root as template, with Ex Taq（TAKALA, Japan）It amplifies GmPT5、GmPT7、GmPHF1bGenetic fragment carries out digestion after the recycling of PCR product, is connected to the pSAT6- nEYFP-C1 of corresponding digestion（E2884）With pSAT6- cEYFP-N1（E2914）It in carrier, chooses clone's digestion and detects and be sequenced, merge correctly clone and save backup.It obtains After required recombinant vector, plasmid is transformed into Agrobacterium GV3101 competent cell, it is spare to shake bacterium.

The Transformation of tobacco of 2 BiFC

Take the bacterium solution 1 containing target interaction GFP segment:1（The bacterium solution of PHF1b respectively with PT5, PT7 and empty carrier Bacterium solution）Mixing carries out Transformation of tobacco.

3 microexaminations

Transformed blade underlying epidermis layer is taken, is occurred in laser confocal microscope or other fluorescence microscopy microscopic observation fluorescence Situation, and photograph to record.The fluorescence exciting wavelength section of YFP albumen is 490-515 nm, and maximum emission wavelength section is 520-560 nm。

The result shows that：The combination of GmPHFlb and GmPT5/7 drives the amino-terminal fragment and carboxy terminal fragment weight of YFP New assembling forms fluorescent composition, restores fluorescent effect, and negative control illustrates GmPHFlb and GmPT5/7 then without fluorescence There are interactions in plant, referring to Fig. 5.

Embodiment 6, overexpressionGmPHF1b Influence to soybean nodulation

1 vector construction

The building of over-express vector, according to GmPHF1b Full-length cDNA primers, carrier upstream primer and under Trip primer adds respectivelyPstI HeNruI restriction enzyme site, primer are as follows：

PHF1b- PstⅠ-F： ATCGctgcagGATGGGGAATGATGCAGGGT；

PHF1b- NruⅠ-R： ATCGtcgcgaCCATATCTACTGGCCCCCAAA；

Using the cDNA of Wild-type soy root as template, with Ex Taq（TAKALA, Japan）It amplifiesGmPHF1bGene Segment carries out double digestion, is connected in the pTF101.1 carrier of corresponding digestion after the recycling of PCR product, chooses clone's digestion detection And be sequenced, correctly clone saves backup.After obtaining required recombinant vector, plasmid is transformed into Agrobacterium EHA105 impression In state cell, it is spare to shake bacterium.

2 obtain Transgenic soybean plants by Agrobacterium tumefaciens mediated cotyledonary node method for transformation

1）Seed is sprouted：It is taken after surface sterilization is dried 14 hours in the smooth unabroken soya seeds in surface in chlorine Out, it is placed in superclean bench and blows 30 min removing chlorine, be then seeded on germination medium, 28 DEG C of illumination cultivations 4 It.

2）Agrobacterium bacterium solution prepares：2 mL, which are put into, from picking monoclonal on fresh YEP plate is added to final concentration 50ug/ It in the kanamycins of ml and the YEP fluid nutrient medium of 50ug/ml streptomysin, shakes and is incubated overnight, 2 mL is therefrom taken to be saturated bacterium solution In the YEP liquid added with 250 mL of corresponding antibiotic, is shaken in 28 DEG C to overnight, bacterium colony is collected by centrifugation, with CM liquid Body suspension bacteria liquid to OD650 be 1.0（EHA101）Or 0.5（EHA105）.

3）It co-cultures：Bacterium solution is poured into culture dish, the seed of germination is cut with scalpel, is vertically cutd open along cotyledon hypocotyl Bean or pea are opened, the young shoot on plumular axis is removed, cuts out 8 notch perpendicular to axis in cotyledonary node region；The explant cut is put into Have and infected in the culture dish of suspension bacteria liquid 30 minutes, explant is transferred to tweezers and is co-cultured on base, notch is downward, after sealing Dark culture 3 days in incubator.

4）Young shoot induction：After co-culturing 3 days, with liquid young shoot induced medium（SI）Explant is embathed, then will Explant is placed on SI culture medium, after explant is grown 14 days on SI culture medium, is flushed and is cut at cotyledonary node position The wound newly exposed is inserted into new SI culture medium by cotyledonary node hypocotyl, continues culture 14 days.

5）Shoot growth：The cotyledon on differentiation explant is cut, and cuts a new notch in the base portion of section, then will Explant is transferred to young shoot elongation medium（SE）On, it is grown 2-8 weeks in culturing room, changes primary new SE training every two weeks Base is supported, cuts a fresh horizontal cut in the base portion of explant every time.

6）It takes root：When shoot growth is to 3 cm long, they are cut from tissue, is transferred it to equipped with life It cultivates in the culture bottle of root culture medium, after 2 weeks, after seedling grows enough, is transferred into matrix in incubator Middle culture 4 weeks, is then transferred to hot-house culture to bearing pods for seedling.

The detection of 3 transgenic plants

(1) herbicide screening：Chosen in transgenic plant it is a piece of in the trifoliolate leaf being fully deployed, with marking pen in half It marks, the other half is dipped with cotton swab observes blade variation after the herbicide diluted is applied to face of blade 2-3 days.If Blade occurs chlorosis, turns yellow, and the generation of withered or coloured speckle then illustrates the plant not antiweed, for negative non-transgenic Material；If blade is there is no variation, illustrating has Herbicid resistant in its plant may be positive plant.This experiment is used Herbicide Liberty, originate from France.

(2) the PCR identification of whole strain converting material：The T of antiweed₀After harvesting seed for plant, T is carried out₁Generation Breeding, T₁ For Dai Miao by preliminary herbicide screening, the plant of antiweed collects root nodule, extracts RNA, is inverted to cDNA It uses later Bar Gene primer carries out PCR identification, detects positive plant and carries out quantitative fluorescent PCR detection.Primer is such as Under：

Bar-F: gaagatctATGAGCCCAGAACGACGC

Bar-R: gACTAGTTCAAATCTCGGTGACGGGC

(3) quantitative fluorescent PCR detects：WithGmPHF1b Quantitative primer（See embodiment 2）It detects in positive plantGmPHF1bExpression quantity.

The processing of 4 transgenic plants

Two overexpressions GmPHF1bStrain and wild type, sprout after 7 days seedling inoculation rhizobium in high phosphorus（250 μM KH₂PO₄）, it is low-phosphorous（5 μM KH₂PO₄）, low nitrogen（530 μM N）It is grown in nutrient solution.Grow to collect within 20 days root nodule into Row qualitative PCR detects marker geneBarGene, then detected by fluorescence quantitative RT-RCRGmPHF1bExpression quantity；It collects 3 repeat the measurement of root nodule numbers and weight.

Fig. 6 A-F is overexpressionGmPHF1b Influence to soybean nodulation.Wherein：

Fig. 6-A is that blade applies herbicide positive plant；

Fig. 6-B is that PCR detects positive plant；

Fig. 6-C is quantitative PCR detectionGmPHF1bExpression quantity；

Fig. 6-D is root nodule picture；

Fig. 6-E is nodule number；

Fig. 6-F is root nodule fresh weight.

Relative expression quantity is purpose geneGmPHF1bExpression quantity and soybean house-keeping gene in root noduleTefS1（Gene Sequence number: X56856）The ratio of expression quantity, and conversion is standardized for 1 with the relative expression quantity of WT under high phosphorus.

WT：WT strain；OX：GmPHF1bOverexpression strain.It is 3 biology of same genetically modified plants in figure Duplicate average value and standard error.

Asterisk indicates that same character otherness between OX strain and control WT strain compares（T- test）；

* the level of signifiance 0.01 is indicated<pWhen≤0.05, significant difference；

* indicates the level of signifiance 0.001< pWhen≤0.01, the significance of difference between it is significant with it is extremely significant between；

* * indicates the level of signifiancepWhen≤0.001, difference is extremely significant.

The result shows that：Compared with the control, interfereGmPHF1b (OX) nodule number and fresh weight, explanation are dramatically increasedGmPHF1bInfluence the development of root nodule.

Embodiment 7, interferenceGmPHF1b To soybean growth and the influence of plant the content of nitrogen and phosphorous

The measurement of plant the content of nitrogen and phosphorous first by plant each section sample comminution, uses H₂SO₄-H₂O₂Method, which disappears, boils, then by certain Ratio draws the boil liquid that disappears, and utilizes Flow Analyzer（SKALAR SAN ++ , Netherlands）Carry out nitrogen and phosphorus yield.

Nutrient content in plant indicates that calculation formula is with unit plant nitrogen, phosphorus amount：

Nitrogen content（mg/plant）=nitrogen concentration（mg/g）× plant weights（g/plant）

Phosphorus content（mg/plant）=phosphorus concentration（mg/g）× plant weights（g/plant）

Fig. 7 A-C is interferenceGmPHF1b To soybean growth and the influence of plant the content of nitrogen and phosphorous.Wherein：

Fig. 7-A is plant fresh weight；

Fig. 7-B is total nitrogen content；

Fig. 7-C is plant content of tatal phosphorus.

WT：WT strain；OX：GmPHF1bOverexpression strain.

Test data is the duplicate average value of 3 biology of same genetically modified plants and standard error.

Asterisk indicates that same character otherness between OX strain and control WT strain compares（T- test）；

* the level of signifiance 0.01 is indicated<pWhen≤0.05, significant difference；

* indicates the level of signifiance 0.001<pWhen≤0.01, the significance of difference between it is significant with it is extremely significant between；

* * indicates the level of signifiancepWhen≤0.001, difference is extremely significant.

The result shows that：InterferenceGmPHF1bThe growth for remarkably promoting dross soybean improves full nitrogen, the content of tatal phosphorus of soybean And biomass.

Embodiment 8, interferenceGmPHF1b Influence to soybean yields

1 water culture experiment：2 overexpressions GmPHF1bStrain and wild type, after sprouting 7 days seedling inoculation rhizobium In normal phosphorus concentration（250μM KH₂PO₄）Low nitrogen（530 μM N）It is grown 25 days in nutrient solution, later in 1/2 nitrogen（2650 μM N）Harvest seed is grown in nutrient solution.Count kernal number and seed dry weight.

2 field experiments：2 overexpressions GmPHF1bStrain and the seed of wild type mix and broadcast in good fortune after rhizobium State midocean base carries out the screening of blade face Herbicid resistant after sowing two weeks, and then thinning removes not the negative of antiweed and plants Strain finally harvests seed, counts kernal number and seed dry weight.

Fig. 8 A-D is interferenceGmPHF1b Influence to soybean yields.Wherein：

Fig. 8-A is the kernal number of water culture experiment；

Fig. 8-B is the seed dry weight of water culture experiment；

Fig. 8-C is the kernal number of field experiment；

Fig. 8-D is the seed dry weight of field experiment.

WT：WT strain；OX：GmPHF1bOverexpression strain.

Test data is that a biology of same genetically modified plants 3 (water culture experiment)/30 (field experiment) is duplicate Average value and standard error.

Asterisk indicates that same character otherness between OX strain and control WT strain compares（T- test）；

* the level of signifiance 0.01 is indicated<pWhen≤0.05, significant difference；

* indicates the level of signifiance 0.001<pWhen≤0.01, the significance of difference between it is significant with it is extremely significant between；

* * indicates the level of signifiancepWhen≤0.001, difference is extremely significant.

The result shows that：InterferenceGmPHF1b Dramatically increase the kernal number and seed dry weight of dross soybean.

In conclusion the transhipment helper factor of phosphate cotransporterGmPHF1bThere is gene regulation leguminous plant to be increased with phosphorus The new function of nitrogen.Under conditions of low nitrogen handles Rhizobium Inoculation, the root nodule number of the overexpression soybean of gene of the present invention Amount, weight, full nitrogen and content of tatal phosphorus, biomass and yield are all remarkably higher than WT strain,GmPHF1bCultivating nitrogen, phosphorus association There is important application value with high-efficient transgenic leguminous plant and in terms of improving crop yield.

It should be noted that the above embodiments do not limit the invention in any form, it is all to use equivalent replacement or equivalent change The mode changed technical solution obtained, falls within the scope of protection of the present invention.

SEQUENCE LISTING

<110>University Of Agriculture and Forestry In Fujian

<120>The application of the transhipment helper factor GmPHF1b of phosphate cotransporter

<130> 21

<160> 21

<170> PatentIn version 3.3

<210> 1

<211> 1188

<212> DNA

<213>Artificial sequence

<400> 1

atggggaatg atgcagggtc acctcagggt ccggttacgt gtgggtcgtg gattcggagg 60

cctgagaatt tgaacttggt ggtgttagga aggtccagac gtggcaattc ttgtccttct 120

ctcttggaga ttttctcctt cgatcccaag accacttctc tgtctacctg tcctctgacc 180

acttatgtgt tggaagcaga ggaaggtgat cctgttgcta ttgcagtcca cccaagtggg 240

gatgattttg tgtgcgctct cagcaatggt agctgcaaat tgtttgagct gtatggtcgt 300

gaaacaaaca tgaagttgtt ggctaaggaa ctggctcctc tacagggtat tggtcctcag 360

aaatgcattg cttttagtgt tgatgggtct aaatttgctg ctggtgggtt ggatggacat 420

ctcagaatta tggagtggcc tagtatgcgc gtgattttgg atgaaccaag agcacacaaa 480

tcagttcggg atatggattt tagtctagac tcagaatttc tagcttcaac ttctactgat 540

ggttcagcaa gaatctggaa gattgaagat ggtgttcctt tgactacttt gtctcgcaac 600

tcggatgaaa agattgaatt atgtcgattt tccatggatg gaaccaaacc atttttattt 660

tgctctgttc aaaaagcagg tgatacttct gtcactgcgg tttatgagat tagcacatgg 720

aataaaattg ggcacaagag gctgattaga aagtctgctt cagtaatgtc cattagccat 780

gatgggaaat acctttctct gggcagtaaa gatggagaca tatgtgtagt tgaagtaaag 840

aaaatgcaga tataccatta tagcaagaga ttgcacctgg gtacaaatat tgcatatctg 900

gagttctgtc ccggggaaag ggttttactt acaacctcag tagaatgggg agcgctggtc 960

accaagctga ctgtacctaa agattggaaa gagtggcaga tctatttggt gctattggga 1020

ctatttttag catcagctgt tgcattttac atattctttg agaactctga ttcattctgg 1080

aactttccca tgggcaaaga ccaaccagca agaccaaggt ttaaacctgt gttaaaagat 1140

ccccagtctt atgatgacca aaatatttgg gggccagtag atatgtga 1188

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

tgggtcgtgg attcggaggc 20

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<400> 3

ccccacttgg gtggactgca a 21

<210> 4

<211> 28

<212> DNA

<213>Artificial sequence

<400> 4

gtggatccat ggggaatgat gcagggtc 28

<210> 5

<211> 34

<212> DNA

<213>Artificial sequence

<400> 5

gtggatcctc agtcacatat ctactggccc ccaa 34

<210> 6

<211> 29

<212> DNA

<213>Artificial sequence

<400> 6

aatctagacg atggggaagg agcaagttc 29

<210> 7

<211> 31

<212> DNA

<213>Artificial sequence

<400> 7

acaagcttga caccttggtc tcctcttctt g 31

<210> 8

<211> 28

<212> DNA

<213>Artificial sequence

<400> 8

aatctagacg atggcgggag gacaacta 28

<210> 9

<211> 30

<212> DNA

<213>Artificial sequence

<400> 9

acaagcttga aactggaacc gtcctagcag 30

<210> 10

<211> 28

<212> DNA

<213>Artificial sequence

<400> 10

gtggatccat ggggaatgat gcagggtc 28

<210> 11

<211> 34

<212> DNA

<213>Artificial sequence

<400> 11

gtaggaattc agtcacatat ctactggccc ccaa 34

<210> 12

<211> 30

<212> DNA

<213>Artificial sequence

<400> 12

atcgaagctt atggggaagg agcaagttca 30

<210> 13

<211> 34

<212> DNA

<213>Artificial sequence

<400> 13

atcgggatcc ttacaccttg gtctcctctt cttg 34

<210> 14

<211> 28

<212> DNA

<213>Artificial sequence

<400> 14

atcgaagctt atggcgggag gacaacta 28

<210> 15

<211> 33

<212> DNA

<213>Artificial sequence

<400> 15

atcgggatcc ttaaactgga accgtcctag cag 33

<210> 16

<211> 30

<212> DNA

<213>Artificial sequence

<400> 16

atcgaagctt gatggggaat gatgcagggt 30

<210> 17

<211> 31

<212> DNA

<213>Artificial sequence

<400> 17

atcgggatcc ccatatctac tggcccccaa a 31

<210> 18

<211> 30

<212> DNA

<213>Artificial sequence

<400> 18

atcgctgcag gatggggaat gatgcagggt 30

<210> 19

<211> 31

<212> DNA

<213>Artificial sequence

<400> 19

atcgtcgcga ccatatctac tggcccccaa a 31

<210> 20

<211> 26

<212> DNA

<213>Artificial sequence

<400> 20

gaagatctat gagcccagaa cgacgc 26

<210> 21

<211> 26

<212> DNA

<213>Artificial sequence

<400> 21

gactagttca aatctcggtg acgggc 26

Claims (3)

1. the transhipment helper factor of phosphate cotransporterGmPHF1bIn legume nitrogen, phosphorus collaboration efficiently and in raising yield Using.

2. application according to claim 1, which is characterized in that the transhipment helper factor of phosphate cotransporterGmPHF1bIt expresses in leguminous plant leaf, stem, root, root nodule and in spending.

3. application according to claim 1, which is characterized in that transhipment helper factorGmPHF1bSequence such as SEQ ID Shown in NO.1.